ID: 1091415372

View in Genome Browser
Species Human (GRCh38)
Location 12:278267-278289
Sequence CAGAGTAAACTGACAGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091415361_1091415372 24 Left 1091415361 12:278220-278242 CCAGAGTGACAGGCCAGAGTCTA 0: 1
1: 0
2: 0
3: 21
4: 179
Right 1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 210
1091415365_1091415372 11 Left 1091415365 12:278233-278255 CCAGAGTCTATGCTAAATGGGGA 0: 1
1: 0
2: 1
3: 8
4: 72
Right 1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091415372 Original CRISPR CAGAGTAAACTGACAGAGGG GGG Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
902416792 1:16244444-16244466 CAGGCTTAACTGACAGAGGGAGG + Intergenic
904305559 1:29586413-29586435 CAGCTTCTACTGACAGAGGGTGG - Intergenic
904989262 1:34578389-34578411 CAGAGTAAAGGGACAAAGGGTGG - Intergenic
905320427 1:37112690-37112712 CAGAGTACATAGAAAGAGGGAGG + Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
907272654 1:53299926-53299948 CAGAGTGGGCTGACAGAGGGAGG + Intronic
910260610 1:85290117-85290139 CAGAGGAAACTCACCCAGGGCGG - Intergenic
911521751 1:98938046-98938068 GAGAGTAAGCTCATAGAGGGTGG + Intronic
914799774 1:150952222-150952244 CAGAGTAATCTGAAAAAGGCAGG - Intronic
916894892 1:169151800-169151822 CAGAGGACATAGACAGAGGGAGG - Intronic
920925541 1:210338036-210338058 CAGAGTCAACTGACAGGCAGAGG + Intronic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921718528 1:218444768-218444790 CATAGTAAACTCATAGAGAGAGG + Intergenic
921834213 1:219761011-219761033 CAGAGGAAACTCACAGGGGCAGG - Intronic
923490792 1:234482265-234482287 CAGAGAAAATTTACAGAGTGAGG - Intergenic
1063203379 10:3807332-3807354 CAGAGCAGACTGGCAGAGAGAGG - Intergenic
1063262336 10:4403915-4403937 CAGAGAAAACTAACAGAAGCCGG + Intergenic
1063262347 10:4404027-4404049 CAGAGAAAACTAACAGAAGCCGG + Intergenic
1063944747 10:11165673-11165695 CAGAGTAAAGGTACAGAGCGCGG + Exonic
1064504671 10:16015709-16015731 CTTAGTAAACGGAGAGAGGGAGG + Intergenic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1066700983 10:38127976-38127998 CAGTTGAAACTGAGAGAGGGTGG + Intergenic
1070559486 10:77555129-77555151 AAGAGGACACTGACATAGGGAGG + Intronic
1070752074 10:78969837-78969859 CAAAGTAAACTGCCAGGGTGCGG + Intergenic
1070834696 10:79440898-79440920 CAACGTAATCTGACAGAGGGAGG + Intronic
1071192595 10:83119531-83119553 CAGATTTTACTGACAGATGGAGG - Intergenic
1073415906 10:103381776-103381798 CAGATTCAACTGTCAGAGTGTGG + Exonic
1073591956 10:104766204-104766226 CAGAGTGAACTGCCAGTGTGAGG + Intronic
1076063868 10:127433357-127433379 CAGAGGCCACAGACAGAGGGCGG - Exonic
1076108336 10:127842457-127842479 CTCAGTAACCTGACATAGGGAGG + Intergenic
1076315070 10:129534145-129534167 CACAGCAAAGGGACAGAGGGTGG + Intronic
1076923924 10:133471758-133471780 GAGAGGAAAATGGCAGAGGGAGG + Intergenic
1078298963 11:10105866-10105888 CAGTGATAGCTGACAGAGGGAGG + Intronic
1080016407 11:27511252-27511274 TAGAGCAAAAAGACAGAGGGAGG - Intergenic
1080122054 11:28689610-28689632 CAGAGGATACTCACAGAGGAAGG + Intergenic
1081714894 11:45242909-45242931 AAGTGAAAACAGACAGAGGGAGG + Exonic
1088232639 11:107688535-107688557 CAAAGTAAAATTACAAAGGGTGG - Intergenic
1089332859 11:117701924-117701946 CAGGGTAAACAGACAGCGCGTGG + Intronic
1089403453 11:118178798-118178820 AAGATTAAACTGACAGGGTGGGG - Intergenic
1089575239 11:119437533-119437555 GAGAATACACGGACAGAGGGAGG - Intergenic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1099729341 12:86478417-86478439 CATAGTGAACTGCCAGAGCGAGG + Intronic
1099902835 12:88734031-88734053 CAGAGTGAACTCATAGAGGAGGG + Intergenic
1100070709 12:90712922-90712944 CAGAGTACAGTGACAAAGGATGG + Intergenic
1102543830 12:113640735-113640757 CTTAGTAAATTGACAGGGGGTGG - Intergenic
1102590009 12:113949870-113949892 GAGAGTAAACTGACTTAGGAGGG - Intronic
1102784574 12:115594141-115594163 CAAACTAAGCAGACAGAGGGGGG - Intergenic
1103164178 12:118756089-118756111 CAGAGTAAGCAAGCAGAGGGTGG + Intergenic
1104919538 12:132283380-132283402 CAGAGCCATCTGACAGAGGAAGG - Intronic
1105045847 12:133002573-133002595 CAGAGTCATGAGACAGAGGGAGG - Intronic
1105931903 13:25060452-25060474 TAGATTGCACTGACAGAGGGTGG - Intergenic
1105991821 13:25629719-25629741 CACAGTAAAAAGGCAGAGGGTGG - Intronic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106937740 13:34742615-34742637 CAGAGTAGACAGACACAGAGTGG - Intergenic
1108067558 13:46593765-46593787 CAGAAGAAACTGACAGAGATTGG - Intronic
1108851128 13:54730671-54730693 TAGAATAAAAAGACAGAGGGAGG - Intergenic
1108976467 13:56450305-56450327 CAGACTACACTTACAGAGCGAGG + Intergenic
1110710860 13:78649283-78649305 CAGAGGAAACTGACAAGGAGGGG + Intronic
1114279203 14:21175484-21175506 CAGCAAAAACTGACAGAGGCTGG + Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1116226344 14:42157826-42157848 CACATTGAACTGACAGAGAGAGG - Intergenic
1119919686 14:78434941-78434963 TAGAGACAACTGACAGAGAGGGG + Intronic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1122391373 14:101388430-101388452 CATAGTAAACTGAAACAGAGGGG - Intergenic
1123193655 14:106595468-106595490 AAGAGGAAAATGATAGAGGGAGG + Intergenic
1123202278 14:106677694-106677716 AAGAGGAAAATGATAGAGGGAGG + Intergenic
1125325551 15:38532894-38532916 GAGAGAAAACTGGCAAAGGGTGG + Intronic
1125501041 15:40240449-40240471 GTGAGTAAGCTGCCAGAGGGAGG + Intronic
1127456842 15:59162787-59162809 CAGATAAAAGTGACAGAGGTGGG - Intronic
1127517917 15:59714201-59714223 CAGAGTGAAATGACTAAGGGAGG - Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129803674 15:78436941-78436963 CAGGGAAAATGGACAGAGGGAGG + Intergenic
1129991271 15:79965522-79965544 CAGAGTCAAGTGAGAGAGGAAGG + Intronic
1130748470 15:86683122-86683144 CACAAAAAACTGACAGATGGGGG + Intronic
1133896616 16:9935402-9935424 GAGAGTAAAAGGACAGAGGACGG + Intronic
1135175211 16:20221746-20221768 CAGAGGGAAATGACAGAGAGAGG - Intergenic
1135206618 16:20490382-20490404 CAGAGAAAAGGGACAAAGGGTGG + Intergenic
1135212268 16:20533250-20533272 CAGAGAAAAGGGACAAAGGGTGG - Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140748766 16:78004472-78004494 CAGATAAATCTGAAAGAGGGTGG + Intergenic
1142985197 17:3691090-3691112 CAGCGTTACCTGAAAGAGGGCGG + Intronic
1144176774 17:12715140-12715162 CAGAGCAAAGTCAAAGAGGGTGG + Intronic
1144260774 17:13517982-13518004 CAGAGTCAACTGGGAGAGGAAGG + Intronic
1144773193 17:17770900-17770922 CAGAGGACACGGGCAGAGGGAGG - Intronic
1145985937 17:29046241-29046263 CACAGACAACTGACAGAGAGGGG - Intronic
1147499405 17:40948470-40948492 CAAAGGAAACAGAGAGAGGGAGG - Intergenic
1148099862 17:45082663-45082685 CAAAGTAGGCTGACAGAGGCAGG + Intronic
1149239472 17:54632246-54632268 CAGAGTAAAAGAACAGGGGGCGG - Intergenic
1149283720 17:55137292-55137314 CAGAGCAGAAGGACAGAGGGAGG - Intronic
1150718024 17:67588514-67588536 CAGAGTTGACGGACAAAGGGAGG - Intronic
1155308870 18:24504766-24504788 CTGCGTAAGCTGAGAGAGGGTGG + Intergenic
1160308259 18:77761696-77761718 AAGAGTAAAGTAAAAGAGGGAGG - Intergenic
1165981662 19:39729306-39729328 CAGAGAAAAATGAGAGAGTGTGG - Intergenic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166855485 19:45780944-45780966 CAGGGTAAACTGAGACCGGGTGG - Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1167330615 19:48853682-48853704 CTGAGTCAAGTGACAGAGGGTGG + Exonic
925322976 2:2991115-2991137 CAGAGTGACCTCACTGAGGGTGG - Intergenic
925957103 2:8977645-8977667 AAGACTAAAATGACAGAGGAAGG - Intronic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
932008265 2:67949382-67949404 CAGGTTTAACTGACAGAGGTTGG - Intergenic
932126211 2:69147456-69147478 CAGAGGAAAGTCAGAGAGGGAGG - Intronic
934756703 2:96829221-96829243 GAGAGAAAAAAGACAGAGGGTGG - Intronic
936541446 2:113355278-113355300 CAGACTAAGCTGACACAGGTAGG - Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937891216 2:126940454-126940476 CAGGCTCAACTGGCAGAGGGAGG - Intergenic
939300989 2:140338280-140338302 CAGAGAATAATGGCAGAGGGTGG + Intronic
939357273 2:141119452-141119474 CATACTAAAGTGAGAGAGGGAGG + Intronic
939604090 2:144231047-144231069 CAGAATAATATGTCAGAGGGTGG + Intronic
943231150 2:185254113-185254135 CAGAGAAAACAGAGAGAGAGAGG - Intergenic
943721969 2:191214161-191214183 CAGAGTACAATAACAAAGGGTGG + Intergenic
947809903 2:232997746-232997768 CAGAGGAAAAGGACAGAGGGTGG - Intronic
948430044 2:237913046-237913068 CAGGGTCTACTGACAGTGGGCGG + Intergenic
948935608 2:241162368-241162390 GAGAGTGAACTGACAGAGGAGGG + Intronic
1169099366 20:2932684-2932706 CATAGGAAACTGACAAAGGAAGG + Intronic
1169578703 20:6994846-6994868 AAGAGTAAACTGACTTGGGGAGG + Intergenic
1169967401 20:11232831-11232853 CAGTGGAAACTGACAGAGGATGG + Intergenic
1170211063 20:13846698-13846720 CCGAGATGACTGACAGAGGGAGG - Intergenic
1170418802 20:16171979-16172001 CAGAGAGGACTGACAGAGAGAGG + Intergenic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172982319 20:38953114-38953136 AAGAGAAAAGTGTCAGAGGGGGG - Intergenic
1178621116 21:34177158-34177180 CAGAGTAAACTGGCATAGATTGG + Intergenic
1183601051 22:38840842-38840864 CAGAGGCAGCAGACAGAGGGAGG + Intronic
953840113 3:46383325-46383347 CAAAGCAAACTGAGAGAGTGAGG + Intergenic
954099213 3:48356453-48356475 CAGAGGAAACTGCAAGAGGCTGG + Intergenic
955148513 3:56344055-56344077 CAGAGTAAACAGGCAGAGAGAGG + Intronic
955372594 3:58366473-58366495 CTGAGTTGACTTACAGAGGGTGG + Intronic
955783829 3:62515008-62515030 CAGACAAAATTGAGAGAGGGAGG + Intronic
957916677 3:86695334-86695356 CATAGTAAACTTAAAGGGGGTGG + Intergenic
959906749 3:111718575-111718597 TAGAGTCCACTGAGAGAGGGAGG + Intronic
960328643 3:116328713-116328735 CAAAGTAAAATGAGAGAGAGAGG + Intronic
963388192 3:144623264-144623286 CAGAGTAAGCTGGAAAAGGGTGG + Intergenic
968686739 4:1964727-1964749 AAGAGAAAAATGAAAGAGGGGGG - Intronic
970191896 4:13525269-13525291 CAGAGTAGCCTCAGAGAGGGAGG + Intergenic
970712275 4:18877121-18877143 CAGAAGAAACTGTCAGAGGCAGG - Intergenic
975337252 4:73193528-73193550 CAGAGTAAAACTACAAAGGGGGG - Intronic
975957512 4:79858920-79858942 GTGAGTCAACTGACAGAGAGAGG - Intergenic
976470337 4:85421016-85421038 CAAAGTAAGCTGACAGTGGGCGG + Intergenic
976858349 4:89630806-89630828 CAGAGTGAAGAAACAGAGGGAGG - Intergenic
976916135 4:90376695-90376717 CTGATTAATCTGACAGAGGCTGG - Intronic
977507040 4:97915667-97915689 CAGAGCAAAATGACGGAGGCAGG + Intronic
978831555 4:113091833-113091855 GAGCGCAAACTGAAAGAGGGTGG - Intronic
979182474 4:117748518-117748540 GAGAGGAAACTGGTAGAGGGAGG + Intergenic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
979659529 4:123237847-123237869 GAGAGTGAACTGAAATAGGGTGG + Intronic
981602624 4:146507708-146507730 CATAGTAAAGGGACAGAGTGAGG - Intronic
981803100 4:148680868-148680890 CAGAATACAGGGACAGAGGGAGG - Intergenic
983803838 4:171968750-171968772 CAGAGTTCACTGACTGAGAGAGG - Intronic
987978400 5:25046180-25046202 CAGATTGAGCTGACAGAGGTTGG - Intergenic
992670099 5:79051117-79051139 AAGAGCAAAGTGATAGAGGGAGG + Intronic
994650438 5:102520255-102520277 CAGAATAGAAAGACAGAGGGAGG + Intergenic
996982220 5:129512647-129512669 CACAGGAAACTGACAGATTGGGG + Intronic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
999087659 5:148907374-148907396 CAGAGTAATGTGATAGAGAGTGG + Intergenic
999675791 5:154001264-154001286 CAGAGTAAAAGGACAGAGAATGG + Intronic
999758004 5:154679663-154679685 CAGAGAAGACAGACAGATGGTGG - Intergenic
1001123305 5:168997434-168997456 TAGAATTAACTGAAAGAGGGAGG + Intronic
1002453787 5:179334073-179334095 CAGAGAAACTGGACAGAGGGAGG + Intronic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1003885147 6:10514781-10514803 CAAAGTAAATTGTCAGATGGTGG - Intronic
1004059498 6:12178632-12178654 CAGACACAACTGGCAGAGGGAGG + Intergenic
1005138378 6:22598332-22598354 CAGAGAAGACTGTCTGAGGGGGG - Intergenic
1006275492 6:33002066-33002088 CACAGTCAACTGACACAGGGCGG + Intergenic
1007905812 6:45459775-45459797 CAGGGTAAGGGGACAGAGGGAGG + Intronic
1013010298 6:106114422-106114444 AAAATTAAACTGAGAGAGGGAGG + Intergenic
1013055041 6:106575118-106575140 CAGAGTTAAAATACAGAGGGGGG + Intronic
1014183180 6:118407456-118407478 CAGAGAACACTGACGGGGGGAGG - Intergenic
1014942056 6:127453217-127453239 CAGGGTCAACGGACTGAGGGAGG + Intronic
1015812490 6:137174925-137174947 CAGAGAACAGTGACAGAGGCAGG - Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1020011337 7:4807484-4807506 GAGAGGAGACAGACAGAGGGAGG - Intronic
1022674015 7:32481443-32481465 CAGAATAAAAGGACAGAGAGAGG + Intergenic
1022779098 7:33560029-33560051 CTGGGTAAACTGATAGAGAGGGG - Intronic
1023568145 7:41543995-41544017 CAGAAAACACTGGCAGAGGGTGG + Intergenic
1023705910 7:42941664-42941686 GAGAGCAAACTGACCCAGGGCGG - Intronic
1024044721 7:45578798-45578820 CAGAGTAAAGTAGCAAAGGGAGG - Intronic
1024234817 7:47390020-47390042 CAGAGTCAAATGTCATAGGGTGG + Intronic
1024374067 7:48618185-48618207 CTGACTGAACCGACAGAGGGTGG - Intronic
1029286137 7:99467413-99467435 CAGAATGAACTGAACGAGGGTGG - Intergenic
1029686227 7:102149887-102149909 TAGAGGAAACGGACAGAGGTGGG - Intronic
1030505689 7:110418887-110418909 CAAAGTAATCTGATACAGGGAGG - Intergenic
1032044879 7:128596739-128596761 CAGAGGGAACTGAGAGAGCGGGG - Intergenic
1032765980 7:134994117-134994139 CAGAGTGAAGTCACAGATGGAGG + Intronic
1034537592 7:151735462-151735484 CGGAGTAATCTGACAGATCGTGG - Intronic
1036279040 8:7383525-7383547 ATGAATAAATTGACAGAGGGAGG + Intronic
1037956572 8:23064971-23064993 CATATTTGACTGACAGAGGGAGG - Intronic
1038086604 8:24204717-24204739 CAAAGTAAACTGTCAAAAGGAGG + Intergenic
1040335439 8:46413620-46413642 AAGAGAAAACTGCCAAAGGGTGG + Intergenic
1040914518 8:52555419-52555441 GAGAGTAAACTCACAGAGACAGG + Intronic
1041433047 8:57805783-57805805 CAGAAAAAACTGACTGACGGTGG + Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1041967113 8:63691332-63691354 CCAAGTAAACTGAAAGAAGGGGG - Intergenic
1042898235 8:73694514-73694536 TAGAGTAAAATTACAGAGGAGGG + Intronic
1043927050 8:86049254-86049276 CAGAGTAAGCTTTCAAAGGGAGG - Intronic
1044392413 8:91667077-91667099 CATAGTTGACTGACAGAGTGGGG + Intergenic
1044675891 8:94728268-94728290 CAGTGTATACTGAGAGTGGGGGG - Intronic
1047166169 8:122440858-122440880 GAGAGTAAACTCCCAAAGGGTGG + Intergenic
1049258371 8:141625740-141625762 CAGGGTAGAGTGACAGAGTGAGG + Intergenic
1050214750 9:3309954-3309976 CAGAATAAAAGGACAGAGTGGGG + Intronic
1050614531 9:7388241-7388263 CAGGATCAACTGGCAGAGGGTGG - Intergenic
1055605404 9:77965112-77965134 CAGAGTAAAGTAAAAAAGGGTGG - Intronic
1056247613 9:84711904-84711926 CAAAGAAAACTGACAGAGGTTGG - Intronic
1057333207 9:94135561-94135583 CAGAGGAGAAAGACAGAGGGAGG - Intergenic
1057973497 9:99579656-99579678 CAGAGTAATGGGACAGAGAGTGG + Intergenic
1059973245 9:119689203-119689225 AAAAATAAACTGACAGAGGAAGG - Intergenic
1060667903 9:125443854-125443876 CACAGTAAACTGACTTGGGGTGG - Intronic
1061960782 9:133988017-133988039 CAGATTAAACTCAAAGTGGGAGG + Intronic
1185657891 X:1700857-1700879 CAGAGGAAGCTGACTGAGAGGGG - Intergenic
1186074892 X:5867372-5867394 AAGAGTAGAATGAAAGAGGGAGG - Intronic
1187142383 X:16606433-16606455 GAGAGTTTTCTGACAGAGGGTGG - Intronic
1187790643 X:22946351-22946373 CAGAGTAACCTTACACATGGTGG - Intergenic
1189972699 X:46434309-46434331 CAGAGGCCAATGACAGAGGGTGG - Intergenic
1192243016 X:69349656-69349678 AAGAATAGACTGACAGTGGGAGG - Intergenic
1192245413 X:69367792-69367814 CTGAGAAAACAGACAGAAGGGGG - Intergenic
1193334564 X:80273571-80273593 GAGAGCAAGCTGAAAGAGGGTGG + Intergenic
1199569478 X:149253139-149253161 CTGAGTAAACAGGCAGAGGTTGG - Intergenic
1200494021 Y:3859083-3859105 AAGAGTCAACAGACAGAGGAAGG + Intergenic