ID: 1091433759

View in Genome Browser
Species Human (GRCh38)
Location 12:458097-458119
Sequence CTGCAGTTCTTTAGCAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091433759 Original CRISPR CTGCAGTTCTTTAGCAAAAA GGG (reversed) Intergenic
905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG + Intergenic
906848921 1:49226567-49226589 CAGAAGTTCTTGTGCAAAAATGG + Intronic
909930722 1:81496357-81496379 CTTTTTTTCTTTAGCAAAAAAGG + Intronic
911042696 1:93603619-93603641 CTGCAGAACTTTAGCCAAAAGGG - Intronic
911519164 1:98908224-98908246 CTGTAGTTCTTTAGGAGCAAAGG + Intronic
912564440 1:110576408-110576430 TTTCAGTCCTTCAGCAAAAAGGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919830674 1:201538632-201538654 CCGCAGTTCTTTAGGAGAAGGGG - Intergenic
1071448141 10:85768721-85768743 CTGCAGTGCTTTACCAAACTGGG - Intronic
1073133291 10:101204719-101204741 CTGCAGGTCTTGAACAAAACAGG + Intergenic
1074904042 10:117844971-117844993 CTGCAGTTATAGAGCAAAAGGGG + Intergenic
1076978707 11:193930-193952 CTGCAGATCTTTAGAAAATGGGG - Intronic
1077243732 11:1525594-1525616 CAGCACTTCTTCAGCCAAAAAGG + Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1079908191 11:26275832-26275854 TTAAAGTTCTTTAGCTAAAAAGG - Intergenic
1081901896 11:46635763-46635785 CTACAGTTATTGAGCCAAAAAGG - Intronic
1083084834 11:60131961-60131983 TTGCAGTGCTTTAGAAAACAAGG + Intergenic
1085803716 11:79615190-79615212 GTGCAGTTCTTTAGCAAGTCTGG - Intergenic
1085892537 11:80597983-80598005 CTGCATTGATTTAACAAAAAAGG - Intergenic
1086440041 11:86819923-86819945 CTCCAGTGCTTTATCAAAAATGG + Intronic
1086471204 11:87113206-87113228 CTGCAGCTTTTTAGTAAAAATGG - Intronic
1088083164 11:105945112-105945134 CTGGAGTTCCTTAGGAAGAAGGG - Intronic
1088112348 11:106277221-106277243 CTGCAGTTCTTTAGTTTCAAGGG + Intergenic
1088727107 11:112648981-112649003 TTGCATTTCTGTAGGAAAAAGGG + Intergenic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1089672224 11:120064438-120064460 CTGCAATTCTCCAGCACAAATGG + Intergenic
1089880719 11:121770731-121770753 CTACAGTTCTTTAAATAAAATGG + Intergenic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1092167581 12:6352381-6352403 CTGGAGATCTTTAGGAAGAAGGG + Intronic
1092269282 12:7009952-7009974 TTGCAATTCTTTAGTAAAATTGG + Intronic
1095365843 12:41404002-41404024 CTGAAGTTCTTTATATAAAATGG + Intronic
1095375882 12:41528049-41528071 CTGTAGCCATTTAGCAAAAAGGG + Intronic
1096245239 12:49981219-49981241 CTGCAGTTAATTAGCAGAAAAGG + Intronic
1096522024 12:52189790-52189812 TTGAAGTTCTTTAGCAGAATTGG - Intronic
1100618200 12:96247770-96247792 CTTCAGTGGCTTAGCAAAAAAGG + Intronic
1103572631 12:121855140-121855162 ATGCATTTATTTAGCAAAACTGG + Intronic
1104162921 12:126198007-126198029 CAGCAGTTCCTTGGCCAAAAGGG + Intergenic
1105740288 13:23316383-23316405 CTGCACTTCTTTAGCCATAAAGG - Intronic
1107576827 13:41733592-41733614 CTTCAGTTTTTTAGCAGAGATGG + Intronic
1107981808 13:45741165-45741187 ATGCAGTTCTTCACCAAACAGGG + Intergenic
1108127795 13:47263320-47263342 CTGCAAATCTGCAGCAAAAACGG - Intergenic
1108331174 13:49386082-49386104 CTGTAGTTCTATAGCACTAAGGG + Intronic
1109096299 13:58121099-58121121 CTGGAGTAATTTAGAAAAAAAGG + Intergenic
1109145842 13:58778943-58778965 GTGCACTTCTTTGGCAGAAATGG - Intergenic
1110041868 13:70771369-70771391 TTACAGTTCTTTAGAAAGAAAGG + Intergenic
1112931527 13:104745268-104745290 CTCCACCTCTTTAGGAAAAATGG - Intergenic
1117919899 14:60718694-60718716 TTGCATTTCTTTAGGCAAAATGG - Intronic
1119219502 14:72894385-72894407 CTGCAGTTATTTAGAAAAGTAGG - Intergenic
1121779045 14:96609970-96609992 CTGCATTTGTTAAACAAAAATGG - Intergenic
1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG + Intergenic
1126491498 15:49241909-49241931 CTGCAGTGCCTAAGCAAAAAGGG + Intronic
1127905278 15:63371646-63371668 TTGCAGATCTTGAGCAAACAGGG + Intronic
1128446474 15:67766042-67766064 TTCCAGTTGTTTAGCAAAAGGGG + Intronic
1129643311 15:77405529-77405551 CTTGAGATCTTTAGCCAAAAAGG + Intronic
1134668378 16:16036557-16036579 TTCCAGTTCTTTACCAAAACAGG - Exonic
1137662115 16:50216875-50216897 CAGCAGTTCTTTTCAAAAAATGG - Intronic
1138836526 16:60442977-60442999 CTGCATTTACTTATCAAAAATGG - Intergenic
1140450759 16:75069057-75069079 CTGCTGCTCTTTAGCCAAAGGGG + Intronic
1142466136 17:138421-138443 CTGCAGATCTTTAGAAAATGGGG - Intronic
1147632231 17:41939532-41939554 CTGCAGATGTCAAGCAAAAAGGG + Intronic
1147892460 17:43726982-43727004 CTGCACTTCTCAAGAAAAAATGG + Intergenic
1149248383 17:54738752-54738774 CTGCATGTCTTTGGCAGAAAGGG - Intergenic
1149393535 17:56216077-56216099 CTGAAGTTCTTTCTCACAAAAGG - Intronic
1153078198 18:1190059-1190081 GAGCAGTTCTATAGCAAAAGGGG + Intergenic
1156424125 18:36990167-36990189 GTCCAGTTCTTTAAGAAAAATGG + Intronic
1158610959 18:58940449-58940471 AAGCGGTTCTTTAGCAAAAAGGG + Intronic
1159963920 18:74577914-74577936 CTGCAGATCTTGGGCAAAGAGGG + Intronic
1166580369 19:43893271-43893293 CTGCAGTTCCTTTGCAAGATGGG + Intronic
925196527 2:1930385-1930407 CTGCATTTATTGAGCAAAAGAGG - Intronic
931058757 2:58502732-58502754 TTGCAGTTCTTTTGAAAGAAAGG + Intergenic
931108605 2:59085377-59085399 TTGCAATTCTTTAAAAAAAAAGG - Intergenic
933637510 2:84723897-84723919 CTGGAAGTCTTTAGCAAAATTGG - Intronic
934654800 2:96111864-96111886 CTGCATTTCTCTAGTATAAAAGG + Intergenic
935839737 2:107096258-107096280 CTGCAGCTCTCTTGCAAGAAAGG + Intergenic
936725840 2:115314253-115314275 CCACAGTTCTTCAGCAACAATGG + Intronic
939999942 2:148957148-148957170 CTGAAGTTCTTTTGGAAACAAGG + Intronic
940506189 2:154556460-154556482 ATGCAGAACTTTAGCAATAATGG + Intergenic
942162553 2:173207010-173207032 CTGCTGTTCTTTTGCAATGAGGG + Intronic
942985291 2:182133914-182133936 CTGCAATTCTTTCGCACAGAGGG + Intergenic
943269430 2:185779778-185779800 ATGCAGTACTTTAGAACAAATGG - Intronic
943371472 2:187022183-187022205 CTCCAGTTCTTAAGTACAAAGGG + Intergenic
944247954 2:197551848-197551870 CTCCAGTGCTTTATCAAAAATGG - Exonic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
944302672 2:198142148-198142170 CTGCATTTTTTTGGTAAAAATGG + Intronic
945806440 2:214495729-214495751 TTGGATTTCTTTAGAAAAAATGG - Intronic
948497100 2:238357933-238357955 CAGCAGATGTTTACCAAAAAAGG - Intronic
1170063610 20:12286705-12286727 ATGCAGTTCTTTTTAAAAAATGG + Intergenic
1173463924 20:43266291-43266313 CTGCAGATCTATAACAAAGATGG - Intergenic
1175536048 20:59713759-59713781 CAGCAATTCTTTACCAAAAAAGG - Intronic
1179285051 21:39970051-39970073 CTTCAGTTCTATAGGAAAATTGG - Intergenic
1181980443 22:26762267-26762289 GTCCAGTTCTGTAGCAAGAAGGG + Intergenic
1182111365 22:27726106-27726128 CTGGACTTCTTTGTCAAAAAGGG + Intergenic
949922475 3:9013835-9013857 CTCCAGTTCTGTAACATAAAGGG + Exonic
951378948 3:21958678-21958700 CTGCAGTAATTTAGAAAAATAGG - Intronic
955745860 3:62139856-62139878 CTCCAGGCCTCTAGCAAAAAAGG + Intronic
955918858 3:63933666-63933688 CTACTTTTCTTTTGCAAAAAAGG + Intronic
956179659 3:66505236-66505258 CTGCAGTTCCACAGCAAGAATGG + Intergenic
957634819 3:82768275-82768297 CTGGAGTAATTTAGAAAAAATGG + Intergenic
957728418 3:84099347-84099369 CTGCAAGTCTCTAGCATAAAAGG - Intergenic
958667229 3:97156990-97157012 CTGTACTTCTTAAGCAAGAATGG - Intronic
959788010 3:110324393-110324415 CTGCAGCTCTTTACCATAAGAGG + Intergenic
960407792 3:117283329-117283351 CTGAATTTCTATAACAAAAATGG + Intergenic
961724186 3:128915237-128915259 CTCCAGTACATTAGCAAACAGGG + Exonic
965441399 3:168719636-168719658 CTTCAGTGCTTTTGGAAAAAGGG - Intergenic
967175820 3:186863173-186863195 CTTTAGTTATTTAGAAAAAAAGG + Intergenic
968248650 3:197183412-197183434 GTGTAGGTCTTTAGCACAAAAGG - Intronic
968719808 4:2193218-2193240 CTGCAGTTTTTTGGCAATGATGG - Exonic
969897145 4:10316081-10316103 TTGAAGTTCTTTAGTATAAAAGG + Intergenic
972023647 4:34348297-34348319 TGGCAGATCTTTAGGAAAAAAGG - Intergenic
975427799 4:74250912-74250934 CTGGAGTTCTGTGGCAAAATGGG + Intronic
975981366 4:80163453-80163475 CTGAAATTCTTTATCAAGAATGG + Intergenic
976518625 4:86001144-86001166 CTTCATTTCCTCAGCAAAAAAGG - Exonic
977789668 4:101084699-101084721 ATTCAGTTCTTTGGCAAAAAGGG + Intronic
978424320 4:108566371-108566393 CTGAAGTTCTTCAATAAAAAAGG + Intergenic
978854987 4:113384664-113384686 CTGAAGTTCTTTTACAAAAATGG - Intergenic
978868071 4:113539720-113539742 CTGCAGTTATGTAGAAGAAAAGG + Intronic
980138545 4:128886858-128886880 CTTGAGTTCTATAGTAAAAAGGG - Intronic
981270801 4:142846011-142846033 CTCCAGCTCTTTAGCTTAAAGGG - Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
988551739 5:32206424-32206446 CTGTAATTGTTTAGGAAAAATGG - Intergenic
988944240 5:36179344-36179366 CTTAAGTTCTTTAGCATAGATGG - Intronic
989775196 5:45198336-45198358 CTGCGGTTTTTAATCAAAAAAGG - Intergenic
990568645 5:57055446-57055468 CTGAAGTTTTCTAGCTAAAAAGG - Intergenic
991606893 5:68411643-68411665 ATGCTGTTCTGTAGCAAAATAGG - Intergenic
992530411 5:77646769-77646791 TTGCAGTCCTTTTACAAAAATGG - Intergenic
992996222 5:82336288-82336310 CTGCATTTGTTTAACATAAATGG + Intronic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
994053646 5:95390890-95390912 GTTCAGTTATTTAGCCAAAAGGG - Intergenic
994840258 5:104914968-104914990 CTGCAGTTATATAGCAAAAAAGG + Intergenic
998010967 5:138695341-138695363 CTCAAATTCTTAAGCAAAAATGG - Intronic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
999661356 5:153866562-153866584 CTGAAGTTCTCTATCAAATATGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1003754866 6:9105705-9105727 CTGCATTTCTTTTAAAAAAATGG + Intergenic
1003794608 6:9586895-9586917 CTGCATTAGTTTAGCATAAAAGG - Intergenic
1004196698 6:13511899-13511921 CCTCAGATCTTTAGCAAGAATGG + Intergenic
1004270391 6:14190106-14190128 CTTCTGCTCTTTAGCAAAAGGGG - Intergenic
1005403041 6:25455005-25455027 CTGGAGTTTGTTAGCAAATATGG + Intronic
1005658603 6:27968899-27968921 CTGCAGTTCTTTATAAAAGTTGG - Intergenic
1006569310 6:34987519-34987541 CTGCACTTCTGGAGCAAAGAAGG + Intronic
1008432177 6:51432234-51432256 CTGCAGTTCTTTTGCTAGAGAGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009820372 6:68792409-68792431 CTACTGTTATTTAGCAATAATGG - Intronic
1009868633 6:69429445-69429467 ATGTGGTTCTTTAGAAAAAAGGG + Intergenic
1011053827 6:83184347-83184369 CTGAAGTTATTTAACAGAAATGG + Intronic
1011567469 6:88691937-88691959 ATGCAGTTCTTTACTAAGAAAGG - Intronic
1012570694 6:100724368-100724390 CTGCAGTGGTTTAGTCAAAAGGG + Intronic
1014393004 6:120888211-120888233 TTGATGTTCTTTAGCCAAAAAGG + Intergenic
1016323000 6:142868225-142868247 CTTCAATCCTTTATCAAAAATGG + Intronic
1018343626 6:162879334-162879356 CTGAATTTCTTGAGCAAGAAGGG - Intronic
1018810709 6:167295946-167295968 CTGCAGTTCTTTAGTCAATCTGG - Intronic
1020501436 7:8926706-8926728 ATGCATTCCTTTAGTAAAAAAGG - Intergenic
1020755621 7:12199218-12199240 CTGCAATTTCTTAGTAAAAAGGG + Intergenic
1021355158 7:19645017-19645039 CTGAAGTTCTTTGGAAGAAATGG - Intergenic
1021954041 7:25806019-25806041 CTGTAGTTGTTTAGCAGAGACGG - Intergenic
1024435151 7:49343436-49343458 CTGGAGTTCTAGAACAAAAAGGG + Intergenic
1025157914 7:56626006-56626028 TTGCAGAACTTTAGCAAAATTGG - Intergenic
1027869396 7:83687603-83687625 CCGCACTTCTATAGCAAAGATGG + Intergenic
1028082587 7:86597625-86597647 TTCCAGTTCTCTAGTAAAAAGGG + Intergenic
1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG + Intronic
1030319274 7:108146924-108146946 CTGGGGCTCTTTAGCAAAAAGGG - Intergenic
1030826150 7:114160815-114160837 GTTCAGTTCTTTATCACAAAGGG + Intronic
1031845619 7:126802710-126802732 CTGCAGCTCTTAAGGAAAATAGG - Intronic
1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG + Intronic
1032272439 7:130422487-130422509 CTGCAGCCCTTTAGCCAACAGGG - Intronic
1032971629 7:137170935-137170957 CTGGAATTCATTAGAAAAAACGG + Intergenic
1033168244 7:139060077-139060099 CTGCAGTTCTAAAGCAGAATAGG + Intronic
1034850756 7:154491306-154491328 CTGCTGTGCGTTAGCAACAATGG + Intronic
1037905747 8:22715185-22715207 CAGGAGTTCTTTTGCAGAAAGGG + Intronic
1038157565 8:25004497-25004519 CTGCTTTTGTTTAGCAATAAGGG + Intergenic
1039464227 8:37772177-37772199 CTGCAGTTTTTTAGTAGAGATGG + Intronic
1040714986 8:50240211-50240233 CTGCATTTCAGGAGCAAAAATGG - Intronic
1042151165 8:65786103-65786125 CTTAATTTCTTAAGCAAAAAAGG + Intronic
1042422766 8:68611354-68611376 CTGCATTTCTTTTGGAAAAAGGG + Intronic
1045017202 8:98010138-98010160 CTCCTGTTCTTTAGCCAAAGTGG + Intronic
1046575624 8:116025226-116025248 TTGCAGTGCTTTAGGAGAAATGG - Intergenic
1051989339 9:23132387-23132409 CAACAGTTATTAAGCAAAAAAGG - Intergenic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054337616 9:63820845-63820867 CTGCAGTTCTTAAAACAAAACGG + Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1055096895 9:72423192-72423214 CTGCATTTCTTCTGCAAATAGGG - Intergenic
1056068556 9:82962077-82962099 CTGCAATTCGATTGCAAAAATGG + Intergenic
1058335549 9:103823846-103823868 ATGCAGTTATTTGGGAAAAATGG + Intergenic
1059872909 9:118597782-118597804 CTGAACTTCTTAAGCTAAAATGG - Intergenic
1060248870 9:121969639-121969661 CTTCAACTCTTTAGCAAAAGAGG - Intronic
1186131708 X:6473735-6473757 CTGAATTTCTATAGCAACAATGG + Intergenic
1186546947 X:10459829-10459851 GTGCAGTTCTTTGGCACAAGGGG + Intronic
1187558526 X:20376721-20376743 CTACAGTTTAATAGCAAAAATGG - Intergenic
1189818622 X:44848455-44848477 CTGCATTTCTTTTGAAACAAAGG + Intergenic
1189996468 X:46643803-46643825 CAGCATTTCCTTAGCAAAAGGGG + Intronic
1193121378 X:77825954-77825976 CAGCAGCTCTTTTGCAAACATGG - Intergenic
1194824570 X:98545741-98545763 TTGCAGCTCTTCAGTAAAAAGGG - Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1195789475 X:108567192-108567214 CTCTAATTCTTTAGCAAAACTGG - Intronic
1197012664 X:121586137-121586159 CTCAAGTTCTTTAGCTAAAATGG - Intergenic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1198690863 X:139282768-139282790 CTCCAGTTCTTTACCTAAAATGG + Intergenic
1198971878 X:142291103-142291125 CTGCATTTGCTTAGGAAAAAAGG - Intergenic
1202270023 Y:23062346-23062368 CAGCATTTATTTAACAAAAAAGG - Intergenic
1202296004 Y:23358336-23358358 CAGCATTTATTTAACAAAAAAGG + Intergenic
1202423017 Y:24696091-24696113 CAGCATTTATTTAACAAAAAAGG - Intergenic
1202447772 Y:24973995-24974017 CAGCATTTATTTAACAAAAAAGG + Intergenic