ID: 1091410078

View in Genome Browser
Species Human (GRCh38)
Location 12:233437-233459
Sequence TGCACTCCCTCTACTACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091410078_1091410085 -2 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410085 12:233458-233480 CAGACCACGAAGGAAGGGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 219
1091410078_1091410083 -4 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410083 12:233456-233478 TGCAGACCACGAAGGAAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 229
1091410078_1091410086 1 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410086 12:233461-233483 ACCACGAAGGAAGGGTGGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 357
1091410078_1091410088 9 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410088 12:233469-233491 GGAAGGGTGGGGAGGAGACCCGG 0: 1
1: 1
2: 14
3: 145
4: 1278
1091410078_1091410082 -7 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410082 12:233453-233475 GAGTGCAGACCACGAAGGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 152
1091410078_1091410081 -8 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410081 12:233452-233474 GGAGTGCAGACCACGAAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 201
1091410078_1091410092 30 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410092 12:233490-233512 GGAGCCTCTGGACAACTGACAGG 0: 1
1: 0
2: 0
3: 12
4: 125
1091410078_1091410084 -3 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410084 12:233457-233479 GCAGACCACGAAGGAAGGGTGGG 0: 1
1: 0
2: 2
3: 10
4: 171
1091410078_1091410089 18 Left 1091410078 12:233437-233459 CCCGCTGTAGTAGAGGGAGTGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1091410089 12:233478-233500 GGGAGGAGACCCGGAGCCTCTGG 0: 1
1: 0
2: 2
3: 34
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091410078 Original CRISPR TGCACTCCCTCTACTACAGC GGG (reversed) Intronic
903368717 1:22820625-22820647 TGCACTCCATGCACTCCAGCCGG + Intronic
907850474 1:58250290-58250312 CGCTCGCCCTCTACTGCAGCCGG - Intronic
910587496 1:88895632-88895654 TGCACTGCCTCGGCTTCAGCAGG - Intergenic
914814443 1:151053168-151053190 TGGACTCCCTCTACTCCCTCTGG - Exonic
918570806 1:185989590-185989612 TGCACTGCCACCAATACAGCCGG + Exonic
921637893 1:217518745-217518767 TTCTCTCCCTCTAGTATAGCTGG + Intronic
1067920341 10:50449359-50449381 TGCACTCCCTCCACCACCCCAGG - Intronic
1068087645 10:52394425-52394447 TGCACACCATCTGCTTCAGCTGG + Intergenic
1068576694 10:58691766-58691788 TGCACTCACCCCACTACTGCAGG + Intronic
1070838036 10:79463601-79463623 TTCACTCTCTCTTCTGCAGCTGG + Intergenic
1072642590 10:97223327-97223349 TGCTCTTTCACTACTACAGCAGG + Exonic
1072906656 10:99460240-99460262 TGCACTTCCTCTTCTACATCTGG - Intergenic
1073686659 10:105761789-105761811 TGCACTGGCTCTACTACACATGG - Intergenic
1078613292 11:12840901-12840923 TGCCCTCCCTGTCCTTCAGCTGG + Intronic
1079861935 11:25683874-25683896 TTCACTCTCTCTTCTAGAGCAGG + Intergenic
1080955145 11:37084554-37084576 TGCACAACATCTACTAAAGCTGG + Intergenic
1089129831 11:116202939-116202961 GGCTCTCCCTCTACCCCAGCAGG - Intergenic
1089441344 11:118520098-118520120 TGCTTTCCCTCTCCTCCAGCTGG + Intronic
1090484734 11:127102775-127102797 TGCTCTCTCTCTCCTTCAGCTGG - Intergenic
1090839590 11:130476513-130476535 TGCACTCCATGTACTGCAGAAGG + Exonic
1091410078 12:233437-233459 TGCACTCCCTCTACTACAGCGGG - Intronic
1093102576 12:15045636-15045658 TGCACTGCCTCTCATGCAGCTGG - Intergenic
1096629973 12:52920244-52920266 TGTACTACCTCTCCTACAGTAGG + Intronic
1097392544 12:59033360-59033382 TGCACTCCCACTCCCATAGCTGG - Intergenic
1097940722 12:65302337-65302359 GCCACTCCCTCTCCTAAAGCTGG + Intronic
1109982179 13:69923738-69923760 TGCACCTCCTCCACTGCAGCTGG - Intronic
1113466181 13:110514729-110514751 TCCACTCACTATACTTCAGCGGG - Intergenic
1119171458 14:72539166-72539188 TAGCCTCCCTCTACTACAGGAGG - Intronic
1129091509 15:73156457-73156479 TGGTCTACCTCTACTACAACAGG - Intronic
1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG + Intergenic
1141503675 16:84461348-84461370 AGCTCTCCCTCTACTACTGACGG + Intronic
1143095595 17:4476853-4476875 TGCTCTCCCTCCACCAGAGCTGG + Intronic
1144997568 17:19281034-19281056 TGCACTCCTTCTCCCACACCTGG - Intronic
1152224724 17:79087457-79087479 TGCACAGCCTCTGCTACACCTGG + Intronic
1154172530 18:12061743-12061765 TGCACTCCCTGTGCTCGAGCAGG - Intergenic
1163248414 19:16111531-16111553 TGCCTTCCCTCTCCTACAGTGGG + Intergenic
1165185786 19:34019964-34019986 TACACTCCCTCTTCTACCTCTGG + Intergenic
1167760722 19:51446698-51446720 TGCACTCCCTTGATCACAGCAGG + Intergenic
1168689316 19:58367286-58367308 TGCACACCCTCTACCGTAGCCGG - Intergenic
925887728 2:8407625-8407647 TTCACTCCCTCTGCTTGAGCTGG + Intergenic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
934952182 2:98584352-98584374 TGCACTCCCACTTCCACAGCAGG + Intronic
939996043 2:148920982-148921004 TGCTCACCCTCTTCCACAGCCGG - Intronic
947707051 2:232284807-232284829 TGCACTGCCTCTAATACTGAGGG - Intronic
1169417852 20:5432939-5432961 TTCACTCCCTCTACTTGAGCTGG - Intergenic
1171331972 20:24348377-24348399 TGCACTCCCAATGCCACAGCAGG + Intergenic
1173552604 20:43943294-43943316 TAAACTCCCTCTCCTACAGATGG + Intronic
1174515204 20:51086707-51086729 TGCACTCCACCTGCGACAGCGGG - Intergenic
1175023925 20:55881156-55881178 TGCACTCCCACTACAAAAACGGG + Intergenic
1178971082 21:37177444-37177466 TGCCATCCCTCCACTACAGTAGG + Intronic
953385064 3:42501738-42501760 TGCATTCCCTATTTTACAGCTGG - Intronic
953984341 3:47429751-47429773 TGCTTTCACTCTACAACAGCAGG + Intronic
958778543 3:98513987-98514009 TGCACACACACAACTACAGCAGG + Intronic
962697316 3:137962957-137962979 AGCACTTCCTCTACAATAGCAGG + Intergenic
967966421 3:194963752-194963774 TTGACTCCCTCTTCTTCAGCTGG + Intergenic
968332364 3:197882129-197882151 GGCACTCCCTCTAGTCCAGCTGG + Intronic
969541012 4:7788894-7788916 TGCACTCACCCTGCTGCAGCAGG + Intronic
970270219 4:14338726-14338748 AGCACTCTTTCTTCTACAGCAGG - Intergenic
976301458 4:83519518-83519540 TACCCTCCCTTTACTAAAGCAGG - Intronic
984368626 4:178831653-178831675 TTCACTCCCTCTTCTTGAGCTGG - Intergenic
992414563 5:76539919-76539941 TGCCCTCACTCTGCTACTGCAGG - Intronic
994908412 5:105869349-105869371 TGCACTCCCATAACTCCAGCAGG - Intergenic
997259823 5:132457248-132457270 TGCACTGCCCCTCCCACAGCAGG + Intronic
1000191454 5:158914813-158914835 TGCACTGCTGCTACTTCAGCAGG - Intronic
1003244282 6:4370996-4371018 TTCACTCCCTCTGCTTGAGCTGG - Intergenic
1003403688 6:5811051-5811073 TGCAATCCCTCTAGCACACCAGG - Intergenic
1003874741 6:10425710-10425732 TTCACTCCCTCTAATTTAGCAGG - Intergenic
1004561257 6:16753347-16753369 TGCACTCCCTCGACCATTGCAGG - Exonic
1005781765 6:29200829-29200851 TGCATCTCCCCTACTACAGCCGG - Intergenic
1008638000 6:53431782-53431804 TCAACACCCTCTACTACAACAGG - Intergenic
1014650985 6:124037052-124037074 TGCACTCCCTCACCTACTGCAGG + Intronic
1017262665 6:152405117-152405139 TACACTCACTATACTGCAGCGGG + Intronic
1021510772 7:21429548-21429570 TGCACTCCCGTTATTACTGCTGG - Exonic
1028139252 7:87254675-87254697 GGGACTCACTCTACTCCAGCTGG + Intergenic
1030756210 7:113291112-113291134 TGCACCTCCCCTACTGCAGCCGG - Intergenic
1032784009 7:135186471-135186493 TGCACTTTCCCAACTACAGCTGG + Intronic
1034463820 7:151213879-151213901 TGCACTCTCTTACCTACAGCTGG - Intronic
1034967818 7:155402386-155402408 TGTACTCCGTCCACCACAGCGGG + Intergenic
1036094757 8:5711515-5711537 TGCATTCCCTCTTCTTGAGCTGG - Intergenic
1045723245 8:105139245-105139267 TGCACTATCTCTCTTACAGCCGG - Intronic
1048804856 8:138230534-138230556 TGAAAGCCCTCTACTGCAGCTGG + Intronic
1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG + Intronic
1049384760 8:142337624-142337646 AGCACTGCCTCTGCTACTGCTGG + Intronic
1052354479 9:27490168-27490190 TCCAATCCCCCTACTACAGATGG + Intronic
1056975119 9:91245822-91245844 TGCACTCCCTCTAGAACACAGGG - Intronic
1057934785 9:99227907-99227929 TGCACTCCTTGTCCCACAGCTGG - Exonic
1196064242 X:111445192-111445214 TAAACTCCCTCTTCCACAGCGGG + Intergenic
1196515577 X:116606567-116606589 TACATTCCCTCTTCTCCAGCTGG + Intergenic
1198683517 X:139205117-139205139 AGCTCTCCTTTTACTACAGCGGG - Intronic