ID: 1091427790

View in Genome Browser
Species Human (GRCh38)
Location 12:406502-406524
Sequence CAGATCATACAGGACCTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 1, 1: 6, 2: 32, 3: 160, 4: 526}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091427790 Original CRISPR CAGATCATACAGGACCTTGT CGG Intronic
901386044 1:8909942-8909964 TGGATCCTATAGGACCTTGTGGG + Intergenic
901541275 1:9918619-9918641 CAAATCATACAGGCCTTTATAGG + Intergenic
901883110 1:12205383-12205405 CAGATCAGACAGGGCCTGGTAGG + Intronic
902408565 1:16199760-16199782 CAGACCATGAAGGGCCTTGTAGG - Intronic
902528773 1:17076958-17076980 CAGATCAGAAAGGAATTTGTTGG - Intronic
902954873 1:19918742-19918764 CACAGCATTCAGGACCTTGAGGG - Intergenic
903052168 1:20609531-20609553 CAGATCACACAGGGCCTTACAGG + Intronic
903690688 1:25171348-25171370 CGGACCATGCAGGATCTTGTAGG - Intergenic
904053485 1:27655362-27655384 TAGATCACGCAGGGCCTTGTAGG + Intergenic
904228301 1:29043651-29043673 CAGATTGTATAGGGCCTTGTGGG + Intronic
904730430 1:32586788-32586810 CAGATCATATAGGGCCTTTTAGG + Intronic
905043023 1:34976168-34976190 CAAATCAGACAGGGCCTTGTAGG + Intergenic
905064720 1:35170709-35170731 GAGATCATAAAAGGCCTTGTAGG - Intergenic
905126103 1:35717296-35717318 CAGATCAAACAGGGTGTTGTAGG - Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
906096556 1:43228147-43228169 TGGATCACGCAGGACCTTGTGGG - Intronic
906784017 1:48598116-48598138 CAGATCACACAGGGCCTTGAAGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907021249 1:51068599-51068621 CAGATCATGAAGGGTCTTGTGGG - Intergenic
907530221 1:55088037-55088059 CAGATCAAGCAAGGCCTTGTGGG + Intronic
907551934 1:55312074-55312096 CAGATCGTAAAGGCCCTTGTAGG - Intergenic
907772947 1:57484221-57484243 CAGATCATCCTGGGCCTTGGGGG + Intronic
907778800 1:57545042-57545064 CAGGTCACACAGGGCCCTGTGGG - Intronic
907924764 1:58944832-58944854 TAGATCATCCAGGACCTTATGGG + Intergenic
907952162 1:59194151-59194173 CAGAGCATGCATGACCTTGTTGG - Intergenic
908379984 1:63588630-63588652 CTGATCATATTGGGCCTTGTAGG - Intronic
908714615 1:67055963-67055985 CACATTATCTAGGACCTTGTAGG - Intergenic
910573309 1:88730195-88730217 AAGATCATATAGGGCCCTGTAGG - Intronic
912565763 1:110586108-110586130 CAGATTGTATAGGACCTTGTAGG - Intergenic
912698478 1:111858748-111858770 CAGATCATGGAAGGCCTTGTAGG - Intronic
912721099 1:112020793-112020815 TAGATGATATAGGACCTTCTAGG - Intergenic
912734503 1:112138271-112138293 TAGATTATAAAGGACCTTGAAGG - Intergenic
913253722 1:116935262-116935284 CAGAGCTTCCAGCACCTTGTGGG - Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
915533447 1:156518093-156518115 CAGATCTGACATAACCTTGTAGG - Intergenic
915837099 1:159186249-159186271 CAGACTGTACAGGACCTTGAAGG + Intronic
915923991 1:160002365-160002387 CAGATCCTGCAGGGTCTTGTAGG - Intergenic
917038156 1:170772382-170772404 TAGATCATATAGGACCTCATGGG + Intergenic
917619608 1:176782690-176782712 CAGAACACACGGGACCTCGTAGG + Intronic
918119097 1:181521970-181521992 CACATCATTCAGGGCCTCGTTGG + Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
919436665 1:197571310-197571332 CAGATCATACAAGGCTTTGAAGG - Intronic
919709033 1:200707872-200707894 CAGATCACACTGGGCCTTCTAGG + Intergenic
919733753 1:200931316-200931338 CAGATCATGAAGGGTCTTGTGGG - Intergenic
919754315 1:201057158-201057180 CAGATCATCTAGGCCCTTGAAGG - Intronic
921124477 1:212164883-212164905 TAGATTAAACAGGACCTTGAAGG - Intergenic
921200333 1:212799187-212799209 GATCTCATACAGGACCTTGTTGG + Intronic
921515651 1:216087985-216088007 CAGATTATATGGGACCTTGTGGG - Intronic
921601960 1:217115426-217115448 CGGATCATATAGGGCCCTGTAGG - Intronic
921811264 1:219517123-219517145 TAGATCATACCAGGCCTTGTAGG - Intergenic
921813807 1:219544466-219544488 CAGACCATAAAGGACCTTGTAGG + Intergenic
922224082 1:223630198-223630220 CAGATCATGAATGACTTTGTTGG - Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923422585 1:233832906-233832928 CTGATCATACGGTACCATGTTGG + Intergenic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1063641979 10:7839050-7839072 CCGATCACACAGGGCCCTGTAGG - Intronic
1065255486 10:23862728-23862750 CAGATCACAGAGGATCTTGTAGG + Intronic
1068684408 10:59854831-59854853 CAAATCATATAGGACTTTGTCGG - Intronic
1069400140 10:68035639-68035661 TAGATCATACAGCACCTTATAGG - Intronic
1069410005 10:68143628-68143650 CAGATCACAAAAGTCCTTGTAGG + Intronic
1069569457 10:69485590-69485612 CAGATCACAGAGGTCCTTGTAGG + Intronic
1069573152 10:69506708-69506730 CAGGTCACACAGGACCATGAGGG + Intronic
1070112900 10:73501675-73501697 CATATCACACAGGACCTTGTAGG - Intronic
1070183770 10:74039875-74039897 CAGATCATAAAGAGCCTTTTAGG - Intronic
1071757866 10:88565442-88565464 CAGATGTTAAAGGATCTTGTGGG + Intronic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1072565727 10:96615234-96615256 CAGATCACAAAGGGCCTTGTAGG + Intronic
1072807326 10:98432167-98432189 TAGATCACACAGGGCCTGGTAGG + Intronic
1074367793 10:112873793-112873815 CAGCTCATATGGGGCCTTGTAGG + Intergenic
1074447618 10:113533415-113533437 AAGATCACACAGGGCCTAGTTGG + Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1075597966 10:123746114-123746136 GAGATCATTCAGGAGTTTGTTGG - Exonic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1077649366 11:3956078-3956100 CAGATCATTCTGGGCCTTGCAGG + Intronic
1077704475 11:4471379-4471401 CAGATCACACAGGACCTCATAGG - Intergenic
1077775944 11:5271561-5271583 CTGAACATACAGGAAATTGTAGG - Intronic
1077900825 11:6486984-6487006 TGGATCATGCAGGGCCTTGTAGG - Intronic
1078627571 11:12971555-12971577 TAAATCATACAGGGCCTTGTAGG - Intergenic
1079140040 11:17802537-17802559 CAGATGGTATAGGACCTTATAGG - Intronic
1079619970 11:22542025-22542047 CAGATCATGCAATGCCTTGTGGG + Intergenic
1080044452 11:27794512-27794534 CAGGTCATACAGGGCTGTGTAGG + Intergenic
1080068706 11:28052333-28052355 CAGATCACATAGGGCCTTGTAGG - Intronic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080935856 11:36862672-36862694 CAGATCATATAGGATCTTTTGGG - Intergenic
1081470811 11:43368800-43368822 TAGATCTTACAGGACCTTGTAGG - Intronic
1081693023 11:45090913-45090935 CAGATCTTTCAGGCCCTCGTGGG + Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1084464777 11:69316113-69316135 CAGATCACACTGGACTTTGTAGG + Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085193673 11:74651799-74651821 CAGATGGTTCAGAACCTTGTCGG + Intronic
1085718517 11:78893493-78893515 CAGAGCTTATAGGAGCTTGTGGG - Intronic
1086116913 11:83261573-83261595 TAAATCATACAGGATTTTGTGGG - Exonic
1086210824 11:84316923-84316945 CAGCTTCAACAGGACCTTGTGGG - Intronic
1086884772 11:92192634-92192656 CAGATCATAAAGGATCTTTTAGG - Intergenic
1086885481 11:92200629-92200651 CAGATCATGCAGGACTGTTTGGG + Intergenic
1088263754 11:107970329-107970351 CAGATCATACAGAAATTTCTAGG - Intergenic
1088265616 11:107984981-107985003 CAGAGCATACATGGCCTTCTGGG - Intergenic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1088722666 11:112608309-112608331 CAGAACATACAGAACCTGGCTGG + Intergenic
1089043910 11:115481975-115481997 CAAATCATACAGGACCAACTTGG - Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1092093815 12:5825329-5825351 CAGAGCATACATGGCCTTCTGGG - Intronic
1092381813 12:8002779-8002801 CAGAGCATACATGACCTTCTGGG - Intergenic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1092860118 12:12713029-12713051 CAGATCAGATAGGACCAGGTAGG - Intergenic
1093393383 12:18651052-18651074 CAGATCACATAGGGCCTTTTAGG - Intergenic
1093495538 12:19752817-19752839 AAAATCATACAGGGCCTTGTGGG - Intergenic
1093547405 12:20365379-20365401 AAGATCATGAAGGTCCTTGTAGG + Intergenic
1093655019 12:21684589-21684611 CAGGTTATACAGGTCCTTGTAGG + Intronic
1093829432 12:23737631-23737653 CAAATCATATAGGGCCTTGCAGG - Intronic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1094099328 12:26744200-26744222 CAGCTCATATAGGGCCTTGTGGG - Intronic
1094342861 12:29432164-29432186 CAGATCCTATAGCATCTTGTAGG + Intronic
1095282177 12:40366092-40366114 CAGCTCATGCAGCACCTTGTAGG - Intronic
1095730446 12:45500971-45500993 CAGATCATTTAGGAACTTCTAGG + Intergenic
1095743848 12:45635640-45635662 CAGCTCACAGAGGGCCTTGTAGG + Intergenic
1095973480 12:47922600-47922622 GAAATCAAACAGGACCTCGTGGG - Intronic
1096176222 12:49521279-49521301 AAGATCATCCAGGACCTTACAGG + Intronic
1096201734 12:49688410-49688432 CAGATTATGTGGGACCTTGTTGG - Intronic
1096684068 12:53276389-53276411 CAGATCACACAGGGCCTTATAGG + Intronic
1096971964 12:55673925-55673947 CAGATCACACAGGGCCTTATGGG + Intergenic
1097159035 12:57032753-57032775 CAGATCATGATGGGCCTTGTAGG + Intronic
1098641938 12:72849525-72849547 CAGATAATACAGGACCTTGTAGG + Intergenic
1098646651 12:72910207-72910229 CAGATGGTAAAGGACCTTGTGGG + Intergenic
1098697816 12:73581488-73581510 CAGATCACACATGAGCTTGGAGG - Intergenic
1099203363 12:79700875-79700897 CAGATCATACAGGGTCTTAAAGG - Intergenic
1099210901 12:79787267-79787289 CAGATCATGCAGTGCCTTATAGG - Intronic
1099318679 12:81117621-81117643 CAGATCATATAGAACCTTGCAGG + Intronic
1099372647 12:81856320-81856342 CTGATCATACAGGAACTTGTAGG + Intergenic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1099830572 12:87837520-87837542 CAGATCATAAACAACCTTGATGG + Intergenic
1099948699 12:89275575-89275597 CAGATCCTAGAGGAGCTTCTGGG + Intergenic
1100016070 12:90012263-90012285 TAAATCATCCAGGACCTTGTTGG - Intergenic
1100209342 12:92385459-92385481 CAGATCCTACAGGATCCTGCAGG - Intergenic
1101001341 12:100361235-100361257 TAGATCACAGAGGACCTTGAAGG - Intronic
1101451762 12:104786174-104786196 GAGATTATGAAGGACCTTGTTGG + Intergenic
1101572272 12:105964669-105964691 CAGCTCATTTAGAACCTTGTTGG - Intergenic
1101931747 12:109020603-109020625 CAGATCTGTCAGGACCTTATGGG - Intronic
1102114209 12:110389175-110389197 CAGATATTACTGGGCCTTGTGGG - Intronic
1102353283 12:112211022-112211044 CAGATCCTATAGGACCTTATAGG + Intronic
1102478489 12:113204275-113204297 CAGATCACACAGGGCCTTTGAGG - Intronic
1103059443 12:117847130-117847152 CAGAACATACGAGACCCTGTGGG + Intronic
1103143380 12:118571900-118571922 CAGATCATTCTGGGCCTTCTAGG - Intergenic
1103172597 12:118834282-118834304 CAGATCATGCAGGGACATGTTGG + Intergenic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1104072345 12:125356703-125356725 CAGACCACGCAGGGCCTTGTAGG - Intronic
1104411305 12:128560320-128560342 CAGATCACTCAGGATCTTGCAGG - Intronic
1104697903 12:130878500-130878522 CAGAGCCTGCAAGACCTTGTAGG - Intergenic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1107644462 13:42479512-42479534 CAGATCACATGGGACCTTGTGGG + Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1108845932 13:54678526-54678548 CAGATCATACAGGAGGGTGAGGG - Intergenic
1108994973 13:56718723-56718745 CAGATCATATATGACCTTGTAGG + Intergenic
1109278321 13:60326431-60326453 CAGATCATTTAGGGCCTTATAGG + Intergenic
1109339931 13:61043120-61043142 GAGATCATTCAGGACATTGAAGG + Intergenic
1109383520 13:61597437-61597459 GGGATCATTCAGGACCCTGTAGG + Intergenic
1109482119 13:62969587-62969609 CAGGTTATACAGGACCTTGAAGG - Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110270503 13:73584306-73584328 CATATTATGCAGGATCTTGTAGG + Intergenic
1110391942 13:74984256-74984278 AAGATCATAGAGGGCCTTGAGGG - Intergenic
1110639217 13:77802530-77802552 AAGATCATGTAGGAGCTTGTAGG + Intergenic
1110658000 13:78023525-78023547 CAGATTACAAAGGACCTTGTGGG + Intergenic
1110815384 13:79855065-79855087 CAGATTATATCAGACCTTGTAGG - Intergenic
1111073422 13:83200127-83200149 CAGTTCACACAGGGCCTTGAAGG - Intergenic
1111698974 13:91661843-91661865 CAGATCATTCAGGGCCCTGTGGG + Intronic
1112725813 13:102302997-102303019 CAGCTCATTTAGGACTTTGTAGG - Intronic
1115254953 14:31390231-31390253 CAGAAGATATAGGACCTTGTAGG + Intronic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1115775164 14:36706993-36707015 CAGATCATACTGGCCCTTGTAGG - Intronic
1116380137 14:44257496-44257518 CAAATTATACATGGCCTTGTGGG + Intergenic
1116785536 14:49284389-49284411 GAGATCAGAGAGGATCTTGTAGG - Intergenic
1116901523 14:50366457-50366479 CAGATCCTACAGGGCCTTGCAGG + Intronic
1117077161 14:52116296-52116318 CAGATGCTACAGGGTCTTGTAGG - Intergenic
1117767876 14:59101726-59101748 CACATCATACAGGGGCTTGCAGG - Intergenic
1117769480 14:59118636-59118658 CAGATCATTTGGGGCCTTGTAGG - Intergenic
1117803624 14:59468288-59468310 CAAATCATGCAGTGCCTTGTAGG - Intronic
1117937138 14:60919245-60919267 CAGATCACTCAGGGTCTTGTGGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1118367815 14:65110617-65110639 CAGATCACACAGGACCTCACAGG - Intergenic
1118587054 14:67363692-67363714 CAGATCATATAGGATTCTGTAGG + Intronic
1118775005 14:68968311-68968333 CAGGTCACACAGCAACTTGTAGG - Intronic
1119116544 14:72027107-72027129 CTGATCCTTCAGGGCCTTGTGGG + Intronic
1119557558 14:75565421-75565443 CAAATCTTGCAGGGCCTTGTGGG - Intergenic
1119628693 14:76206935-76206957 AAGATCTTTCAGGAGCTTGTAGG - Exonic
1119661418 14:76454708-76454730 CAGATCATAAAAGGCCTGGTAGG + Intronic
1120000615 14:79299019-79299041 CAGATCACACAGGAACTGCTAGG + Intronic
1120042223 14:79767142-79767164 CAGATTGTACTGGACCTTGTAGG - Intronic
1120088633 14:80305555-80305577 CAGATCTTAGAGGACTTTGTAGG + Intronic
1120316620 14:82902496-82902518 CAGATCATGCAGTACACTGTAGG - Intergenic
1120489118 14:85154177-85154199 CATATAATACATAACCTTGTTGG + Intergenic
1123858918 15:24443177-24443199 CAGATTAGACAGGACCTGATGGG - Intergenic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1126506933 15:49416018-49416040 CAGATCATAATGAACTTTGTAGG - Intronic
1127345054 15:58086447-58086469 CATATCATGCATGACCTTGGTGG + Intronic
1127387430 15:58477907-58477929 CAGATCATAGAGGGACTTGTGGG - Intronic
1128581049 15:68810175-68810197 CAGACCATGCAGCACCTTGTTGG + Intronic
1128714285 15:69895827-69895849 CAGGTCACACGGGGCCTTGTTGG - Intergenic
1129077008 15:73005549-73005571 CAGATTATAGAGAGCCTTGTGGG + Intergenic
1129085278 15:73083072-73083094 CAAATAATTCAGGGCCTTGTTGG + Intronic
1129138803 15:73578153-73578175 CAGATTAGACAGGACTTTGTAGG + Intronic
1129435040 15:75532526-75532548 CAGAACATTAAGGACCTTGGAGG - Intronic
1129532585 15:76280680-76280702 CAGATCACATAGGGCCTTATAGG - Intronic
1129624534 15:77182792-77182814 CAGATCATGCAAGGCCTTTTAGG + Intronic
1130318449 15:82817360-82817382 CAGACCATGCAGGGGCTTGTGGG + Intronic
1130705333 15:86227838-86227860 CAGATTCTACAGGATCTTGAGGG + Intronic
1131419028 15:92288093-92288115 CAGACCACACAGAGCCTTGTAGG - Intergenic
1131623843 15:94097060-94097082 CAGAACATTCAGGGCCTTGTAGG + Intergenic
1132345048 15:101102998-101103020 CAGACCAGACAGGGCCTTGCAGG - Intergenic
1134250836 16:12572641-12572663 CAGCTCACACAGGAGCTTGGTGG - Exonic
1134306582 16:13038382-13038404 TAGATTGTGCAGGACCTTGTGGG - Intronic
1134692735 16:16201560-16201582 CAGATCACACAAGACCTTACAGG + Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1134979110 16:18593121-18593143 CAGATCACACAAGACCTTACAGG - Intergenic
1135387654 16:22058019-22058041 CAGGTAATACAGGACCTGGTAGG + Intronic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136596421 16:31253254-31253276 CAGGTCATGCAGGTCCTTGTAGG + Intergenic
1137346246 16:47664014-47664036 CAGAACTTAAAGCACCTTGTTGG - Intronic
1137964167 16:52914377-52914399 CAGATCACACATGAGCTTGAAGG - Intergenic
1137989207 16:53135240-53135262 CAGATTATACAGGGCCTTGTGGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138181260 16:54941652-54941674 CAGGTTATATGGGACCTTGTAGG + Intergenic
1138189802 16:55005227-55005249 CAGCTCATACAGTCCCTGGTTGG + Intergenic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1138797255 16:59983940-59983962 CAGATCATAAAGGGTCTTGTAGG + Intergenic
1139446594 16:67001944-67001966 CACATCACACAGGACATTGCTGG + Intronic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1139661009 16:68420929-68420951 CAGCTCATCCAGGTCCTAGTGGG + Intronic
1140015747 16:71182190-71182212 TAGATGGTACAGGACCTTGGAGG + Intronic
1140101226 16:71919190-71919212 CAGACAATGCAGGACCATGTAGG - Intronic
1140291535 16:73663482-73663504 TGGATCATACAGGAAGTTGTTGG - Intergenic
1140590619 16:76347856-76347878 CAGATCATTGAGGACATTGCAGG + Intronic
1140979880 16:80097419-80097441 CAGCTCATATAAGATCTTGTAGG - Intergenic
1141090563 16:81127644-81127666 AAGTTCATTCAGGTCCTTGTGGG - Intergenic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1144914638 17:18713793-18713815 CAGATCATACAAGACCCCATGGG + Intronic
1146262351 17:31430311-31430333 CAGATCACATGGGGCCTTGTGGG + Intronic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1148248686 17:46054621-46054643 CAAATACTATAGGACCTTGTGGG - Intronic
1148683573 17:49488206-49488228 CCAATCAAACAGGACCGTGTTGG - Intergenic
1149029219 17:52065005-52065027 CAGCTCATAGAGGGCCTTGTGGG - Intronic
1149248866 17:54744629-54744651 CAGATCATATAAGGCCTTATAGG + Intergenic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1150113839 17:62526967-62526989 CAGATCACGCAGGAGCTTTTAGG - Intronic
1150123624 17:62622562-62622584 CAGGTCATACAGAACCCTTTGGG + Intergenic
1150500889 17:65649994-65650016 CAGACAGTACAGGGCCTTGTTGG - Intronic
1150577435 17:66442555-66442577 CTGATGATACAGGGCCTTGTAGG - Intronic
1150676319 17:67247544-67247566 CACCTCACACAGGAGCTTGTAGG - Intergenic
1152873614 17:82772899-82772921 CAGTTAATACAGGACGTTGGGGG - Intronic
1153018161 18:602945-602967 AAGGTCTTGCAGGACCTTGTAGG + Intronic
1153165857 18:2261588-2261610 CAGACCATACAGGACTTTGTGGG - Intergenic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1156035416 18:32761335-32761357 CAAATCATACAGGAAGTTGTAGG - Intronic
1156294143 18:35774635-35774657 CAGATGATACAGGGCCTTCTAGG - Intergenic
1156410859 18:36827569-36827591 CAGATCTTACAGGGACTTGTGGG + Intronic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1158157151 18:54438860-54438882 TAGATCACATAGGACCCTGTAGG - Intergenic
1158263064 18:55630989-55631011 CAGTACATACAAGGCCTTGTTGG + Intronic
1158543437 18:58376787-58376809 CAGGCCACGCAGGACCTTGTGGG - Intronic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1160713016 19:561810-561832 CAGATAATACAGGCCCTGATGGG - Intergenic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1161492126 19:4567837-4567859 CAGGTTGTACAGGGCCTTGTGGG - Intergenic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161633264 19:5370168-5370190 CAGGTCACACAGAGCCTTGTGGG - Intergenic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1162148624 19:8629428-8629450 CAGGTCATGAAGGGCCTTGTGGG + Intergenic
1162762115 19:12894929-12894951 CTGGTCACACAGGGCCTTGTGGG - Intronic
1162833205 19:13299585-13299607 CAGATTACACAGGGCCTTCTGGG - Intronic
1162856488 19:13472456-13472478 CAGGTCACACAAGACCTTCTAGG - Intronic
1162875310 19:13616917-13616939 CAGATGGTACAGGGTCTTGTGGG + Intronic
1163000130 19:14362063-14362085 CAGATCCTGCAGGGCCCTGTGGG + Intergenic
1163221904 19:15927719-15927741 CAGAACATGTTGGACCTTGTAGG - Intronic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165639706 19:37373899-37373921 CAGATCATGAACCACCTTGTTGG + Intronic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1166039839 19:40195157-40195179 CAGATCACATAGGACCTTGGGGG + Intronic
1166341151 19:42138001-42138023 CAGATCGCACAGGGCCTTGCAGG + Intronic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1167204765 19:48093583-48093605 CAGATCATATGGGACCCTGAAGG - Intronic
1167243427 19:48359220-48359242 CAGATCGTACTGGGCCTTGTGGG - Intronic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167490637 19:49790999-49791021 CAGACCCTGCAGGGCCTTGTTGG - Intronic
1167533280 19:50032234-50032256 CAGATCAAAGAGGACCTTTGAGG - Intronic
1167611195 19:50508438-50508460 CAGACCACGCAGGGCCTTGTGGG - Intronic
925937121 2:8774755-8774777 CAGATCATAAAGGGCTTTGTAGG + Intronic
926363612 2:12113175-12113197 CAGATCGTGCTGGGCCTTGTGGG + Intergenic
926771584 2:16381789-16381811 CAGATCCTAGAGCACCTTGTAGG + Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
927609210 2:24520842-24520864 CAGATCATATAGAGCTTTGTAGG - Intronic
929742817 2:44621684-44621706 CAGATCATATATGGCCTTGTAGG + Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930282340 2:49385436-49385458 TAGATCATATAGGATCTTGAGGG - Intergenic
930656541 2:54012881-54012903 CAGAGCACTCAGGGCCTTGTAGG - Intronic
930689588 2:54346906-54346928 CAGATCAAAAAGGGCCGTGTAGG - Intronic
930886598 2:56333458-56333480 CAGATCACACAGGGCCCTGATGG + Intronic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931331903 2:61295222-61295244 CAGAGCATACAATAGCTTGTGGG + Exonic
931339211 2:61382280-61382302 CAGATTATTCAGGACCTTGTAGG - Intronic
931648195 2:64444430-64444452 CAGCTCCTACAGGGCCTTGAAGG + Intergenic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
932778531 2:74544394-74544416 CAGATCATAGAAGACCTTATAGG - Intronic
932792461 2:74667477-74667499 TATATCATACTGGACTTTGTAGG - Intronic
933075135 2:77914911-77914933 CAGATAATATAGGACCTATTTGG + Intergenic
933232287 2:79822840-79822862 CAGATCATATATGGCCTTATAGG - Intronic
933644723 2:84801386-84801408 CAGCTCATACAGTATCTTGCAGG - Intronic
933730471 2:85452419-85452441 CAGATCACACAAGGCCTGGTAGG - Intergenic
935641860 2:105298510-105298532 CATATCCTACAGGACTTTGAAGG - Exonic
935832851 2:107018656-107018678 CAGGTCATACAGGACTATGTAGG + Intergenic
936893798 2:117403930-117403952 CAGATCACATAGGAACTTTTAGG + Intergenic
937487843 2:122334458-122334480 CAGATCATACAGGGTCTTACTGG - Intergenic
937552469 2:123111616-123111638 CATATCATACAGTACTTTGTTGG + Intergenic
937896534 2:126980454-126980476 CAGATCTTACAGGGCCTCATGGG - Intergenic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
939706520 2:145460276-145460298 TAAATTATGCAGGACCTTGTGGG + Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
940892518 2:159048747-159048769 AAAATCATACAGAACCTTTTTGG + Intronic
941043992 2:160652296-160652318 CAGAGCATGCAGGGCCTTCTAGG - Intergenic
941351504 2:164442835-164442857 AAGCTCTTGCAGGACCTTGTAGG + Intergenic
941801916 2:169669325-169669347 CAGATCATACAGAGCCTTGGAGG + Intronic
941995215 2:171595614-171595636 AAGATCATTTAGGACCATGTGGG + Intergenic
942177710 2:173350471-173350493 CAGATCATGTGGGACCTTCTTGG - Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942664689 2:178304744-178304766 CAGTCCCTGCAGGACCTTGTAGG - Intronic
943040028 2:182793275-182793297 CAGATCATAGAGGGCTTTGCAGG + Exonic
943626824 2:190210620-190210642 CAGAGCATACAGAGCCTTGAAGG - Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944668573 2:201976528-201976550 AAGCTCATGTAGGACCTTGTAGG + Intergenic
945122376 2:206470191-206470213 CAGATTATATATTACCTTGTTGG - Intronic
945679785 2:212899895-212899917 CAGATCATTCAGGGCCTTATGGG + Intergenic
946268585 2:218569607-218569629 CACATCATACAGGGCCGTGCAGG - Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
946657212 2:221961252-221961274 CAGAACACACAGGGCCTTTTAGG + Intergenic
946950080 2:224864538-224864560 AAGATTATACATTACCTTGTTGG + Exonic
947134621 2:226964853-226964875 CAGGTCACACAGGGCCTTTTAGG + Intronic
947924728 2:233911370-233911392 CAGATTATATAGGACTTTGTAGG - Intergenic
948061519 2:235046011-235046033 CAGATCTTACACGACTTTGTGGG - Intronic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948800516 2:240431331-240431353 CAGAGCAGACAGGACCTGGCAGG + Intergenic
948949462 2:241239597-241239619 GAGATCATTGAGGACCTGGTAGG - Exonic
1168958152 20:1849054-1849076 CAGATCACACAGGGCCTTGAAGG - Intergenic
1169298688 20:4423124-4423146 CAGATAATAGAGGACCTGCTTGG - Intergenic
1169477469 20:5945229-5945251 CAGATCATTTATGACCTTGCAGG - Intronic
1169783468 20:9333544-9333566 CAGATCGTTCAGGACCTTTTCGG + Intronic
1169815290 20:9650176-9650198 CAGATCATCCAGTCCCTTGTAGG - Intronic
1169886246 20:10401460-10401482 CAGCTGAAACAGGGCCTTGTAGG + Exonic
1170243072 20:14191837-14191859 CAGATCATATAGGGTCTTTTAGG + Intronic
1170293289 20:14795135-14795157 CAGACCGTGAAGGACCTTGTAGG + Intronic
1170478919 20:16745664-16745686 CTGATCCTACAGGAGCTTGTAGG + Intergenic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1172199298 20:33114002-33114024 AAGACCCTGCAGGACCTTGTGGG - Intergenic
1172223662 20:33290220-33290242 CAGATCATACAAGGCCTCTTGGG + Intronic
1172293230 20:33790877-33790899 CAGATCACACAGGTGCTGGTGGG + Intronic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172786158 20:37470120-37470142 CACTTCACACAGGGCCTTGTTGG - Intergenic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1172836866 20:37878717-37878739 CGGATCTTACAGGGCCTTGAGGG + Intergenic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173338655 20:42134847-42134869 CAGATCATGCAAGACATTGCAGG - Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1173829558 20:46072540-46072562 AAGATTATACAGGACCTTCATGG - Intronic
1173946359 20:46953933-46953955 CAGCTCACACAGGGCCTTGTAGG - Intronic
1174047471 20:47743718-47743740 CGGATCACTGAGGACCTTGTAGG - Intronic
1174115299 20:48222837-48222859 CAGATCCTGCAGGCCCTTGTGGG + Intergenic
1174277371 20:49413752-49413774 CAGATCAGACAGGGTCTTGAAGG - Intronic
1175024665 20:55889156-55889178 CAGATTGTGCAGGGCCTTGTGGG + Intergenic
1175295731 20:57907571-57907593 CAGATCCCACAGCTCCTTGTGGG - Intergenic
1175408541 20:58751220-58751242 CAGATCACAAAGGACCTCATTGG + Intergenic
1176167066 20:63679922-63679944 CAGATCATCCAGCACCTGGCAGG + Exonic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177922371 21:27168712-27168734 CAGATCATATAGTACCTTGTGGG - Intergenic
1178455153 21:32742323-32742345 CAGATGATAGAGGATCTTGTAGG - Intronic
1178674830 21:34622251-34622273 CAGATCATATAGAACTTTGTAGG + Intergenic
1179078011 21:38142448-38142470 CACACCATACAGGGCCTTTTGGG + Intronic
1179473275 21:41626279-41626301 CAGAGCAATGAGGACCTTGTTGG - Intergenic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182007179 22:26970518-26970540 CAGGTCATTAAGAACCTTGTGGG + Intergenic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1183223756 22:36534840-36534862 TAGATCACACAGGGCCTGGTAGG + Intergenic
1183380278 22:37487230-37487252 CAGCTCACGCAGGGCCTTGTGGG - Intergenic
1184419325 22:44370391-44370413 CAGAGCCTGCAGGGCCTTGTGGG + Intergenic
1184617395 22:45647285-45647307 CATATCATTCAGGACCTTCATGG - Intergenic
949107452 3:217713-217735 CAGATCACATAAGGCCTTGTAGG + Intronic
949289239 3:2444566-2444588 CAGATCACATAGAGCCTTGTTGG + Intronic
949399588 3:3652026-3652048 CAGTTCATAGAGGACTCTGTGGG - Intergenic
949478729 3:4472998-4473020 TAGATCATGGAGGACCTTCTTGG - Intergenic
949491344 3:4592510-4592532 CAGCTCATACAGGAATTAGTTGG + Intronic
949702865 3:6779478-6779500 CAAATCATATAGGGCCTTATGGG + Intronic
949735853 3:7170818-7170840 CAGGTCATACAGAATCATGTAGG - Intronic
949842955 3:8340036-8340058 CACATCATTCAGGACCTTATAGG - Intergenic
950076552 3:10191458-10191480 TAGACCATGCAGGGCCTTGTAGG - Intronic
950201657 3:11048682-11048704 CAGATCAGACAGGGCCTTGCAGG - Intergenic
951103363 3:18714854-18714876 TAGATCATACTGGGTCTTGTAGG - Intergenic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
951595364 3:24312750-24312772 CACATCACACAGGGCCTGGTAGG + Intronic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952077862 3:29720042-29720064 CAGATCACATAGGGCCTTGTGGG - Intronic
952254315 3:31682354-31682376 CAGATCACATAGGACCTCATGGG - Intronic
952279339 3:31908203-31908225 CAGATCACACAGAACCTTGCAGG + Intronic
952495621 3:33913564-33913586 CAGATCCTCCAGGGCCTGGTGGG - Intergenic
952498343 3:33935765-33935787 CAGAGCATCCAGGGTCTTGTGGG + Intergenic
952845297 3:37683080-37683102 CAGATCCCACAGGGCCTTGAGGG - Intronic
952852846 3:37743032-37743054 CAGTCCTTAGAGGACCTTGTTGG + Intronic
953070064 3:39511321-39511343 CAGATAATTCAGGGCCATGTAGG - Intronic
953442187 3:42927786-42927808 CAGGTCATACAGGACCCACTAGG + Intronic
954219756 3:49145772-49145794 CAGATCTCATAGGACCTTTTGGG - Intergenic
954545387 3:51430177-51430199 CACATCAGACAGAACATTGTGGG + Exonic
954568399 3:51619538-51619560 CAGGTCATCAAGGACATTGTTGG - Intronic
955147674 3:56336367-56336389 CTAATCACACAGGACCTTGCTGG + Intronic
955676322 3:61452753-61452775 CAGATCATTCAGGGTCCTGTAGG - Intergenic
957127514 3:76180842-76180864 CAGAAAATTCAGGGCCTTGTAGG - Intronic
957544752 3:81623148-81623170 CAGATCATATAAAACCTTGTAGG - Intronic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
957947747 3:87086902-87086924 CAGCTCACACAGGGCCTTATAGG - Intergenic
958915388 3:100044612-100044634 CAGATTATACAGGGCCTTATAGG + Intronic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
959353143 3:105293706-105293728 CAGTTAACACAGGAACTTGTGGG + Intergenic
959399637 3:105883914-105883936 CAGACCATGCAGGGCTTTGTAGG - Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959999888 3:112720150-112720172 CACATCATACAGGATTTTGTCGG + Intergenic
961751940 3:129101745-129101767 CAGAGCATATAGGATCTTGCAGG + Intronic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
962141031 3:132791105-132791127 AAGTTCATACAGGGCCATGTAGG - Intergenic
963100024 3:141592434-141592456 TAGATTTTATAGGACCTTGTGGG + Intronic
963219171 3:142788060-142788082 CAGACCATGCATGGCCTTGTAGG + Intronic
963547470 3:146678243-146678265 GAGCTCATACAGGAGCTGGTTGG + Intergenic
963942947 3:151113384-151113406 AAGATCACACAGGAACTTTTAGG + Intronic
964004922 3:151815438-151815460 CATATCATACAGTGCTTTGTGGG + Intronic
964155610 3:153581599-153581621 CAGATCATCCAGTGCCTTATAGG - Intergenic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964435996 3:156654412-156654434 CAAATCATGCATGGCCTTGTGGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964518070 3:157534191-157534213 CAGAGGGTACAGGACATTGTGGG - Intergenic
964763722 3:160158380-160158402 TGGATCATGCAGGGCCTTGTAGG - Intergenic
965676768 3:171205786-171205808 CAGATCATTCAGGGCTTTGCAGG - Intronic
965690112 3:171346851-171346873 CAGATCATCCTGGGCCTTGTAGG + Intronic
965785556 3:172331270-172331292 CCAATCACACAGGACCTTGTGGG - Intronic
965824264 3:172714707-172714729 CAGATCATTTAGGACCATGTAGG + Intergenic
965846485 3:172968247-172968269 CAGATCATACAAGAATTTGAGGG - Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
967861639 3:194156330-194156352 CAGTTCACACAGGGCCTTGAAGG + Intergenic
967861645 3:194156363-194156385 CAGTTCACACAGGGCCTTGAAGG + Intergenic
967946059 3:194805130-194805152 CAGATCATAGAGGACCCTACTGG + Intergenic
968292858 3:197552461-197552483 CAGAACATGGAGGGCCTTGTAGG - Intronic
969854044 4:9984893-9984915 CAGATCACATAAGACCTTGTAGG - Intronic
970330602 4:14979592-14979614 TAGAAGATACAGGGCCTTGTAGG + Intergenic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
971130557 4:23804617-23804639 CAGACCATACAGGGCCTTGTAGG - Intronic
971467317 4:26977310-26977332 CAGATCTCATAGGACCTGGTAGG + Intronic
972625844 4:40797810-40797832 CAGATAGTACAGGGACTTGTGGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974889621 4:67865248-67865270 AAGATCATTCAGGAGCATGTTGG - Intronic
975413855 4:74085657-74085679 TAAATCATACAGGATTTTGTTGG - Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
978103051 4:104866815-104866837 CAGATCATACAGGTCCTTGTAGG - Intergenic
978905825 4:114004525-114004547 CAGATCTTGCAGGACCTAATAGG - Intergenic
979864446 4:125736333-125736355 CAGATCATGGAGGTCATTGTAGG + Intergenic
980091441 4:128447306-128447328 CAGATCATGTTGGACCTTCTAGG + Intergenic
980191504 4:129530557-129530579 AAGATTACACAGGACCTTGAAGG - Intergenic
980546295 4:134267471-134267493 CAGATAAGACAAGACCATGTAGG + Intergenic
981065947 4:140486028-140486050 CTGATCACACAGGGCTTTGTGGG - Intronic
981610323 4:146587157-146587179 CAGATCATATAGGATCTTAAAGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
982054314 4:151532594-151532616 CAGATCAAAGAGGAACTTGGTGG + Intronic
982306848 4:153941539-153941561 CTGGTCATACAGGACTTTGTAGG - Intergenic
983078539 4:163355810-163355832 CAGATGACACAGGTCCTTGTAGG + Intergenic
983239703 4:165218285-165218307 CAGATCACAAAGGGCCTTTTAGG - Intronic
984126556 4:175817571-175817593 CAGATCAAACTGTACCTTCTAGG - Intronic
984216528 4:176919632-176919654 CAGAACATACATGAACTTGGAGG + Intergenic
984504722 4:180602664-180602686 CAGGACATACAGCACCTTCTAGG + Intergenic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
986351674 5:6885788-6885810 CAAATCACACAGGGCCTTGGGGG + Intergenic
986831646 5:11586013-11586035 CAGAGCACAGAGGCCCTTGTTGG + Intronic
987206806 5:15635703-15635725 CAGTTCATATAGGACCTTCTAGG + Intronic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
987493582 5:18614281-18614303 CAGATCTTGCAGTACCATGTTGG + Intergenic
987805043 5:22753454-22753476 CAGATGACATAGGGCCTTGTGGG + Intronic
987960924 5:24807412-24807434 CAGATAATTCAGGGCCTTGAGGG + Intergenic
989488464 5:42021039-42021061 CAGATCACACAGGGTCCTGTAGG + Intergenic
989541905 5:42627902-42627924 CAGATCATACAGGGGCTCGAAGG + Intronic
989807195 5:45624110-45624132 CAGATAATGCAGGACCTTATGGG + Intronic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
990911087 5:60853033-60853055 CAGATCACAAAGGCTCTTGTAGG - Intergenic
991092816 5:62709465-62709487 CAAATCTTAGAGGAGCTTGTAGG + Intergenic
992716993 5:79520783-79520805 CAGATCATGCAGTACCTCTTAGG - Intergenic
992969413 5:82040831-82040853 CAGATCATCTAGGGACTTGTTGG - Intronic
993314475 5:86383555-86383577 CAAACCATAAAGCACCTTGTAGG - Intergenic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
994044127 5:95289120-95289142 CAGATGATACAGGATTCTGTAGG + Intergenic
994416096 5:99473724-99473746 CAGATCATACTGTTTCTTGTTGG - Intergenic
994463873 5:100101448-100101470 CAGATCATACTGTTTCTTGTTGG + Intergenic
994992070 5:107009526-107009548 CAGATCATATAGGGTTTTGTAGG + Intergenic
995092585 5:108195507-108195529 CAGATCACATAGGGTCTTGTGGG + Intronic
995095906 5:108235660-108235682 CAGATCATGCGGGGCCTTATAGG - Intronic
995618695 5:113998313-113998335 TTGCTCATACAGGGCCTTGTGGG - Intergenic
995640843 5:114255546-114255568 CAGATAAGGCAGGGCCTTGTAGG + Intergenic
995982113 5:118117003-118117025 CAGATCATAAATGACCTTGTGGG + Intergenic
996257443 5:121422613-121422635 CAGAGCATGCAGGAACTTTTAGG + Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
996703643 5:126475008-126475030 CAGCTCATATTGGACCATGTTGG - Intronic
996875905 5:128240195-128240217 GAGATCACAAAGGGCCTTGTGGG + Intergenic
996918444 5:128737946-128737968 CAGATCACACAGGATCTTACTGG - Intronic
997307842 5:132852581-132852603 CTGATGATACCAGACCTTGTTGG - Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997705037 5:135942506-135942528 CAGACCTTGCAGGACCTTGTGGG - Intronic
997745695 5:136298396-136298418 CAGGTCATGCAGCACTTTGTAGG + Intronic
997860536 5:137411424-137411446 CAAATCACCAAGGACCTTGTTGG + Intronic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
998010699 5:138693225-138693247 CAGATCATGAATGACCTTATAGG - Intronic
998189916 5:140014873-140014895 CAGATCAAATAGGGCCTTGTGGG - Intronic
998190161 5:140016912-140016934 GAGATCACACAGGGCCTTGGAGG + Intronic
998449292 5:142221840-142221862 CAGATCACACAGGGCTTTGGAGG + Intergenic
998636217 5:143957816-143957838 CAGATCATATAGGTCCCTGTAGG + Intergenic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998727767 5:145037654-145037676 CAAATCATATAGGACTTTTTAGG - Intergenic
998767644 5:145506157-145506179 CAAATCATACAGGCTCTTGTGGG - Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999572147 5:152931303-152931325 CAGATTATACTGGAACTTGTAGG - Intergenic
999861393 5:155650687-155650709 CAGATCATGTAAGAACTTGTGGG + Intergenic
1000112076 5:158117786-158117808 CAAGTCATACAGGACATTGTAGG + Intergenic
1000348271 5:160332488-160332510 CAGATCACACAGGGCCCTGTAGG - Intronic
1000541028 5:162540233-162540255 CAGATCATGAAGGACTTTATGGG + Intergenic
1000901668 5:166918612-166918634 CAGACCACTCAGGACCTTCTAGG + Intergenic
1000971399 5:167718536-167718558 CAGATCCTACAGAACCCTCTGGG + Intronic
1000978985 5:167796312-167796334 TAGATCATGCAGCCCCTTGTAGG - Intronic
1001243929 5:170091668-170091690 CAGATCCTACAGGTCCCTGTGGG + Intergenic
1001804375 5:174570754-174570776 CACATCACACAGGACTTTGTAGG + Intergenic
1001948719 5:175801066-175801088 GAGATCATGCAGGCCCTTCTAGG + Intronic
1002123158 5:177021616-177021638 CAGATTGTACAGGGCCTTGTTGG + Intronic
1003455600 6:6278791-6278813 CAGATCAAGCAGGGCTTTGTAGG + Intronic
1004817642 6:19329946-19329968 CAGATCATATAGGGTCCTGTAGG + Intergenic
1005660200 6:27990511-27990533 CAAATCACACAGGACCATGAAGG + Intergenic
1006548108 6:34796258-34796280 CAGATGATAAAGTATCTTGTTGG + Intronic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1009296869 6:61961780-61961802 AAAATCATACAGGGCCTTGAAGG + Intronic
1010259243 6:73796266-73796288 CAGATCACCCAGGACCCTGTAGG - Intronic
1010308101 6:74348786-74348808 CAGATCATTCAGGAACCTGTAGG + Intergenic
1010944649 6:81959822-81959844 CATATCATACATGGCCTTGGAGG - Intergenic
1011801365 6:91019740-91019762 CAGGTCCTGCAGGACTTTGTGGG - Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012397032 6:98810453-98810475 CAGATCATACAGGGCATTGTAGG - Intergenic
1012552524 6:100477089-100477111 CAGATCACATAGGCCCTTGGAGG + Intergenic
1012649393 6:101734676-101734698 CAGATCCTACAGGGCCCTGAAGG + Intronic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1012817659 6:104044379-104044401 CAGAATTTACAGGCCCTTGTAGG + Intergenic
1013548437 6:111183121-111183143 CAGATTGTGAAGGACCTTGTAGG - Intronic
1014275181 6:119380074-119380096 CAGATCATAGAGAACCTAGGAGG + Intergenic
1014368625 6:120577230-120577252 CAGATAACAAAGGACCTTGAAGG + Intergenic
1014516715 6:122387781-122387803 CAAATCACACAGGTGCTTGTAGG + Intergenic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1014887121 6:126795362-126795384 CAGATCATACACAACCCTGCAGG - Intergenic
1015209959 6:130685771-130685793 GAGATAATGAAGGACCTTGTAGG + Intergenic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015645171 6:135379675-135379697 CAGATTGTACAGAACCTTGTAGG - Intronic
1015809094 6:137143292-137143314 CAGATCATACAGCGCCTTGGAGG + Intergenic
1015911097 6:138168440-138168462 CAGATCATGAAAGTCCTTGTTGG + Intronic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016532658 6:145075466-145075488 CAGATTATACAGGACCTCATAGG + Intergenic
1016699993 6:147043531-147043553 CAGATCACATAGGATCTTGGAGG - Intergenic
1017321980 6:153105077-153105099 CAGATCACACTGGGCCTTGAGGG + Intronic
1017440761 6:154462558-154462580 AAGATCACACTGGACCTTTTTGG - Intronic
1018331530 6:162732874-162732896 TAGATCACACAAGACCTTGCTGG - Intronic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1020524060 7:9235835-9235857 CAGATCATGCAGCAACTTGTTGG + Intergenic
1021096967 7:16546626-16546648 CAGTGTGTACAGGACCTTGTTGG - Intronic
1021490875 7:21219111-21219133 CTGGGCATACAGGACTTTGTAGG - Intergenic
1021928201 7:25553526-25553548 CAGATCCCACAGGAGCTTCTTGG - Intergenic
1022144620 7:27524661-27524683 CAGATCATATGGGGCCTTGCAGG - Intergenic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1025309725 7:57917229-57917251 CACATCATAGAGAACTTTGTCGG - Intergenic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026337873 7:69410432-69410454 CAGATCATCTACAACCTTGTGGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1026450005 7:70520319-70520341 CAGATCAGGGAAGACCTTGTGGG - Intronic
1026823820 7:73568588-73568610 CAGGTTACACAGGACCTTGCAGG + Intergenic
1027419570 7:78006168-78006190 CAGATCACACAGGGCCTAATCGG - Intergenic
1028751657 7:94390164-94390186 CAGATCAAAAAGGACCTTTTAGG - Intergenic
1028981752 7:96974964-96974986 CAGATCCTGAAGGGCCTTGTAGG - Intergenic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1029856724 7:103524950-103524972 GATATCAGGCAGGACCTTGTGGG - Intronic
1029970380 7:104782729-104782751 CAAATCACAAAGGACCTAGTTGG - Intronic
1030112482 7:106038556-106038578 CATATCACATAGGGCCTTGTAGG + Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030618205 7:111760874-111760896 CAGATCATTCAGGTACTTTTTGG - Intronic
1030815569 7:114032416-114032438 CCAATCATAAAGCACCTTGTAGG - Intronic
1031509095 7:122626141-122626163 CAGATCACACAGGACTTTGCAGG + Intronic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1032043544 7:128582725-128582747 CAGATCACGCAGGAGCTTTTAGG - Intergenic
1032327107 7:130939836-130939858 CAGATCATCAATGACCTTCTGGG + Intergenic
1032429178 7:131847058-131847080 CACATCATGCAGGACCTCTTTGG + Intergenic
1032749975 7:134829631-134829653 TAGATTATACACGACATTGTAGG + Intronic
1033076453 7:138254420-138254442 CAGAGCATACATGGCCTTCTGGG - Intergenic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1033548726 7:142425938-142425960 CAAATGATAGATGACCTTGTAGG - Intergenic
1034410324 7:150937842-150937864 CAGAGCAGACTGGGCCTTGTGGG - Intergenic
1036505280 8:9349238-9349260 CAGATCATGCAGGGTCTTATCGG - Intergenic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1037316464 8:17604047-17604069 CAGACCATGGAGGGCCTTGTTGG + Intronic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1038669206 8:29568664-29568686 AAGTCCATACAGGATCTTGTTGG + Intergenic
1039140184 8:34378434-34378456 CAGATCACATAAGGCCTTGTAGG - Intergenic
1039605500 8:38877095-38877117 GAGAGCATTCAGGGCCTTGTAGG + Intergenic
1041106075 8:54445161-54445183 CAGTTCATATGGGACCTTGTAGG + Intergenic
1041176253 8:55200034-55200056 CACATCAGACAGTACCATGTGGG + Intronic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042150798 8:65781368-65781390 CAGATCATGCTGGACCTTTGTGG + Intronic
1042275976 8:67005954-67005976 CAGATCATAAAGGTCATTTTAGG - Intronic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1044211063 8:89551923-89551945 CAGCTGAGACAGGGCCTTGTAGG + Intergenic
1044306979 8:90649416-90649438 TAGATCATAAAGGGCTTTGTAGG - Intronic
1044889826 8:96822607-96822629 CATATCATGCAGGACCTCCTGGG - Intronic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045663092 8:104458270-104458292 CAGGTCATGCAGGACCTTATGGG - Intronic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046078284 8:109338064-109338086 CAGATCATGAAGGATCATGTAGG + Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047348266 8:124049355-124049377 AGGATCATACAGGTCCTTTTAGG + Intronic
1047714733 8:127585126-127585148 CAGATCCTACGGGTCCTTGTTGG - Intergenic
1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG + Intronic
1048445349 8:134489068-134489090 CAGATCATGAAGGATCTTATAGG + Intronic
1048904019 8:139069479-139069501 CGGATCACTCAGGACCTGGTAGG + Intergenic
1049764969 8:144350925-144350947 AGGAGCTTACAGGACCTTGTGGG - Intergenic
1050541760 9:6676381-6676403 CACATCATATAGGACTTTGTGGG - Intergenic
1051347159 9:16162583-16162605 AAGATCCTATAGGACCTTGTGGG + Intergenic
1051783239 9:20713203-20713225 CAGGTCATAAAAGGCCTTGTAGG - Intronic
1053189541 9:36050673-36050695 CAGATCATACAGGTCTCTATAGG - Intronic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1055434240 9:76276449-76276471 AAGATCATATAGGATCTTATAGG - Intronic
1055660122 9:78494872-78494894 CAGATCATGCAAGGCTTTGTGGG + Intergenic
1056289274 9:85126387-85126409 CAGGTCATGCAGGATCTTCTGGG + Intergenic
1056489835 9:87095051-87095073 AAGATCTTATAGGGCCTTGTAGG - Intergenic
1056736641 9:89215429-89215451 CTGTTTATGCAGGACCTTGTGGG - Intergenic
1057208497 9:93186898-93186920 CAGAACCTACAGGACCATGAGGG - Intronic
1057321036 9:94013043-94013065 CAGACCACACAGGGCCTTCTGGG - Intergenic
1058532821 9:105924057-105924079 CAGATCCTGCAAGGCCTTGTGGG - Intergenic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059592187 9:115673675-115673697 CAGATCATGCATGGCTTTGTAGG - Intergenic
1059604029 9:115813461-115813483 CAGGTCATGAAGGACCATGTGGG - Intergenic
1059622292 9:116020279-116020301 CAGATCATTTGGGACCTTCTGGG - Intergenic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1060975562 9:127762955-127762977 CAGGCCACACAGGGCCTTGTGGG - Intronic
1203407976 Un_KI270538v1:65253-65275 CAGATCATAAAGTACTTTCTGGG + Intergenic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1186977971 X:14928593-14928615 CTCATCATTCAGGACTTTGTAGG - Intergenic
1187202257 X:17146181-17146203 CAGATCGTACAGGGCCTTGTGGG - Intronic
1187245639 X:17550852-17550874 CAGATCACATAGGGTCTTGTGGG - Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1187277127 X:17826089-17826111 CAGATCAGATAGGGCTTTGTAGG - Intronic
1187508276 X:19895003-19895025 CAGATCAAACAAGACCCTGCAGG + Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188661365 X:32762743-32762765 CAGATCACACAGGGTCTTGCTGG + Intronic
1189105991 X:38235819-38235841 CAGATCAAACAGGGCCTTTTTGG - Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1189907777 X:45779583-45779605 CAGATCACATAGGACTTTCTAGG + Intergenic
1190216104 X:48480464-48480486 CAGATCCTATAGGGCCTCGTGGG + Intronic
1190336825 X:49267645-49267667 TAGACCACGCAGGACCTTGTAGG + Intergenic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190702120 X:52996894-52996916 CAGATTATACAGGACCTTCTGGG + Intergenic
1191024947 X:55904208-55904230 TAGATCATACAAGGCCTTGTAGG + Intergenic
1192099018 X:68244042-68244064 CAGATCATAGGGGATTTTGTAGG - Intronic
1192270997 X:69579307-69579329 CAGATAAAAAAGGACATTGTAGG - Intergenic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192555211 X:72083863-72083885 CAGATCGTGCAGGGCCTTCTAGG - Intergenic
1193515040 X:82452310-82452332 CAGATCATACCTGACCTTTGGGG + Intergenic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1194423601 X:93708314-93708336 CAGATCATATAGGACCTTATAGG + Intronic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195691047 X:107625970-107625992 CTGATCATGCAGAACCTTATAGG - Intergenic
1195700832 X:107704426-107704448 CAGATCACGCAGGCACTTGTAGG + Intergenic
1195725717 X:107913912-107913934 AAAATCATGCAGGACTTTGTAGG - Intronic
1195898587 X:109773607-109773629 CAGATCACACAGGGCCTTGTAGG + Intergenic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1196848785 X:119917956-119917978 CAGATCACACAGGGCCTTGTAGG - Intronic
1197712919 X:129684952-129684974 CAGATCAGGCAGGGCCTTCTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197835029 X:130685286-130685308 CAGATCATATCTGACCTTCTAGG + Intronic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198163009 X:134026129-134026151 CAGATCTTATAGGGCCTTGTAGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198448235 X:136739922-136739944 CAGATCCTGGAGGACCTTGGAGG + Intronic
1198705579 X:139444890-139444912 CAGATCATAGATAACCTTGTGGG - Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1198791548 X:140352344-140352366 CAGATCACACAGGGCCTTGTAGG + Intergenic
1198910151 X:141604656-141604678 CATACCATACAGAGCCTTGTAGG + Intronic
1198994587 X:142559853-142559875 CAGTTCAAAGAGGGCCTTGTTGG + Intergenic
1199297925 X:146180352-146180374 AAGAACAGAAAGGACCTTGTAGG - Intergenic
1199300560 X:146208581-146208603 CAGATCATATAGGGCCATATAGG + Intergenic
1199319321 X:146419809-146419831 CAGCTCATTCAGGGCCTGGTAGG + Intergenic
1199778274 X:151034728-151034750 CAGATCCTATAGGACCTTGTGGG - Intergenic
1199798987 X:151230848-151230870 CACACCACACAGGACCATGTGGG + Intergenic
1199923011 X:152429503-152429525 TAGATCTTAAAGGACCTTGTAGG - Intronic
1200250118 X:154548272-154548294 CCGATGGTACAGGGCCTTGTAGG + Intronic
1201503152 Y:14667949-14667971 CAGATCATTCAGGTCCCTGTTGG + Intronic
1201727604 Y:17170892-17170914 CAGAACATAGATGACCTTGTGGG + Intergenic