ID: 1091434764

View in Genome Browser
Species Human (GRCh38)
Location 12:463649-463671
Sequence AGCTGTGCCCCCATTTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091434764_1091434770 16 Left 1091434764 12:463649-463671 CCTCTTGAAATGGGGGCACAGCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1091434770 12:463688-463710 CATGGAAATGGTGACATTTTGGG 0: 1
1: 0
2: 3
3: 33
4: 360
1091434764_1091434768 4 Left 1091434764 12:463649-463671 CCTCTTGAAATGGGGGCACAGCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1091434768 12:463676-463698 CAACTAATATTTCATGGAAATGG 0: 1
1: 0
2: 1
3: 32
4: 367
1091434764_1091434769 15 Left 1091434764 12:463649-463671 CCTCTTGAAATGGGGGCACAGCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1091434769 12:463687-463709 TCATGGAAATGGTGACATTTTGG 0: 1
1: 0
2: 10
3: 46
4: 436
1091434764_1091434765 -2 Left 1091434764 12:463649-463671 CCTCTTGAAATGGGGGCACAGCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1091434765 12:463670-463692 CTCTCCCAACTAATATTTCATGG 0: 1
1: 0
2: 0
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091434764 Original CRISPR AGCTGTGCCCCCATTTCAAG AGG (reversed) Intronic
900118359 1:1038190-1038212 AGCTGGGGCCACATTCCAAGAGG + Intronic
900559190 1:3295291-3295313 AGCTGCACCCTCATTTAAAGAGG - Intronic
910341371 1:86192105-86192127 ATCTCTGCCCCCATTTCACAAGG - Intergenic
911944895 1:104094657-104094679 AGTTGTGCCCACATTTCAAAAGG + Intergenic
917152907 1:171963974-171963996 AGCTGTGCCTGAGTTTCAAGGGG - Intronic
919745556 1:201006294-201006316 AGCAGTCACCCCATTTCAGGTGG + Intronic
921106890 1:211990325-211990347 AGATGTTCCCCCATATTAAGAGG + Intronic
923811274 1:237319944-237319966 AGCTGTGCCACCTTGTCAAAGGG - Intronic
924573194 1:245256711-245256733 AGCTGTGCCTGAATTCCAAGGGG - Intronic
1062943585 10:1443246-1443268 AGCTTTTGCCCCATTTCATGTGG + Intronic
1064203399 10:13302519-13302541 AGCAGTGCCCACATTTCACCAGG - Intergenic
1064230040 10:13521716-13521738 AGCTGAGCCCCACTTCCAAGAGG - Intronic
1067521973 10:47014376-47014398 AGCTTTGCCCCCAATTCAAGGGG - Intergenic
1071394935 10:85213519-85213541 TGCTGTGCACCCATTTCTACAGG - Intergenic
1074111947 10:110429041-110429063 AGCTGCTTCCCCATTTGAAGGGG - Intergenic
1076787961 10:132760429-132760451 AGCAGAGCCCTCATTGCAAGAGG + Intronic
1078659535 11:13276294-13276316 GTCTCTGCCCCCATTTCATGAGG - Intergenic
1079805516 11:24925233-24925255 AGCTGTGCCTGGATTTCAACAGG + Intronic
1082814970 11:57501639-57501661 AGAAGTGCCCCCATATCTAGAGG + Intronic
1083922825 11:65789712-65789734 AGCGTTGACCCCATTTCCAGTGG + Intronic
1085537361 11:77230778-77230800 AGCTGTGCCTCCCTATCAAGAGG + Intronic
1085970747 11:81587728-81587750 AGCTGAGCCCTCATTTTCAGAGG - Intergenic
1089494638 11:118902004-118902026 AGCTGCGCACCCATTCCAGGTGG + Exonic
1091434764 12:463649-463671 AGCTGTGCCCCCATTTCAAGAGG - Intronic
1092510914 12:9155395-9155417 AGCAGTGCCAACATTTGAAGTGG - Intronic
1093412791 12:18886699-18886721 ACCTGTGCCCCCATCTTTAGAGG - Intergenic
1094430155 12:30359764-30359786 AGCAGTGCCCCCATTTAATGAGG + Intergenic
1096309175 12:50505189-50505211 AGCTGCGCCCGCACTTCAGGCGG - Exonic
1096315238 12:50558841-50558863 ACTTTTGCCCCCATTTCCAGAGG - Intronic
1099196245 12:79619597-79619619 AGCAGTACCCCCATATCAAAGGG - Intronic
1099501246 12:83417157-83417179 CACTGTGCTCCCATTTCACGTGG + Intergenic
1100580965 12:95940160-95940182 AGTTATGCTCCCATTTCAAATGG - Intronic
1101537929 12:105636997-105637019 AAATGTGACCCAATTTCAAGGGG + Intergenic
1102416028 12:112763712-112763734 AGCTGTGCCTGAATTTCAAGAGG + Intronic
1102437606 12:112937602-112937624 AGCTTTGTGCCCATTCCAAGAGG + Intergenic
1103160086 12:118721551-118721573 GGCAGTGGTCCCATTTCAAGAGG + Intergenic
1105210013 13:18252152-18252174 AGCCGTGGCCCCATTTGCAGGGG - Intergenic
1105219275 13:18310494-18310516 AGCTCTGCCTCCATTTATAGAGG - Intergenic
1105607501 13:21938585-21938607 AGCTGTGCTCCAATATCAAGAGG - Intergenic
1105737692 13:23288129-23288151 AGTTGGGTCCCTATTTCAAGTGG + Intronic
1107911263 13:45107775-45107797 AGCTGTGCCTGAATTTCAAAGGG + Intergenic
1109101408 13:58188440-58188462 AGTTGTTCCTTCATTTCAAGGGG + Intergenic
1112755883 13:102632948-102632970 TGCTGTCAGCCCATTTCAAGAGG + Intronic
1114631809 14:24164073-24164095 AACTGAGGCCCCCTTTCAAGGGG + Exonic
1116617132 14:47154290-47154312 AGCAGTGGCCCCATTTGGAGTGG + Intronic
1118441300 14:65814225-65814247 AGCTGTGCCCGAATTCCAAAGGG + Intergenic
1120379203 14:83751896-83751918 AGTCATGCCCCCATTTCCAGGGG - Intergenic
1121635311 14:95450039-95450061 AGCTGTGGCAGCATTTCCAGCGG - Exonic
1122031587 14:98916176-98916198 AGCAGTGCCCCAATCTCAGGGGG + Intergenic
1124188164 15:27548047-27548069 ATGTGTACCCTCATTTCAAGGGG - Intergenic
1128635483 15:69299568-69299590 AGCTGGGCACCCACTTCAACAGG - Intronic
1129109646 15:73329988-73330010 ATCTCTGCCCCCATTGCAAGAGG - Intronic
1130053121 15:80500279-80500301 TTCTGGGCCCCCATTTCAGGGGG + Intronic
1130539268 15:84810306-84810328 AGCTGAGCCTCTATTCCAAGAGG - Intergenic
1134563498 16:15231051-15231073 AGGTGTGACCCCGTTTCAATAGG - Intergenic
1134743546 16:16569821-16569843 AGGTGTGACCCCGTTTCAATAGG + Intergenic
1135041328 16:19119401-19119423 AGCTGTGCCCACCTTTAAAGAGG + Exonic
1136997963 16:35203678-35203700 AGCTGAGCCCCCATCCCAGGAGG + Intergenic
1138052463 16:53794507-53794529 AGTTATGGTCCCATTTCAAGTGG - Intronic
1138581135 16:57941007-57941029 ACCTGGGCCCCCTTTTCCAGCGG - Intronic
1139655541 16:68384960-68384982 AGCTGTGTCCCCGCTTCAGGAGG - Intronic
1141133605 16:81451561-81451583 AGCTGAGCCTCCTTTTGAAGAGG + Intronic
1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG + Intronic
1149441474 17:56678167-56678189 AGCTCTGCCCTTATTTCCAGAGG + Intergenic
1153513772 18:5885444-5885466 AGCTAAGAGCCCATTTCAAGTGG + Exonic
1155599459 18:27528289-27528311 AGCAGTGCTTCAATTTCAAGTGG - Intergenic
1165493753 19:36140421-36140443 ATCTGTGCCCCCAGTTCCAGCGG + Intronic
1168251981 19:55146705-55146727 TTCTGTGCCCCCATCTCCAGAGG - Exonic
925111371 2:1341258-1341280 AGCTGTGGCCCTTTTTCATGGGG - Intronic
926560008 2:14406425-14406447 AGCTTTGCCTACATTACAAGGGG + Intergenic
926735671 2:16071568-16071590 AGCATTTTCCCCATTTCAAGAGG - Intergenic
928015948 2:27657312-27657334 ATCTGTGCCCACTTTTCAACAGG + Intronic
930601597 2:53450161-53450183 AGCTGTTCCCCCATTGTCAGAGG - Intergenic
934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG + Intronic
935686559 2:105688987-105689009 AGCTGTGCCCCCAGCTCAGCAGG + Intergenic
937017446 2:118618897-118618919 TGCTGTGCCCCCATCTCACCTGG + Intergenic
937140074 2:119592543-119592565 ATCTGTGGCTCCATTTCAATAGG - Intronic
937587007 2:123565025-123565047 CCCTGGGCCCCCATTTCAAGAGG - Intergenic
942358711 2:175148595-175148617 AGCTGTGCCTGAATTTCAACGGG - Intronic
948171436 2:235906525-235906547 GGCTGTGCCCTCATGTAAAGAGG + Intronic
1169232476 20:3900331-3900353 AGCTATGCTCACATTACAAGAGG - Intronic
1170521560 20:17191048-17191070 AGATGGGCCCCCATCTCAGGGGG + Intergenic
1173509402 20:43614745-43614767 AGCTGTGCCCACATTTCTATGGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1183873028 22:40754853-40754875 AGCTGTGCCTGAATTCCAAGAGG - Intergenic
949159967 3:869697-869719 AGCCTTGTCCACATTTCAAGTGG - Intergenic
951336675 3:21431504-21431526 TGCGGTGCCCTCATCTCAAGTGG - Intronic
954533681 3:51342116-51342138 AGCTGAGCCCCCAACTCAAATGG + Intronic
957891257 3:86362256-86362278 AGCTGTGCGCTCAGTTAAAGAGG + Intergenic
960160289 3:114343270-114343292 TGCTGAGCCCCCAGTGCAAGAGG - Intronic
962315456 3:134356804-134356826 AGCTGTGGAGCCACTTCAAGAGG + Exonic
963910441 3:150812825-150812847 AGCTGTGCCCCCTTTTCAGTAGG - Intergenic
963938399 3:151077241-151077263 AGATGAGCCCTGATTTCAAGTGG - Intergenic
965055710 3:163712040-163712062 AGCTATGCCTCCATCTTAAGGGG + Intergenic
969183408 4:5458734-5458756 AGCTGTGCACCCAGTCAAAGAGG - Intronic
973610914 4:52635394-52635416 TGGAATGCCCCCATTTCAAGTGG + Intronic
974153418 4:58040138-58040160 AGGTGTGCCCTCTTTGCAAGTGG + Intergenic
975281118 4:72564141-72564163 AGATATGCCCCAATTCCAAGTGG + Intronic
977403046 4:96559356-96559378 AGATTTTCTCCCATTTCAAGGGG + Intergenic
982284618 4:153722264-153722286 AGCTGTGCTCCCACTTAAGGTGG - Intronic
984067168 4:175062603-175062625 ATCTGTGCCCACCATTCAAGTGG + Intergenic
984861604 4:184245172-184245194 AGCTGTCCCCTGATTGCAAGAGG + Intergenic
985600036 5:823505-823527 AGCTGTGGGCCCACTCCAAGGGG + Intronic
988518793 5:31927901-31927923 AGCTATACCCCCATTTCACAGGG + Intronic
992037604 5:72796121-72796143 AGCTCTGCCTCCATTTCACAGGG - Intergenic
995340967 5:111059031-111059053 AGCTGTGCTACAACTTCAAGCGG + Intergenic
1000139483 5:158388074-158388096 GGCTTTGTCCCCTTTTCAAGAGG + Intergenic
1001600904 5:172927533-172927555 AACTGTGCTCCCATTACAACTGG - Intronic
1007605431 6:43114507-43114529 GGCTGTGCCCCCATTCCAGGGGG - Intronic
1013184194 6:107743862-107743884 GGCTGTGTCTCCAATTCAAGAGG - Intronic
1013846480 6:114459071-114459093 AGCTGTGATACCATTTCAACAGG - Intergenic
1018595709 6:165478442-165478464 AGCTGTGCCTGAATTTCAAAGGG - Intronic
1019581730 7:1767403-1767425 ACCAGTGACCCCATTACAAGGGG - Intergenic
1027348130 7:77282767-77282789 AGCTGTGCTCCAAATTCAGGTGG + Exonic
1029507851 7:100973228-100973250 AGTGGAGCCCCCATTTCCAGGGG - Intronic
1030093624 7:105878233-105878255 AGCTGTGCCCTCCTGTCAGGAGG + Intronic
1030775161 7:113525397-113525419 ACCTGTTCCCCCATTTCTTGGGG + Intergenic
1034486025 7:151363486-151363508 AGCTGTGGCACAATTTCAGGCGG + Intronic
1034681656 7:152933465-152933487 AGCTGGGCCTCGATTTCAAAAGG - Intergenic
1037334855 8:17782032-17782054 GGCTGGGCTCCCATTTCAAATGG + Intronic
1037679225 8:21080209-21080231 AGGTGAGACCCCATCTCAAGGGG + Intergenic
1037908043 8:22726991-22727013 ATCAGTGTCCCCATTTTAAGAGG - Intronic
1038113013 8:24521096-24521118 AGTTTTTCCCCCATTACAAGAGG + Intronic
1040598550 8:48862913-48862935 AGCTGTGCCTCCCATGCAAGGGG + Intergenic
1041177584 8:55212495-55212517 AGCTGTGCCTAAATTCCAAGCGG + Intronic
1041649400 8:60287002-60287024 AGCTGTGGTTCCACTTCAAGGGG - Intergenic
1045105143 8:98885240-98885262 AGATGTGCACTGATTTCAAGAGG + Intronic
1045108972 8:98921403-98921425 AGCTGTGCGCTCAGTTGAAGTGG - Intronic
1050054064 9:1633250-1633272 AGCTGTAACCCCATTGTAAGTGG + Intergenic
1050115919 9:2263238-2263260 ACCTTAGCCCCTATTTCAAGAGG - Intergenic
1051264037 9:15294131-15294153 AGCTGTGCACAGATTTTAAGAGG + Intronic
1055212711 9:73816865-73816887 AGGTGTGCTCCCATGGCAAGTGG - Intergenic
1055991279 9:82109054-82109076 AGTTGTCCCCTCATTTCAAAGGG + Intergenic
1058759582 9:108118105-108118127 AAATGTGCCCCCATTGTAAGTGG - Intergenic
1060412621 9:123410177-123410199 GGCTGTGCCCTCATTCCTAGAGG - Intronic
1060939841 9:127536868-127536890 GGCTGTGCCCCCATCTACAGAGG + Intronic
1062023534 9:134330136-134330158 AGCTGTGCCCTCTTCTCCAGAGG - Intronic
1062067538 9:134536872-134536894 CACAGTGGCCCCATTTCAAGTGG + Intergenic
1186370833 X:8945550-8945572 AGCAGTGCACCCACATCAAGGGG + Intergenic
1186820528 X:13283554-13283576 AGCTGTGCCCAGATTCCAATGGG + Intergenic
1192283041 X:69704488-69704510 AGCTGTGCCTGAATTTCAAAAGG + Intronic
1194015000 X:88608508-88608530 AGCTGTGCCTGAATTTCAAAAGG + Intergenic
1195600187 X:106738107-106738129 TGCTGTCCCCCAATTTCAAATGG - Intronic