ID: 1091435349

View in Genome Browser
Species Human (GRCh38)
Location 12:468345-468367
Sequence AAAGACCCCCAAAAAGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091435349 Original CRISPR AAAGACCCCCAAAAAGGTCA GGG (reversed) Intronic
909308450 1:74113262-74113284 ACAGACCCACAAAAAGTTGAGGG + Intronic
912699398 1:111865408-111865430 AATGATTCCCAAAGAGGTCAGGG + Intronic
915866121 1:159500943-159500965 AAAGACCCCCAGACCGGTCAAGG - Intergenic
916743225 1:167664078-167664100 TAACACCCCCTACAAGGTCATGG - Intronic
917119791 1:171635385-171635407 AAAGATTCCCACAAAGTTCAAGG + Intergenic
917204136 1:172552036-172552058 AAAGACTCCAAAAAACCTCATGG + Intronic
917558677 1:176120453-176120475 AAAGACATCAAAAAACGTCAAGG + Intronic
918634032 1:186753634-186753656 AACGACCCCCAAAAAAGGCAGGG + Intergenic
919037930 1:192340395-192340417 AAAGAGACTCAGAAAGGTCAAGG + Intronic
919096105 1:193038656-193038678 AAAGACCACCAAAAAACTCTTGG + Intronic
919726530 1:200888204-200888226 AAAAACCCCCAAATGGGTCCAGG - Intergenic
919801565 1:201357562-201357584 AAATGCCCCCAAAATGGACAGGG - Intergenic
920223853 1:204424069-204424091 AAAGTCCCCCCAAAAGAGCATGG + Exonic
920498335 1:206470924-206470946 AAAGACCCCGGGAAAGGTGAGGG - Intronic
923012087 1:230095970-230095992 AAAGCCCTCCCAAAACGTCATGG - Intronic
924128147 1:240876966-240876988 AAAAACCCCCAAAAAATTCATGG + Intronic
1063870513 10:10411954-10411976 AAAGAACTCCAAAAAGTACAAGG - Intergenic
1065391951 10:25191852-25191874 AAAAACCCCAAAAAAAGTGAGGG - Intronic
1066385709 10:34939649-34939671 CAAGAGCCCCAGAGAGGTCAAGG + Intergenic
1068115929 10:52737510-52737532 GAAAACCCACAAAGAGGTCATGG + Intergenic
1068587591 10:58816617-58816639 AGAGATCCCCAAAGAGGTGAGGG - Intronic
1069399469 10:68027352-68027374 AAATACCCCCAAAAGGGAAAGGG - Intronic
1069935702 10:71914460-71914482 AAAGACTCTCAAAAAGTTGACGG - Intergenic
1070450550 10:76553153-76553175 AAAGACCCTGAAAAATGACAGGG - Intronic
1071398436 10:85245734-85245756 AAAACCCCCCAAAAAGGTTATGG - Intergenic
1073236011 10:102016871-102016893 AGAGCCCCCAAAAAAGGTCTAGG - Intronic
1076825630 10:132966208-132966230 AAACACTCACAAAAATGTCAAGG - Intergenic
1077891826 11:6423901-6423923 AAAGATTTCCAATAAGGTCAAGG + Intergenic
1079332690 11:19546619-19546641 AAACACCCCCAAAAAGCCTAGGG - Intronic
1080510445 11:32964500-32964522 AGAGACCACCAAAAGGGTCTTGG + Intronic
1083192114 11:61059687-61059709 AAACAGACCCAGAAAGGTCAAGG - Intergenic
1084541138 11:69787899-69787921 AAAGCTTCCCAGAAAGGTCAAGG - Intergenic
1088667512 11:112108211-112108233 AAAGACCCCCCAAACTGGCAAGG - Intronic
1089166509 11:116481570-116481592 TAAGACCCCCAAGAAGGTAACGG - Intergenic
1091053911 11:132400978-132401000 AAACACCCCTAAAAAGGGAAAGG + Intergenic
1091435349 12:468345-468367 AAAGACCCCCAAAAAGGTCAGGG - Intronic
1091504551 12:1053952-1053974 ACAGACCACCCAAAAGGTCAAGG - Intronic
1092128551 12:6092327-6092349 AAAAACCCGCAAAAAGGGAAGGG - Intronic
1095234448 12:39779402-39779424 AAAGTCCCCCAAAAAACCCAGGG - Intronic
1098025361 12:66195355-66195377 AAAGACACTCAAGGAGGTCAAGG - Intronic
1100394051 12:94169417-94169439 AAAGACCCCCAGAAATGGCCTGG + Intronic
1102019617 12:109672966-109672988 AGAGAGCCCCATGAAGGTCAGGG - Intergenic
1102516284 12:113448959-113448981 AAACTCCACCAAAAATGTCATGG + Intergenic
1102824793 12:115939992-115940014 ATAGACTGCCATAAAGGTCATGG + Intergenic
1103924790 12:124417518-124417540 CAATGCCCCCAAACAGGTCATGG + Intronic
1106109652 13:26765747-26765769 AATGACCCCCAAAAATATCTAGG + Intergenic
1106726401 13:32490651-32490673 AACCACCCCCAAAAAGGTTGGGG - Intronic
1107642573 13:42458791-42458813 GAAGACCCCCAAAAAAGCTATGG - Intergenic
1107647541 13:42510742-42510764 GAAGACCCCCAAAAAAGCTATGG + Intergenic
1109401140 13:61830102-61830124 AAAGAGTCCCAAAAAAGTCAAGG + Intergenic
1114640662 14:24217611-24217633 ACAGACCCCCAAAGAGATCCAGG - Intronic
1115148880 14:30260240-30260262 AAAGACCCCCAAAAAGTAAGGGG + Intergenic
1116148949 14:41112980-41113002 AAAGACCCCCCAAAAATACAAGG + Intergenic
1117551049 14:56836631-56836653 AAAGACACCCAAACAAGTCATGG + Intergenic
1118490206 14:66251506-66251528 AGAAACCCAGAAAAAGGTCAGGG - Intergenic
1120363947 14:83541704-83541726 AAAAAAACCCAAAAAGGCCAGGG + Intergenic
1121313404 14:92947122-92947144 AGAGACCCCCAAGGAGGTGAGGG + Intronic
1121519139 14:94573927-94573949 TAAAAACCCCAAAAAGGACAGGG - Intronic
1125921060 15:43526267-43526289 AAAATCCCCAGAAAAGGTCAAGG + Exonic
1127360731 15:58242910-58242932 AAAGACCAGCAAACAGGTCTGGG - Intronic
1127615154 15:60677340-60677362 AACAACCCCCAAAAAGCTAAGGG + Intronic
1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG + Intergenic
1129689947 15:77707550-77707572 AAAATCCCCTAAACAGGTCAGGG + Intronic
1133905806 16:10021374-10021396 AATGACGCCCAGAAAGGTGAAGG + Intronic
1135684757 16:24489905-24489927 AAAGACCACCAAGAAGGACCAGG - Intergenic
1137609910 16:49811287-49811309 AGAGACCCCCAAGAAAGTCAAGG + Intronic
1138558689 16:57787501-57787523 AAAGATCTCCAAGAAGCTCATGG + Intronic
1138717113 16:59036131-59036153 AAAAACCCCCAAAAATGCCCAGG + Intergenic
1140911549 16:79457777-79457799 AAGGCACCCCAAGAAGGTCATGG + Intergenic
1141137963 16:81478844-81478866 AAAGACCCAGAAGAAGGGCAGGG - Intronic
1145085020 17:19930418-19930440 AAAAAACCCAAAAAAGGTCAAGG + Intronic
1145111637 17:20168509-20168531 AAACATCCCCATAAAGGTCAGGG + Intronic
1147900910 17:43783668-43783690 AATGACCCTTAAAAAGGCCAGGG + Intronic
1148933059 17:51142766-51142788 AAAGACTCCCAATAGGGTCTAGG + Intergenic
1149135826 17:53362303-53362325 GAACCCCCCCAAAAAAGTCAAGG - Intergenic
1150658778 17:67057762-67057784 AAAAACCCCCAAAACAATCAAGG + Intergenic
1152522790 17:80869480-80869502 AAACACCCCCAAAAATGTGGGGG + Intronic
1152827767 17:82478513-82478535 CAGGTCCCCCAAAAAGGTGAAGG - Intronic
1155635302 18:27946121-27946143 AAATACATCCAAAAAGCTCATGG + Intergenic
1156370685 18:36469067-36469089 AAAGACCCCCAAGTATGGCAAGG - Intronic
1157635422 18:49148769-49148791 ACAGACCCCTAACAAGGTAATGG - Intronic
1157738903 18:50074805-50074827 AAAAACCCCCAAAAAAACCATGG - Intronic
1161409100 19:4106910-4106932 CGAGACCCCCAGAAAGGCCAAGG + Intronic
1164466017 19:28488368-28488390 AGAGCCCCCCAAACAGGGCATGG + Intergenic
1164729775 19:30494649-30494671 AAATACCCTCAAAAAGGCCCCGG - Intronic
1168504507 19:56921870-56921892 ATAAAACCCCAAAAAGGACAGGG + Intergenic
926833418 2:16990289-16990311 ACAGACACACAAAAAAGTCATGG - Intergenic
927685093 2:25165031-25165053 CGAGACCCCTAAAAAGGTTAAGG + Intronic
930511984 2:52357720-52357742 AAAGATGCCCAAAAATGTGAAGG + Intergenic
931355544 2:61535236-61535258 TTAGACCCCCAAAAAGGTTAAGG - Intronic
932218088 2:69979583-69979605 AAAGGCCCCCAAAATGGCCTGGG + Intergenic
932269721 2:70398860-70398882 TAAGAGCCCCCAAAAGCTCATGG - Intergenic
935440178 2:103084297-103084319 AAAGACCCCCAAAAAAATGTGGG + Intergenic
937583202 2:123514383-123514405 AATGACCCCCAAAGATGTCCAGG + Intergenic
939584053 2:143985297-143985319 CAAGTCCCACAAAAGGGTCAAGG + Intronic
940103929 2:150075969-150075991 ATAGATCCCCAGAATGGTCAAGG + Intergenic
942145025 2:173018392-173018414 AAAACCCCACAAAGAGGTCATGG - Intronic
942371932 2:175294668-175294690 GAACACCCCCAAAAAGGCCTCGG - Intergenic
944928573 2:204491963-204491985 GAAGACCCTCAAAGAGGTCCAGG + Intergenic
946933303 2:224693405-224693427 ATAGACCCCAAAGAAAGTCAAGG + Intergenic
1170733168 20:18991246-18991268 ACCTACCCCCAAAAAGTTCAAGG - Intergenic
1170989736 20:21291153-21291175 AATGACCAACCAAAAGGTCAGGG - Intergenic
1174644097 20:52070756-52070778 AAAAACCCCCAAAAAAGTGGTGG + Intronic
1174979954 20:55382355-55382377 AAAGACCAGCAGACAGGTCAAGG - Intergenic
1176050518 20:63116888-63116910 AAGGACCCTCAAAGAGGTCTCGG - Intergenic
1180758952 22:18184192-18184214 AAAGTCCCCCAAAACTGGCACGG + Intergenic
1180769239 22:18367983-18368005 AAAGTCCCCCAAAACTGGCACGG + Intergenic
1180777073 22:18494412-18494434 AAAGTCCCCCAAAACTGGCACGG - Intergenic
1181279045 22:21705499-21705521 AAAAACCCCAAAAAAGGGCTGGG - Intronic
1184444238 22:44537950-44537972 AAAGGCCTCCAAGAAGGACATGG - Intergenic
1184457933 22:44622010-44622032 ACTGAGCCCCAAAAAGGGCAGGG + Intergenic
1184898628 22:47428427-47428449 AAAAACCTCCAAAATGGTCGTGG + Intergenic
1203277256 22_KI270734v1_random:97117-97139 AAAGTCCCCCAAAACTGGCACGG + Intergenic
951154137 3:19328408-19328430 AAAGACCCCCAAATTCATCATGG - Intronic
951552494 3:23888113-23888135 CAAGACCCCAAAAAAAGGCAGGG + Intronic
952107900 3:30090534-30090556 AATGGCCCCCAAAAATGTGAGGG - Intergenic
952531583 3:34267904-34267926 AAAAGCCCCCTAAAAGGACAAGG + Intergenic
953954351 3:47219379-47219401 AATGACCTGCAAAAAAGTCAGGG + Intergenic
954776567 3:53024299-53024321 AAAAAACCCCAAAGAGGTAAGGG + Intronic
954797150 3:53167303-53167325 AGAGCCCCCCAAAAAGGCCTGGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956026141 3:64985119-64985141 AAAGACACATAGAAAGGTCAGGG + Intergenic
956405519 3:68924895-68924917 AAACATCCCCATGAAGGTCAAGG - Intronic
959102229 3:102023792-102023814 AAACACACACAAAAAGGTGAGGG - Intergenic
959278087 3:104303553-104303575 AAAGTCTCCCAATAAAGTCAAGG - Intergenic
959384112 3:105680282-105680304 GAAGACCTAGAAAAAGGTCAAGG + Intronic
960033050 3:113074082-113074104 TAAGACTCCCCAAAAGGTCCAGG - Intergenic
961015791 3:123467124-123467146 GTTGACCCCCAACAAGGTCAGGG + Intergenic
961238521 3:125389666-125389688 AAATACCCGCAATAAGCTCAAGG + Intergenic
961893164 3:130147054-130147076 AAGGACCCCCAAAGAGCCCATGG - Intergenic
963356156 3:144210944-144210966 AAAGACCCTGAAATAGGTCCAGG + Intergenic
963567745 3:146950752-146950774 AAAACCCCCCAAAAAAGACATGG + Intergenic
964276286 3:155012023-155012045 AAAAAACCCCACAAAGGACAGGG - Intergenic
965206001 3:165719852-165719874 AAGCACCTCCAAAAATGTCAGGG + Intergenic
965815693 3:172634429-172634451 CAAAACCCCCAAAAAGGTCATGG + Intronic
968951786 4:3699185-3699207 AAATAACCCCAAAATGTTCATGG + Intergenic
969237534 4:5876533-5876555 AATGAGCCTCAAAAAGATCAAGG + Intronic
973252474 4:48075043-48075065 AAAGATCCCCCCAAAGCTCAGGG - Intronic
975664258 4:76719191-76719213 AAACACCCCCAAGACTGTCATGG - Intronic
975964999 4:79962436-79962458 AAAGACGCCCTGAAAGGTAAAGG + Intronic
976579586 4:86720273-86720295 AAGGAACCTCAAAAATGTCAAGG + Intronic
977739177 4:100456355-100456377 ATAAACCCCCAAAAAGTTGAAGG - Intronic
977797630 4:101186230-101186252 AAATACCCCCAAATAGTTTAGGG + Intronic
978876482 4:113645900-113645922 AAAGATCACCAAAAGGGTCTGGG + Intronic
979358218 4:119730769-119730791 CATGACCCCAAAAAAGGTTATGG + Intergenic
983113933 4:163788636-163788658 AAAGAACCCCAGAGAGGTGAAGG + Intronic
984211621 4:176856545-176856567 CAAGGGCCCCAAAATGGTCAAGG - Intergenic
986707210 5:10462001-10462023 AAAGAAACCCTAAAAGGACAGGG - Intronic
986854316 5:11851343-11851365 AAATGCCCCCAAAAAGATCTTGG + Intronic
990778031 5:59325271-59325293 AAAGATCCAAGAAAAGGTCAAGG + Intronic
993808926 5:92450569-92450591 GAAGACCCCTGTAAAGGTCATGG + Intergenic
993890027 5:93462520-93462542 AAAGATACCCAAAAATGTGAAGG + Intergenic
995725769 5:115179438-115179460 AAAGAGGCCCGAAAAGGCCAGGG + Intronic
995740802 5:115354129-115354151 CAAGGCCCACAAAAGGGTCAAGG - Intergenic
998249364 5:140540976-140540998 AACTGCCCCCACAAAGGTCAAGG - Intronic
998640061 5:143999685-143999707 AAGGAACTTCAAAAAGGTCATGG + Intergenic
1000356459 5:160400670-160400692 AAAGACCCCCAAACAGGAAAGGG - Intergenic
1000383282 5:160648052-160648074 AAAGACCCCCATATAAGTCCTGG + Intronic
1000563753 5:162822895-162822917 CAAGACTCCAAAAAAGGTAATGG - Intergenic
1002347529 5:178558135-178558157 AGAGGCCCCCAAGAAGGTCTTGG - Intronic
1002803250 6:547050-547072 AAAGATACCCAGAGAGGTCAAGG - Intronic
1002872453 6:1179166-1179188 TAAAACCCCCAAAAAGGGCTGGG + Intergenic
1003863863 6:10346121-10346143 AAACACCCCCATACAGTTCAAGG - Intergenic
1004596448 6:17103875-17103897 AAATACCCCATAAAAGGTAATGG - Intronic
1007230878 6:40347080-40347102 AAAGCTCACCAAAATGGTCAAGG - Intergenic
1007450653 6:41938895-41938917 AAAGACTTCCTAGAAGGTCAAGG - Intronic
1008662184 6:53679681-53679703 AAAGCCCACCAAAAAGGACAAGG + Intergenic
1008858620 6:56122111-56122133 AATGACCCACAAAAATGTCATGG + Intronic
1010138921 6:72589782-72589804 AGACACCCCCAAAAAGCTGAGGG + Intergenic
1011409570 6:87053954-87053976 AAAGACCTTCAAAGAGATCAAGG - Intergenic
1013614115 6:111825685-111825707 GAACTCCCCCAAACAGGTCAGGG - Intronic
1015885298 6:137911591-137911613 ACAGCCCCCCATGAAGGTCATGG - Intergenic
1018391561 6:163345276-163345298 ACACACCCCCAAAAATGTCTTGG - Intergenic
1020115086 7:5471757-5471779 GAAGAGCCCTGAAAAGGTCAGGG - Intronic
1020770954 7:12393898-12393920 AAAGACCCTCTGAAATGTCAGGG + Intronic
1025104181 7:56157311-56157333 CAAGCCCCCCATCAAGGTCAAGG - Intergenic
1028052935 7:86207740-86207762 AAAAGCCCCCCAAAATGTCACGG + Intergenic
1032922208 7:136561839-136561861 AAAACCCCTCAAAAAAGTCAAGG - Intergenic
1033612453 7:142977492-142977514 AAATAACCCCAAATAGATCATGG + Intergenic
1034459973 7:151192745-151192767 GAAGACCCCCAAAGAAGACAAGG - Exonic
1037103381 8:15075368-15075390 AATGACCCCATAAAATGTCAGGG - Intronic
1037565519 8:20115034-20115056 AAACACCCCAAAAAAGTTGAGGG + Intergenic
1038832751 8:31080409-31080431 AAAGAACCCTAAAAGTGTCAAGG - Intronic
1040293131 8:46135650-46135672 GAAGACCCCCAAAAGAGACAAGG - Intergenic
1043111927 8:76196348-76196370 AAAGACCTCCAAAAGTGACAGGG - Intergenic
1044371362 8:91415283-91415305 AAAGACCCCTAAGCAAGTCAGGG + Intergenic
1044561459 8:93616719-93616741 AAACACCCCCAAAAAAGTGAAGG + Intergenic
1045431175 8:102116453-102116475 AAAGAAACCCAAAAAAGTCTTGG - Intronic
1045780681 8:105859548-105859570 AATGACCTCCAAAATGGTAAGGG + Intergenic
1047407808 8:124599705-124599727 AATGACCTCCAAAACGGTCTTGG + Intronic
1047622802 8:126624878-126624900 AAATAGCCCCACAAAAGTCATGG - Intergenic
1047911735 8:129537259-129537281 AAAAACCCCCAAAAATGTTGAGG - Intergenic
1048749648 8:137657834-137657856 AAGGAGCTCCAAAAAGGGCATGG - Intergenic
1049144938 8:140992831-140992853 AAAGACTCTGAACAAGGTCAAGG + Intronic
1049607452 8:143536323-143536345 GAAGACCCCCAACAAGGGCCTGG - Exonic
1049780193 8:144425382-144425404 AAAGCCCCCCCAAAAGATCCTGG + Intronic
1050513495 9:6418202-6418224 AAAAAACCCCAAAAAACTCAAGG - Intronic
1052845742 9:33334788-33334810 AATGACCACCAAAAGGGTCATGG - Intronic
1055323102 9:75101060-75101082 AGTGACTCCCAAAAAGGCCAGGG - Intronic
1056089529 9:83191280-83191302 AAAGACTCCAGAAAAGATCATGG + Intergenic
1056206131 9:84321043-84321065 AAAGACTACTAAAAAGTTCAAGG + Intronic
1057507637 9:95648779-95648801 AAAGACACCCAAACATGTAATGG + Intergenic
1058441224 9:105009581-105009603 AAAAGCCCCAAAAAATGTCAAGG - Intergenic
1061889023 9:133608022-133608044 ACCAACCCCCAAAAAGTTCAGGG - Intergenic
1062295524 9:135823305-135823327 AAAGACCCCCAACATGGACCAGG + Intronic
1186740121 X:12508345-12508367 TAAAACCCCCAAAAGGGTAAAGG + Intronic
1187567913 X:20470776-20470798 AAAGATGCCCAGAATGGTCATGG + Intergenic
1189229146 X:39438573-39438595 AAACACCCCCAAAAAGCCAAAGG + Intergenic
1190455963 X:50628100-50628122 AAAGCCCCCCTCAAGGGTCAGGG - Intronic
1192269754 X:69567640-69567662 AAAAAACCCCACAAAAGTCATGG + Intergenic
1193300667 X:79885317-79885339 AAAGTCACCCAACTAGGTCAGGG + Intergenic
1196251855 X:113470200-113470222 AAAGATCCCCTAAATGCTCAGGG - Intergenic
1197781473 X:130164971-130164993 AAAGACCACCAAGAAGTACACGG + Intronic
1198759561 X:140017436-140017458 AAAGACCAACAAAAATGGCAAGG + Intergenic
1198779227 X:140216614-140216636 AAAGACCAACAAAAATGGCAAGG - Intergenic