ID: 1091410696

View in Genome Browser
Species Human (GRCh38)
Location 12:237347-237369
Sequence AGCTCCACTGTCCCAGGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091410696_1091410706 30 Left 1091410696 12:237347-237369 CCCCGTCCTGGGACAGTGGAGCT 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1091410706 12:237400-237422 TTCTCTGCTCTCTTCACATGAGG 0: 1
1: 0
2: 2
3: 31
4: 374
1091410696_1091410700 -8 Left 1091410696 12:237347-237369 CCCCGTCCTGGGACAGTGGAGCT 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1091410700 12:237362-237384 GTGGAGCTGAGCCTGCCTCCAGG 0: 1
1: 0
2: 3
3: 35
4: 390
1091410696_1091410702 6 Left 1091410696 12:237347-237369 CCCCGTCCTGGGACAGTGGAGCT 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1091410702 12:237376-237398 GCCTCCAGGCTCTTGTCCAAAGG 0: 1
1: 0
2: 0
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091410696 Original CRISPR AGCTCCACTGTCCCAGGACG GGG (reversed) Intronic
900375089 1:2350600-2350622 CGCTCCACTGTCCATGGAAGAGG - Intronic
900404559 1:2486759-2486781 AGCTCCAGTGTCACATGACTTGG - Intronic
903653129 1:24932993-24933015 AGCTCCTTTGCCCCAGGAAGGGG + Intronic
904048700 1:27625099-27625121 AGCCCCACTGACCCAGGAGTAGG - Exonic
905042945 1:34975419-34975441 ACCTCCACTGTACCAAGACTTGG - Intergenic
906109554 1:43313583-43313605 TGATCCACTGTCCCAGGGCTGGG + Intronic
912722120 1:112028939-112028961 AGCAACACTGTCTCAGGGCGGGG + Intergenic
913958792 1:143323881-143323903 AGCTGCTCTGTGCCAGGAGGAGG - Intergenic
914053109 1:144149261-144149283 AGCTGCTCTGTGCCAGGAGGAGG - Intergenic
914126088 1:144817280-144817302 AGCTGCTCTGTGCCAGGAGGAGG + Intergenic
918378576 1:183932972-183932994 ATCTCCATTGTCCCTGGACAGGG - Intronic
919786201 1:201259998-201260020 AGCTCCACTGACGCGGGAGGTGG - Intergenic
920060392 1:203223253-203223275 AGCTCCACTCCCACAGGACTTGG - Exonic
923692348 1:236206918-236206940 AGCTCCCCTTTCCCAGGAACAGG - Intronic
924425278 1:243944598-243944620 AACTCCACTGTCTCAGGTAGTGG + Intergenic
924924551 1:248666246-248666268 AGCTCCACTGGCCAAGAAGGGGG + Intergenic
1063220120 10:3959550-3959572 ATCTCCACCTTCCCACGACGCGG + Intergenic
1063895420 10:10676342-10676364 AGCGCCACTGACCCAGGAGAAGG - Intergenic
1064934042 10:20660309-20660331 AACTCCACTGTTGCAGGCCGTGG - Intergenic
1065011139 10:21422167-21422189 AGCTCCACAGTTCTTGGACGGGG - Intergenic
1069318192 10:67134514-67134536 AGCTCCAGTTTCCCAGAACTTGG - Intronic
1071269635 10:83995058-83995080 AGCTCCACTATCCCATGATGTGG - Intergenic
1075703511 10:124484364-124484386 AGCTCCCCTTTCCCAGGGTGGGG + Intronic
1077090963 11:777940-777962 GGCTCCGCCGGCCCAGGACGGGG + Intronic
1077170872 11:1165176-1165198 AGCTCCAGGGGCCCAGGACGGGG - Intronic
1080637058 11:34133331-34133353 AGCTCCACTGTTGACGGACGGGG + Intronic
1082110675 11:48270493-48270515 AACTCCACTGCCTCAGGAAGTGG - Intergenic
1084661603 11:70549625-70549647 AGCTCCCCAGTCCCTGGCCGGGG - Intronic
1085784890 11:79440343-79440365 TGCTCCCCTGGCCCAGGAGGAGG - Intronic
1087638270 11:100727654-100727676 GGCTCCACCCTCCCAGCACGTGG - Intronic
1088540964 11:110913296-110913318 AGCTCCACTGGCCCAGGTGGAGG - Intergenic
1089745437 11:120613714-120613736 AGCTTCCCTGCCCCAGGACCTGG - Intronic
1091410696 12:237347-237369 AGCTCCACTGTCCCAGGACGGGG - Intronic
1091464123 12:669087-669109 AGCTCCACTGGCCGAGAAGGTGG - Intergenic
1092317518 12:7433631-7433653 ACCTCCACTGTCCCAGAGCAGGG + Exonic
1092501317 12:9050773-9050795 AGCTCCCCTGGCGCAGGACCTGG + Intergenic
1096235856 12:49925863-49925885 AGCTCCCCTGTCCAAGGCCCAGG - Intergenic
1096524932 12:52204905-52204927 TGCTCCACTGTCTCTGGGCGGGG + Intergenic
1097008412 12:55935554-55935576 GGCTCCATCGTCCCAGGACTGGG + Intronic
1100876689 12:98969269-98969291 ATCTCCACAGGCCCAGGAAGAGG + Intronic
1101444786 12:104729955-104729977 ATCTCACCTGTCCCAGGACTTGG + Intronic
1101779916 12:107825892-107825914 AGTTCCACTGTCCAGGGACAGGG + Intergenic
1105291549 13:19056678-19056700 ACCTCCACAGTCACAGGAGGAGG + Intergenic
1108314143 13:49221228-49221250 GGCTCCACTTACGCAGGACGCGG - Exonic
1108914948 13:55596531-55596553 AGGTTCACTGTCCTAGGAAGTGG + Intergenic
1112263403 13:97899503-97899525 AGCTCCACCATTCCAGGAAGGGG + Intergenic
1114267055 14:21078902-21078924 AGCTACACTGTATCAGGAAGTGG + Exonic
1116326493 14:43537731-43537753 AGTTCCACTGTCCAGGGACAGGG - Intergenic
1116803463 14:49467341-49467363 AGCGTCACAGTCCCAGGACAGGG + Intergenic
1121121208 14:91376890-91376912 AGCCCCACTTTCCCAGGTCTGGG - Intronic
1121912771 14:97806994-97807016 AGCTCCATTATCCCAGGGCCTGG + Intergenic
1122403260 14:101480157-101480179 AGCTCCGCAGGCCCAGGGCGAGG - Intergenic
1124412053 15:29444835-29444857 GGCTCCACAGTCCCTGGAGGGGG + Intronic
1128341224 15:66823836-66823858 AGCTGCACTACCCCAGGAAGTGG + Intergenic
1128924020 15:71637497-71637519 AGCTTCACTTTCCCTGCACGTGG - Intronic
1131134451 15:89922886-89922908 AGCACCACTGTGCCAGGCCTGGG + Intergenic
1132672172 16:1106431-1106453 GACTCCCCTGGCCCAGGACGGGG - Intergenic
1133104505 16:3498151-3498173 AGCTCCAATGTCCAAGGGCACGG + Intergenic
1133167788 16:3960945-3960967 AGTTTCACTTTCCCAGTACGCGG + Intronic
1133985954 16:10668408-10668430 AGCTCCACTTCCCCAGGGCTGGG + Intronic
1134409405 16:13991612-13991634 AGGTACACTGTCCCAGAACTGGG - Intergenic
1134808461 16:17145979-17146001 ACCTGCACTGTCCTAGGACCTGG - Intronic
1136147039 16:28321840-28321862 AGCCGCACTGTCCCAGGCCCAGG + Exonic
1137612779 16:49829994-49830016 CGCTCGACTGTCCCCGGACAGGG - Intronic
1137622546 16:49885637-49885659 TGCACCACTGTCCCAGCATGTGG - Intergenic
1137779892 16:51089131-51089153 AGAACCACAGTCCCAGGACTGGG + Intergenic
1137840760 16:51638847-51638869 AGCCCCACTGTCCCAGCAGCAGG - Intergenic
1139532310 16:67548356-67548378 ATCTGCACTTTCCCAGGACCTGG - Intergenic
1139825948 16:69757274-69757296 GGCTCCATAGTCACAGGACGAGG + Intergenic
1142033595 16:87850537-87850559 AGCTCCACAGCTCCAGGACTGGG + Intronic
1144299180 17:13907010-13907032 GGCTCCACTGTCCCATGAATTGG - Intergenic
1149656578 17:58312362-58312384 AGCTCCACTTGCTCAGGAGGCGG + Exonic
1152301943 17:79500083-79500105 GGCTCCCTGGTCCCAGGACGGGG + Intronic
1160199836 18:76787419-76787441 ACCTGCGCTGTCCCAGGACAGGG + Intergenic
1161248291 19:3267212-3267234 GGCTCCCCTGTGCCAGGATGAGG - Intronic
1161377435 19:3947216-3947238 AGGTCCACTGTCCCATGCCTGGG + Intergenic
1164735095 19:30535460-30535482 AGCTGCCCTGTCCCAGGTCTGGG - Intronic
1167612261 19:50513241-50513263 AGCTCCACTCTCCCATGGCAAGG + Intronic
1202692504 1_KI270712v1_random:101684-101706 AGCTGCTCTGTGCCAGGAGGAGG - Intergenic
925991482 2:9258633-9258655 AGCCACACTGCCCCAGGACCCGG - Intronic
927142283 2:20138711-20138733 ATCTCTCCTGGCCCAGGACGGGG + Intergenic
927495316 2:23548015-23548037 AGCTGAACTGTCCCAAGACAGGG - Intronic
929934295 2:46283025-46283047 AGCTGCAGTGTCCCTGGAGGGGG + Intergenic
931781038 2:65579669-65579691 AGCCACACTGACCCAGGAGGAGG + Intergenic
932143181 2:69297302-69297324 AGTTCCACACTCCCAGGACAAGG - Intergenic
933953896 2:87352287-87352309 AGCTGCTCTGTGCCAGGAAGAGG + Intergenic
934238097 2:90248533-90248555 AGCTGCTCTGTGCCAGGAGGAGG + Intergenic
934275102 2:91568203-91568225 AGCTGCTCTGTGCCAGGAAGAGG - Intergenic
934524275 2:95042025-95042047 AGCCTCACTGTCTCAGGATGGGG - Intronic
936039452 2:109138720-109138742 AGCTCCACAGCCCCAGCACCTGG - Intronic
939348024 2:140993507-140993529 AGCTTCACTGTCTCAGGACATGG - Intronic
940342791 2:152599001-152599023 AGCTCCATTGTCCAAGGGCAGGG + Intronic
943187013 2:184622409-184622431 AGCTCCATTTTCCCAGGTCTTGG - Intronic
1170365298 20:15591473-15591495 TGCCCCTCTGTCCCAGGAGGAGG + Intronic
1170787789 20:19482357-19482379 AGGACCACTGTTCCAGGAAGAGG - Intronic
1172222210 20:33281741-33281763 AGCTTTGCTGTCCCAGCACGTGG + Intronic
1172899267 20:38322158-38322180 AGCCCAAGTGTCCCAGGAGGGGG - Intronic
1173360644 20:42341601-42341623 ATCTACACTCTCCCAGGATGAGG + Intronic
1173922760 20:46758405-46758427 TGTTCAACTGTCCCAGGAGGTGG - Intergenic
1175230351 20:57469892-57469914 AGCTCAAATGTCCCAGGGCCAGG - Intergenic
1175904197 20:62371762-62371784 AGCTACACAGGCCCAGGCCGGGG - Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1178020743 21:28405710-28405732 AGCATGACTGTCCCATGACGTGG + Intergenic
1180037571 21:45257617-45257639 GGCTCCCCTGTCCCAGGACAGGG - Intergenic
1181851769 22:25754751-25754773 AGCTCCACTGACCCAGGGCCAGG - Intronic
1183315228 22:37133373-37133395 AGAACCACTGCTCCAGGACGAGG + Intronic
1183457175 22:37929255-37929277 AGCTCCCCTGTTCCATGGCGGGG - Intronic
1184246920 22:43240525-43240547 ACCTCCACTGTCCCAGTAGATGG - Intronic
1184372917 22:44094037-44094059 AGCTCAACTGTCTCAGGGCAGGG - Intronic
1185372931 22:50469291-50469313 AGCTCCCCTGGGCCAGGAGGAGG + Intronic
950186588 3:10949227-10949249 AGCTGCCCTGGCCCAGGAAGTGG - Intergenic
950472818 3:13197110-13197132 AGCTACACAGTCCCAAGAGGAGG - Intergenic
950831629 3:15880087-15880109 AGCTCCCCTGTCCCTGGCCCTGG + Intergenic
950884277 3:16348989-16349011 GGCTCCACTATCCAAGGACAGGG + Intronic
953235997 3:41107688-41107710 TGCTCCAATGACCCAGGAAGGGG + Intergenic
953883413 3:46702827-46702849 AGCTCCAGTGTCCCTGTAAGGGG + Intronic
953905526 3:46866582-46866604 AGCTACATTTTCCCAGGACCTGG + Intronic
954576637 3:51680000-51680022 AGCTGCACTGGCCCATGACTAGG - Intronic
954905503 3:54059069-54059091 AGCTCCCCTGTCCCCTGATGAGG + Intergenic
955952822 3:64259432-64259454 AGCTCCTCGGTCCCAGGAAGAGG - Intronic
960630609 3:119726741-119726763 AGCGCCACTGTCCCAGTGCCTGG + Intronic
961061434 3:123832183-123832205 ACCTTCACTGTCCCAGGGCTGGG + Intronic
961386097 3:126524258-126524280 AGTTGCACTGGCCCAGGACCCGG - Intergenic
962676451 3:137761873-137761895 AGCTGCACTGACCTAGGAAGGGG - Intergenic
962963818 3:140335468-140335490 AGCCCCACTGACCCTGGAAGTGG + Intronic
963131327 3:141860894-141860916 AGCTCCAGTGTCCCGGGTTGAGG - Intergenic
964822144 3:160783019-160783041 AGTTCCACTGGCCCATGAAGAGG - Intronic
967818242 3:193816861-193816883 GGCTCCATTGTCCCTGGATGTGG - Intergenic
968036893 3:195555197-195555219 TGCTCCACTGTGTCATGACGAGG - Intergenic
968131820 3:196196643-196196665 CCCTCCACTTCCCCAGGACGCGG + Intergenic
968689890 4:1984995-1985017 AGCTCCACTGCCACAGGCTGTGG + Intronic
969496519 4:7529495-7529517 GGCTCCTCTGGCCCAGGGCGGGG + Intronic
973808586 4:54548766-54548788 ATCTACACTGTCCCAGGGCAAGG - Intergenic
974943863 4:68503462-68503484 AGCTGCTCTGTCCCAGGAGGTGG - Intergenic
975689404 4:76949585-76949607 AGCTCCACTGGCCCCGGCCGCGG - Intergenic
976336264 4:83891285-83891307 AGCTCCAGTATCCCAGGGAGAGG - Intergenic
984653962 4:182297816-182297838 AGTTCCTCTGTCCCAGGCCTGGG + Intronic
985904032 5:2819082-2819104 GACTCCACTGTCCCAGGCCACGG - Intergenic
987636491 5:20548790-20548812 TGCTCCACTGTGCCTGGACCTGG + Intronic
991971803 5:72148622-72148644 AGAGCCACTGCCCTAGGACGTGG + Intronic
992398538 5:76389954-76389976 AGCTCCACTGTCTAGGGACCCGG - Intergenic
1002329638 5:178432746-178432768 AGCACGACTGTCCCAGGGCTGGG - Intronic
1006983695 6:38164422-38164444 GGATTCACTGGCCCAGGACGTGG - Intergenic
1015616916 6:135087094-135087116 AGCTCCACTTACCCAGTAAGTGG - Intronic
1019641627 7:2106536-2106558 AGCTCCACTCTCCCAGGGGTGGG + Intronic
1022540896 7:31134686-31134708 AGCTCCACGGGCCCAGGGCGAGG + Intergenic
1024673723 7:51619775-51619797 AGCTCCACTTTCCCAGGTTTTGG - Intergenic
1029590902 7:101506483-101506505 AGAGCCACTGTCCCAGGGGGTGG - Intronic
1035313650 7:157984793-157984815 AGCTCCCTAGTCACAGGACGTGG + Intronic
1036493361 8:9248061-9248083 AGCTCCACATTCCCAGGCCAAGG + Intergenic
1039905466 8:41783044-41783066 AGCTCCGCAGGCCCAGGAGGAGG + Intronic
1040046188 8:42966284-42966306 AACTCCACTGTCCCAAGTCTTGG - Intronic
1049325139 8:142017727-142017749 AGCAGCACTGAACCAGGACGTGG + Intergenic
1056905356 9:90642789-90642811 AGCTCCACTCGCGCAGGACAGGG + Exonic
1057965242 9:99496876-99496898 AACTCCATTGTCCCAGGCAGTGG + Intergenic
1061119814 9:128635764-128635786 AGGTCCACTGTCCCTGCAGGAGG - Exonic
1062343150 9:136102607-136102629 ATCTTCCCTATCCCAGGACGCGG - Intergenic
1062582158 9:137233505-137233527 TCCTCCCCTGTCCCAGGACAGGG - Intronic
1190002170 X:46699544-46699566 AGCTCAATAGTCCCAGGACCTGG + Intronic
1192458375 X:71296569-71296591 GGCTCCACAGTCACAGGACGAGG - Exonic