ID: 1091415142

View in Genome Browser
Species Human (GRCh38)
Location 12:276368-276390
Sequence TGCTGTGTATGGAGGGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091415137_1091415142 27 Left 1091415137 12:276318-276340 CCTTCAGGTTATCTGTTGCATGT 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1091415142 12:276368-276390 TGCTGTGTATGGAGGGATAAAGG 0: 1
1: 0
2: 2
3: 20
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091415142 Original CRISPR TGCTGTGTATGGAGGGATAA AGG Intergenic
905409481 1:37758423-37758445 TGCAGTAGATTGAGGGATAAAGG - Intronic
907225090 1:52938703-52938725 GGCTATATATGGAGGGATAGGGG - Intronic
907505439 1:54914798-54914820 AGCTGGGTATAGAGGGACAATGG + Intergenic
908494351 1:64679641-64679663 TCCTGTGGCTGGAGGGATCATGG + Exonic
910225142 1:84928639-84928661 TGCTGTGAAAGCTGGGATAAAGG - Intronic
910591193 1:88929306-88929328 AGCTGGGTATAGAGGGACAACGG - Intergenic
911802990 1:102167641-102167663 TGCTGTGAATGCAGGATTAATGG + Intergenic
911874987 1:103149571-103149593 TGCTGAGACTGGAGAGATAATGG - Intergenic
913070895 1:115297691-115297713 TTCTGAGTGTGGAGGGATTAGGG - Intronic
913513817 1:119585906-119585928 TGCTGTGTGTGGAGTGAGCAGGG - Intergenic
914927599 1:151902137-151902159 TGCTGTGGATGCAGTGATCAAGG + Intronic
915108129 1:153546914-153546936 TGCTCTGTATGGAGGGGTAAGGG - Intronic
915325089 1:155077807-155077829 TGTTGTGTGTGGATGGATATAGG + Intergenic
916438146 1:164795929-164795951 TTTTGTTTTTGGAGGGATAAGGG - Intronic
917389482 1:174519014-174519036 TGCTGTTTATGGAAGTATTATGG + Intronic
920180865 1:204131038-204131060 TGCTGTGTCTTGAGTGACAATGG - Intergenic
921092585 1:211857698-211857720 AGCTGGGTATAGAGGGACAACGG + Intergenic
921546745 1:216482683-216482705 TGCAGCTTTTGGAGGGATAAAGG - Intergenic
1062901590 10:1150812-1150834 TGCTGAGCATGGAGGGCCAACGG + Intergenic
1065854674 10:29820787-29820809 TGCAGGGTATGAAGGGTTAACGG - Intergenic
1065963470 10:30752800-30752822 AGCTGTGTTTGGAGTGATAAGGG - Intergenic
1070712119 10:78690330-78690352 GGCTGTGTGGGGAGGGACAAGGG + Intergenic
1072016467 10:91351813-91351835 TGGGGTGTATGCAGAGATAAAGG + Intergenic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1073774548 10:106771158-106771180 TGCTGTCTATGCCGGGGTAAGGG - Intronic
1075587950 10:123670930-123670952 TGTTGTGTGGGGAGGGATGAGGG + Intronic
1075793786 10:125104556-125104578 TCCTGTGTAAGGAGGTAAAATGG - Intronic
1077789433 11:5422596-5422618 TGGTGAGGATGGAGGCATAATGG - Exonic
1078703864 11:13718805-13718827 TGCTGTGGAGGGAGTGGTAAAGG + Intronic
1079026083 11:16949034-16949056 TCCAGTGTATGGAGTGACAAGGG - Intronic
1079161101 11:17995052-17995074 TGCTGTATACAGAGGGAGAAAGG + Intronic
1079601159 11:22314695-22314717 AGCTGAGTATAGAGGGACAATGG + Intergenic
1080198756 11:29643774-29643796 TGGTGTGGATGTAGGGAAAAGGG + Intergenic
1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG + Intergenic
1080764559 11:35283207-35283229 TTCAGTGTAGGGAGGGATCAAGG - Intronic
1080810579 11:35700386-35700408 TGCCTTGTTTGGAGGGTTAAAGG - Intronic
1086217811 11:84404944-84404966 TGATGTTTATTGAGGGACAAAGG + Intronic
1086441839 11:86836142-86836164 AGCTGGGTATAGAGGGACAAGGG + Intronic
1088603480 11:111505982-111506004 TGGTGTGTATGCAGAGAAAAGGG + Intronic
1091038468 11:132254876-132254898 TTCTGTGTATGATGGGATACCGG + Intronic
1091415142 12:276368-276390 TGCTGTGTATGGAGGGATAAAGG + Intergenic
1092294219 12:7185355-7185377 AGCTGGGTATAGAGGGACAACGG - Intergenic
1092469295 12:8764012-8764034 AGCTGGGTATAGAGGGACAACGG + Intronic
1092561384 12:9617653-9617675 TTCTGTGGATGGAGGGAGAGAGG + Intergenic
1092592241 12:9962918-9962940 GGCTTGGTATGGAGAGATAACGG + Intronic
1093077962 12:14776408-14776430 TGCTGTGTGTGGATGAATGATGG + Intronic
1093368874 12:18340822-18340844 TGCTGTTAATGGAGGTATTAAGG + Intronic
1093618678 12:21260692-21260714 TGCTGTGAAAGCAGTGATAAGGG - Intergenic
1094204747 12:27828441-27828463 TACTGTCTCTGGAGGGGTAAAGG + Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1095811213 12:46374171-46374193 GGCTGAGTACGGAGGGATTAAGG - Intergenic
1095933044 12:47648597-47648619 AGCTGTGTTTGGAAGGCTAACGG + Intergenic
1096981814 12:55732473-55732495 TGCTTGGTGTGGAGGGACAAGGG - Intergenic
1099013021 12:77313979-77314001 TGCTGTAAATGGAGTGTTAATGG - Intergenic
1101132036 12:101698850-101698872 GGCTGAGTGTGGAGGGATAGGGG + Intronic
1104639465 12:130458114-130458136 TGCTGCCTGTGGAGGGATAGTGG - Intronic
1106537561 13:30660666-30660688 TCCTCTGTATGGAGAGATAAAGG - Intronic
1106894555 13:34285124-34285146 TGCTGTGGATGCAGTGAAAAGGG + Intergenic
1107316218 13:39135109-39135131 AGCTCTGAATGGAGGGAGAAAGG + Intergenic
1107344408 13:39443533-39443555 TGCTGTGAATGGAGTGGTAAGGG + Intronic
1108594869 13:51940759-51940781 TGCTCTGTCTGCAGGGATGAAGG + Intronic
1110160628 13:72373972-72373994 TTTTGTGTGTGGAGGGATGATGG + Intergenic
1110470009 13:75848891-75848913 TGGTGTGAATGCAGGGAAAAGGG - Intronic
1112265093 13:97916314-97916336 TTATGTGTATGGAGGGAAATGGG + Intergenic
1113138264 13:107117691-107117713 TGCTGTGTACGGCAGAATAATGG - Intergenic
1114444576 14:22778446-22778468 AGCTATGTATGTGGGGATAAGGG + Intronic
1115233778 14:31188858-31188880 AGTTGTGTATGGAGGGATGGGGG - Intronic
1119085980 14:71739222-71739244 TGCTTTCTATGGAGGGAATAAGG - Exonic
1119417838 14:74486413-74486435 TTCTGTGGATGGAGTTATAAAGG - Exonic
1119520453 14:75280762-75280784 TCCTGTATACAGAGGGATAAAGG - Exonic
1122440942 14:101731478-101731500 TGCTGTGCATGGAGGGGTGCTGG - Intronic
1123970545 15:25504235-25504257 TGCTGTGTGGGGAGGGAGTACGG + Intergenic
1128160020 15:65417416-65417438 TGCTGTGTGTGGAGGGGTAGAGG - Intronic
1135254250 16:20928040-20928062 TGCTGTGAATGGAGCATTAAGGG - Intergenic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1136143141 16:28299893-28299915 TGCTGTGTGCACAGGGATAAGGG - Intronic
1137010707 16:35317116-35317138 TGCTGGGGAGGGAGGGAGAAGGG - Intergenic
1139071267 16:63386304-63386326 TGCTGTGCATGGTGGGACAGGGG + Intergenic
1139282632 16:65783793-65783815 GGCTGAGTCTGGAAGGATAAAGG + Intergenic
1140031181 16:71340556-71340578 TTCTGTGTTTTGAGGGAGAAGGG + Intergenic
1140779837 16:78284956-78284978 TGCTGTCTATTTAGGGAAAATGG + Intronic
1140850549 16:78931232-78931254 TGCTGTGTGGGGAGGGATAATGG + Intronic
1140865779 16:79060811-79060833 TGCTGTGATTTGAGGGATAGTGG + Intronic
1140981426 16:80113265-80113287 TGCTGTGCTTGGAGGGATACGGG + Intergenic
1143347575 17:6261229-6261251 TGGGGTCGATGGAGGGATAAAGG - Intergenic
1144466083 17:15498863-15498885 TGCTGAGTCTAGAGGGAAAATGG + Intronic
1146425285 17:32732202-32732224 TGCTGTGGATGGCAGGTTAATGG + Intronic
1149132974 17:53329629-53329651 TGCTGAGTGTGAAGTGATAATGG - Intergenic
1149273934 17:55013982-55014004 AGCTGGGTATAGAGGGACAACGG + Intronic
1152450805 17:80378374-80378396 TACTGTGTATGGAGGGCTCTAGG - Intronic
1153401699 18:4689456-4689478 AGCTGGGTATAGAGGGACAATGG - Intergenic
1153961743 18:10145926-10145948 TGACGAGTATGGCGGGATAATGG + Intergenic
1156126933 18:33917322-33917344 TGCTGTGTTTGGATGGATGAAGG + Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1158464200 18:57675265-57675287 TCCTGTGGATGGTGGGATTATGG - Intronic
1158626777 18:59078437-59078459 TGGTGGGAATGGAGGGATCAGGG + Intergenic
1158868775 18:61663730-61663752 TGCTGTAGATGGAGGGATTTGGG - Intergenic
1159831860 18:73286801-73286823 TGCTGCGTATTGAGGAACAAAGG - Intergenic
1164173708 19:22749485-22749507 AGCTGGGTATAGAGGGACAACGG - Intergenic
1164983036 19:32628368-32628390 TGCTGGGTGTGGAGGCCTAAAGG - Intronic
925291327 2:2750430-2750452 TGTGGTGTATGGGGGGATGATGG + Intergenic
926452616 2:13024089-13024111 TGCTGTGGAAGGAGGGAGGAAGG + Intergenic
926556730 2:14366125-14366147 TGCCATGTTTGAAGGGATAAGGG + Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928234081 2:29524920-29524942 TGGGATGTATGGATGGATAATGG + Intronic
928347997 2:30518647-30518669 AGCTGGGTATAGAGGGACAACGG - Intronic
928677197 2:33661571-33661593 AGCTGGGTATAGAGGGACAACGG - Intergenic
928914851 2:36459732-36459754 AGCTGTGGCTGGAGTGATAAGGG + Intronic
928999502 2:37332127-37332149 TGGTGAGTATGGAGGGATACTGG + Intergenic
931748814 2:65313466-65313488 GGCTGCGGATGGAGGGAGAAGGG + Exonic
932011607 2:67983523-67983545 TGGTGAGGATGGAGGGATAAGGG - Intergenic
932185018 2:69687132-69687154 TGTTGTGTAAGGAAGGATTAGGG + Intronic
933155506 2:78968885-78968907 TGCTGTGGATGGAGGGGTGAGGG - Intergenic
934970779 2:98762426-98762448 TACTGTGGAAGGAGGGATGAAGG - Intergenic
935748840 2:106212761-106212783 AGCTGGGTATAGAGGGACAATGG - Intergenic
935900208 2:107783658-107783680 TGCTGTGAATGGAGAGACAATGG + Intergenic
936700068 2:115001191-115001213 TGCTGTTTATTAAGTGATAATGG - Intronic
936716771 2:115195872-115195894 TGCTGTGTATGGGTGCATCAGGG - Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
944082721 2:195807129-195807151 GCCTGTGTTTGGAGGAATAAAGG - Intronic
946248942 2:218401626-218401648 TGCTGTGTCTGCCGGGATGATGG + Exonic
947157383 2:227176025-227176047 TCCTGTGTCAGGTGGGATAAGGG - Intronic
1170594019 20:17792193-17792215 TGCAGAGTATGGAGGGATTTGGG + Intergenic
1170874814 20:20240516-20240538 AGCTGTGTATGCAGGGTTACAGG - Intronic
1171147126 20:22794736-22794758 AGCTGATTATGGAGGGAAAAGGG + Intergenic
1171383029 20:24747553-24747575 TGCTGTGGATGCAGTGACAACGG + Intergenic
1172780826 20:37436186-37436208 TGATGGGGATGGATGGATAATGG - Intergenic
1173544810 20:43887331-43887353 TGCTGTCTATGTAGGGAGATGGG + Intergenic
1173910632 20:46667195-46667217 AACAGTGTATGGAGGGACAAAGG + Intronic
1173988520 20:47281554-47281576 TGCCGTGTACGGAGGGAAAGGGG + Intronic
1174977264 20:55349629-55349651 AGCTGGGTATAGAGGGACAATGG - Intergenic
1175493920 20:59399589-59399611 TCCTGTGTACGGAGAGATCACGG - Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1177263360 21:18755758-18755780 AGCTGGGTATAGAGGGACAACGG + Intergenic
1177933119 21:27310323-27310345 TGATGTGTATGCAGAGAAAAGGG - Intergenic
1177933121 21:27310351-27310373 TGGTGTGTATGCAGAGAAAAGGG - Intergenic
1179474815 21:41636407-41636429 GGCTGTGTAGGGCAGGATAAGGG - Intergenic
1183014809 22:34977414-34977436 TTCTGTGTTTGCAGGGGTAATGG - Intergenic
1184458074 22:44622646-44622668 TGTGGTGTATCGAGGCATAAAGG + Intergenic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1185421703 22:50738584-50738606 AGCTGTCTGTGGGGGGATAAGGG - Intronic
951040699 3:17986355-17986377 TTCTGAGGATGGAGGTATAAGGG + Intronic
951838072 3:27003998-27004020 AGCTGGGTATAGAGGGACAATGG - Intergenic
952211274 3:31231427-31231449 TGCCATGTTTGGAGGCATAAAGG + Intergenic
953191036 3:40688362-40688384 TGCTGTGTTAGGAAGAATAATGG + Intergenic
953564904 3:44022997-44023019 GGTTGTGTATGGATGGATACAGG - Intergenic
953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG + Intronic
953927461 3:46989656-46989678 TCCTGTGTATGGCAGGATCAAGG - Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
956401892 3:68888411-68888433 TGCTGTGAATGGAGTGTTAAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958016090 3:87941806-87941828 AGCTGGGTATAGAGGGACAATGG + Intergenic
958555796 3:95674298-95674320 TGCTGTGAATTGAGTGTTAAAGG - Intergenic
958628036 3:96651657-96651679 AGATGTAAATGGAGGGATAAAGG - Intergenic
959972971 3:112427703-112427725 TGCTGTGAGTGGAGTGTTAAGGG + Intergenic
961388405 3:126537440-126537462 TGCTGTGTAGAGAAGGATCAGGG + Intronic
962679984 3:137789038-137789060 TGCTTGGAATGGAGGGATAGTGG - Intergenic
963522062 3:146367469-146367491 GGTTGGGTATGGAGAGATAATGG - Intergenic
964222778 3:154365925-154365947 TGCTGTGAATGGAGCATTAAGGG - Intronic
965054645 3:163697493-163697515 AGCTGGGTATAGAGGGACAATGG + Intergenic
965254689 3:166390790-166390812 TGCTGTGGATGTAGGGGAAAAGG - Intergenic
967732282 3:192917613-192917635 TGCTGGGTAAGGAGGAAAAAGGG - Exonic
967975924 3:195034806-195034828 TGCTCTGCATGGAGGGATGCAGG + Intergenic
971213255 4:24640174-24640196 TGAAGGGTGTGGAGGGATAATGG - Intergenic
972082558 4:35171943-35171965 TGCTGTGAATGCAGAGTTAAGGG + Intergenic
972947831 4:44279597-44279619 TGCTGTGTATGTGGGAACAAGGG - Intronic
973963846 4:56140161-56140183 CACTGTGGATGCAGGGATAAAGG - Intergenic
975313656 4:72929113-72929135 AGCTGGGTATAGAGGGACAACGG + Intergenic
977436584 4:97004354-97004376 TGCTGTGAATGGAGCATTAAGGG - Intergenic
978586640 4:110281773-110281795 AGCTGGGTATAGAGGGACAACGG + Intergenic
980444368 4:132886547-132886569 AGCTGGGTATAGAGGGACAATGG - Intergenic
981739932 4:147990963-147990985 TGCAGTGTATGGTGTGATCATGG - Intronic
984584033 4:181542432-181542454 TTCTGTTTATGAAGGAATAATGG + Intergenic
984664000 4:182405853-182405875 TGGAGGGTATGGAGGAATAAAGG + Intronic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985604022 5:849161-849183 GGCTGTGTATGCAGGGCCAATGG - Intronic
986843643 5:11727430-11727452 AGCTGTGAATTGAGAGATAAAGG - Intronic
987111579 5:14692760-14692782 TGCTGTGCACTGTGGGATAATGG + Intronic
987549859 5:19365480-19365502 TGCTGTGTTTGTAGTGATGATGG - Intergenic
988347904 5:30063797-30063819 TGATGCATATGGAGGGATCAAGG - Intergenic
989173028 5:38492523-38492545 TGCACTGTAAGGAAGGATAAAGG + Intronic
990892441 5:60663434-60663456 AGCTGGGTATAGAGGGACAACGG - Intronic
991714384 5:69437759-69437781 TGCTTTGTATGAATGGACAAGGG + Intronic
992007303 5:72490578-72490600 TGCTGGGCATGGAGGGACAATGG + Intronic
992473756 5:77082694-77082716 TGATGTGAAAGGAGGGAGAAGGG + Intronic
992678827 5:79132842-79132864 TTCTGTGCATTGAGGGATTAGGG - Intronic
994943782 5:106359229-106359251 AGCTGTGCATGGAGGGATCTAGG + Intergenic
995588002 5:113669371-113669393 TGCTGTGGATGTAGTGAAAAGGG + Intergenic
996869340 5:128169641-128169663 TTCTGTGTATATAGGGATTAGGG + Intronic
998089784 5:139358255-139358277 TCCTGTGGATGTAGGGATTATGG - Intronic
998844942 5:146299431-146299453 TGGTGTGGATGTAGGGAAAAGGG - Intronic
1001806515 5:174591374-174591396 TGCTGGGGAGGGAGGGAGAAAGG - Intergenic
1001922858 5:175614039-175614061 GGCTGAGGATGGAGGGAAAATGG + Intergenic
1002297032 5:178237531-178237553 TGCTGGGTGGGGAGGGAAAAGGG - Intergenic
1007518420 6:42431699-42431721 TGGTGTGTATTGAGTGACAAGGG - Intronic
1009435452 6:63613083-63613105 TGGTGGGAATGGAGAGATAAGGG + Intergenic
1009544945 6:65009384-65009406 AGCTGGGTATAGAGGGACAATGG - Intronic
1010020780 6:71157632-71157654 TGCTCTGTAGGGAAGGAGAAAGG - Intergenic
1011076937 6:83447808-83447830 AGCTGGGTATAGAGGGACAACGG - Intergenic
1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG + Intergenic
1013543705 6:111135473-111135495 AGCTGGGTATAGAGGGACAATGG - Intronic
1015613904 6:135054915-135054937 TGCTGTGCATGGCGGGACGAGGG + Intronic
1015865325 6:137721515-137721537 AGCTGGGTATGGAGTGACAACGG + Intergenic
1016256462 6:142111301-142111323 TGTTGTGTAGGGTGGTATAAAGG - Intergenic
1016343092 6:143083539-143083561 AGCTGGGTATAGAGGGACAATGG + Intronic
1016594609 6:145785383-145785405 TGCTTTGTGTGGAAGGAGAAAGG + Intergenic
1018761202 6:166895684-166895706 AGCTGGGTATAGAGGGACAATGG - Intronic
1019599346 7:1873596-1873618 TGCGGTGGATGGAGGGGTAGTGG + Intronic
1020553277 7:9635356-9635378 AGCTGTGTATATAGGGCTAAAGG - Intergenic
1021686405 7:23191292-23191314 TGCTGTGTGAGGGGGGAGAAAGG + Intronic
1028088213 7:86663978-86664000 TACTGTGAAAGGAGAGATAATGG + Intronic
1030337454 7:108341880-108341902 AGCTGGGTATAGAGGGACAACGG - Intronic
1036626088 8:10472760-10472782 TTCTGTGTATGGTGTGATATGGG - Intergenic
1036687188 8:10919464-10919486 TGCTATGTGTGGAGGAACAATGG - Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037624613 8:20596004-20596026 TGCTGTTTCTGCAGGGATAAAGG + Intergenic
1039203839 8:35127351-35127373 TTTTGTGTATGGTGTGATAAAGG - Intergenic
1039559690 8:38503313-38503335 TGCTGTGTGTGGGGGTATATGGG + Intergenic
1041990104 8:63977257-63977279 TGCTGTGAATGGAAGCACAATGG - Intergenic
1042925695 8:73966315-73966337 AGCTTTTTATGGAGGGAGAATGG + Intronic
1043514874 8:80986676-80986698 TGGAGGGTATGGAGGGATTAGGG + Intronic
1047402207 8:124556828-124556850 TCCTGGGAATGGAGGGAGAAGGG - Intronic
1048900438 8:139032311-139032333 GGCTGTGTATGAATGGATACAGG - Intergenic
1050010513 9:1181429-1181451 TGCTGAGTTTTGAGGTATAAAGG + Intergenic
1055656836 9:78459072-78459094 TGGTGTGTATGTAGTGATCAGGG + Intergenic
1059752458 9:117260665-117260687 TACTGTGTAGGGAGTGGTAAGGG + Intronic
1060545071 9:124454662-124454684 TGGTGTGTCTGCAGGAATAAAGG + Intronic
1060575940 9:124694242-124694264 ATCTGTGTATGTATGGATAAAGG - Intronic
1060672252 9:125480140-125480162 TGCTTTGTAAGGAGGGAGAGAGG + Intronic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1186267270 X:7844538-7844560 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1186297720 X:8169113-8169135 TGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186325139 X:8467358-8467380 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1189672092 X:43422342-43422364 TGCAGAGGATGGAGGGAGAAGGG - Intergenic
1190524516 X:51315053-51315075 TGCTGTGTCTGGAGTTAGAATGG - Intergenic
1192448159 X:71225619-71225641 TGCTGAGTTTGGAGGGAGTAAGG - Intergenic
1193307546 X:79967103-79967125 TGGTGTGGATGGAGTGAAAAGGG - Intergenic
1193603553 X:83538492-83538514 TGCTGGGGATGTAGGGATTAGGG - Intergenic
1195535108 X:106001531-106001553 AGCTGGGTATAGAGGGACAATGG - Intergenic
1195866679 X:109439923-109439945 TGCTGTGAGTGGAGTGCTAAGGG - Intronic
1196271861 X:113721537-113721559 TGCTGTGTAATGATGGAGAATGG - Intergenic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1197341984 X:125286175-125286197 TGCTGTGAATGGAGTGCTAAGGG + Intergenic