ID: 1091434764

View in Genome Browser
Species Human (GRCh38)
Location 12:463649-463671
Sequence AGCTGTGCCCCCATTTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091434764_1091434765 -2 Left 1091434764 12:463649-463671 CCTCTTGAAATGGGGGCACAGCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1091434765 12:463670-463692 CTCTCCCAACTAATATTTCATGG 0: 1
1: 0
2: 0
3: 12
4: 161
1091434764_1091434769 15 Left 1091434764 12:463649-463671 CCTCTTGAAATGGGGGCACAGCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1091434769 12:463687-463709 TCATGGAAATGGTGACATTTTGG 0: 1
1: 0
2: 10
3: 46
4: 436
1091434764_1091434768 4 Left 1091434764 12:463649-463671 CCTCTTGAAATGGGGGCACAGCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1091434768 12:463676-463698 CAACTAATATTTCATGGAAATGG 0: 1
1: 0
2: 1
3: 32
4: 367
1091434764_1091434770 16 Left 1091434764 12:463649-463671 CCTCTTGAAATGGGGGCACAGCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1091434770 12:463688-463710 CATGGAAATGGTGACATTTTGGG 0: 1
1: 0
2: 3
3: 33
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091434764 Original CRISPR AGCTGTGCCCCCATTTCAAG AGG (reversed) Intronic