ID: 1091436107

View in Genome Browser
Species Human (GRCh38)
Location 12:474332-474354
Sequence GTGTTGTGAGGGAGGGGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 509}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091436107_1091436117 21 Left 1091436107 12:474332-474354 CCCCGTCCCCTCCCTCACAACAC 0: 1
1: 0
2: 2
3: 34
4: 509
Right 1091436117 12:474376-474398 ACACTTATCAACCTTAGCATTGG 0: 1
1: 0
2: 1
3: 11
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091436107 Original CRISPR GTGTTGTGAGGGAGGGGACG GGG (reversed) Intronic
900597404 1:3488368-3488390 ATGGTGTGAGGGTGTGGACGGGG - Intergenic
900817511 1:4859919-4859941 CTGTTGTGGGGTGGGGGACGGGG - Intergenic
901092001 1:6648124-6648146 GTCTTATGAGGGAGGGGACTGGG - Intronic
901150049 1:7095325-7095347 GTGTTGTGAAGGAAGGGACCTGG + Intronic
901417935 1:9129661-9129683 GTGGTGTGAGGGCGTGGGCGGGG - Intergenic
901748023 1:11387531-11387553 GTGTCGTGAAGCAGGAGACGGGG - Intergenic
901879672 1:12186318-12186340 GTGCTGTGAGGAAGGGGAGGAGG + Intronic
902651646 1:17841389-17841411 TTGATGTGGGGGAGGGGAGGAGG - Intergenic
903060618 1:20666178-20666200 GTGTGGAGAGGGTGGGGACAGGG + Intronic
903478968 1:23639383-23639405 GGTTTGTGAGTGAGGGGATGAGG + Intronic
904390105 1:30179222-30179244 GTGAGATGAGGGAGGGGACAGGG - Intergenic
904428840 1:30448832-30448854 GGTTTGGGAGGGAGGGGAAGGGG + Intergenic
905461531 1:38125914-38125936 GTGGAGTGTGGGAGGGGACGGGG + Intergenic
906150473 1:43584533-43584555 GTGGGGGAAGGGAGGGGACGAGG - Intronic
906187247 1:43871408-43871430 GGAGTGTGAGGGAGAGGACGGGG + Intronic
906187266 1:43871484-43871506 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187272 1:43871503-43871525 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187278 1:43871522-43871544 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187296 1:43871577-43871599 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187320 1:43871672-43871694 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906759579 1:48363948-48363970 CTGTTGTGAGGTGGGGGAAGGGG - Intronic
907216086 1:52865234-52865256 GTGTTGTGGGGGAGGGAGCCAGG - Intronic
907578424 1:55550173-55550195 GTGTTCTGAGGGAGAGGGAGGGG + Intergenic
909217224 1:72904924-72904946 CTGTTGTGAGGTGGGGGAGGGGG + Intergenic
909567052 1:77064381-77064403 GTGTTGAGAGGCTGGGGAAGAGG - Exonic
909945928 1:81663042-81663064 GGGGTGGGAGGGAGGGGTCGGGG - Intronic
910067738 1:83173415-83173437 CTGTTGTGCGGTAGGGGAAGGGG + Intergenic
910231190 1:84988820-84988842 GTGTAGTGAGGAAGGGGAAGAGG - Intronic
910676358 1:89820836-89820858 GTGTGGCGAGGGAGGGGACCCGG - Intronic
911168313 1:94744820-94744842 GTGAAGTGTGGGAGGGGAGGTGG + Intergenic
911239609 1:95450722-95450744 GTGTAGTGAGTGAGGGTAAGAGG + Intergenic
911670829 1:100605616-100605638 GGGTAGTGAGGGAGGGGCTGGGG + Intergenic
911884928 1:103286422-103286444 CTGTTGTGGGGTAGGGGAAGGGG - Intergenic
912550577 1:110482971-110482993 CTGTGGTGAGGCAGGGGCCGAGG - Intergenic
914222145 1:145690765-145690787 GTGTTTGGAGAGAGGGGAAGAGG + Intronic
915393220 1:155562711-155562733 GGGTAGTGAGGGACTGGACGAGG - Intronic
915441164 1:155946328-155946350 GGGCTGTGGGGGAGGGGAGGAGG - Intergenic
915467089 1:156104157-156104179 GTGTTGGGCGGCAGGGGTCGGGG + Intronic
915551526 1:156638204-156638226 GTGTGGAGTGGGAGGGGATGTGG - Intergenic
915560395 1:156683725-156683747 GGGTTTGGAGGGAGGGGACAGGG + Intergenic
915862402 1:159458807-159458829 TTGTTGTGGGGGAGGGGGAGGGG + Intergenic
915950450 1:160186734-160186756 GTGTTGTGAGAGCTGGGATGGGG + Exonic
916229083 1:162521458-162521480 GTGGGGTCAGGGAGGGGACAGGG + Intronic
917581956 1:176388026-176388048 CTGTTGTGGGGTAGGGGAGGGGG - Intergenic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
919928860 1:202208454-202208476 GTGATGTGAGGGAGGTGCCAGGG + Intronic
920071904 1:203308108-203308130 GTTTTCTGAGGGGGGGGAGGAGG + Exonic
920533624 1:206723139-206723161 GTGTAGTGAGGGAGTGTACAGGG + Intronic
921930115 1:220748191-220748213 GTGTTGTAGGGGCGGGGAAGAGG + Intergenic
922193329 1:223338989-223339011 GTGTGGTGAGAGATGGGAAGAGG + Intronic
922268244 1:224008494-224008516 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
923092650 1:230751850-230751872 GTGGGGTGGGGGAGGGGAGGGGG + Intronic
924042597 1:239998030-239998052 GGGCTGTGAGGGCGGCGACGAGG - Intergenic
1062866770 10:862457-862479 GTGGGGTGGGGGAGGGGACAGGG + Intronic
1063076481 10:2721940-2721962 GTGTTGTGGGGTAGGGGGTGAGG - Intergenic
1063371194 10:5524089-5524111 GGCCTGTGAGGGAGGGGACAAGG - Exonic
1064231085 10:13529351-13529373 GGGATGTGAGGGCGGGGAGGTGG - Intergenic
1064906151 10:20348025-20348047 GTGTGGTGGGGGAGGGGGCAGGG - Intergenic
1065813445 10:29463633-29463655 GTGCTGTGAGGGCAGGGACAGGG + Exonic
1066107998 10:32172329-32172351 ATGTTGTGGGGGGTGGGACGCGG - Intergenic
1066181219 10:32962600-32962622 GTGTTGTGCGGGAGGGCGGGAGG - Intronic
1067979960 10:51074070-51074092 GAGGTGGGAGGGAGGGGACAGGG - Intronic
1068427578 10:56887500-56887522 GTGTTGTGGGGTGGGGGAAGGGG + Intergenic
1068877036 10:62008043-62008065 GTGTTGTGGGGCGGGGGAGGTGG - Intronic
1069224751 10:65929022-65929044 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1070525968 10:77296261-77296283 GTGATGTGAGGAAGGGGCCATGG + Intronic
1070761081 10:79024809-79024831 GAGTGGTGGGGGAGGGGACCTGG + Intergenic
1071452096 10:85805791-85805813 GTGTTGTGAGGGAGGTATCAAGG - Intronic
1071977912 10:90973692-90973714 GTGCTGTGAGGTAGGGGCAGTGG + Intergenic
1072633221 10:97161202-97161224 GTGCTGGGAAGGAGGGGAGGAGG - Intronic
1072809968 10:98453850-98453872 AGGTTGTGGGGGAGGGGAGGAGG + Intergenic
1073401094 10:103258329-103258351 GTGCAGTAAGGGAGGGGAGGGGG - Intergenic
1074502990 10:114043521-114043543 GGGGGCTGAGGGAGGGGACGGGG + Intergenic
1074627724 10:115211758-115211780 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1075516705 10:123114634-123114656 GTGTGTTGCGGGAGGGGACAGGG - Intergenic
1076331826 10:129675864-129675886 GTGTTGTGAGGAGGGGGTGGTGG - Intronic
1076443905 10:130499078-130499100 TTGTTGTGAGGCAGATGACGTGG + Intergenic
1076847231 10:133075318-133075340 GTGCTGTGTGGGAGGTGAAGGGG - Intronic
1077052952 11:575959-575981 GGGCTGCGAGGGAGGGGGCGGGG + Intergenic
1077497815 11:2894995-2895017 GTATGATGAAGGAGGGGACGGGG + Intronic
1077498153 11:2896662-2896684 GTGGTATGAGAAAGGGGACGTGG + Intronic
1078737132 11:14030465-14030487 GGATTGTGGGGGAGGTGACGTGG - Intronic
1079248958 11:18773322-18773344 GGGGTGTGAGGAAGGGGAGGGGG + Intronic
1080558665 11:33441067-33441089 CTGTTGTGAGGTAGGGGGAGGGG - Intergenic
1081499640 11:43653547-43653569 CTGTTGTGAGGTGGGGGAGGGGG - Intronic
1081582962 11:44365096-44365118 GTGGTGTCAGGGTGGGGACAGGG + Intergenic
1081834473 11:46142882-46142904 CTGTGGTGGGGGTGGGGACGGGG - Intergenic
1083136416 11:60681205-60681227 GGGTTGTGAGGGATGGGAATAGG - Intergenic
1083434771 11:62634747-62634769 GTGTTGTGAGGTCTGGCACGGGG - Intronic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1084438627 11:69158063-69158085 GTGGTGGGAGGGAGGGGAGCAGG + Intergenic
1084757124 11:71246674-71246696 GGGATGTTAGGGAGGGGAGGTGG - Intronic
1084991397 11:72928869-72928891 CTGTTGTGGGGTGGGGGACGGGG - Intronic
1085744112 11:79100260-79100282 GTGATGTGTAGGAGGGGGCGGGG - Intronic
1086673953 11:89581602-89581624 GTGTTGATAGGGAAGGGACAAGG + Intergenic
1088188086 11:107195944-107195966 CTGTTGTGGGGTAGGGGAAGTGG + Intergenic
1089209039 11:116788433-116788455 GGATTGTGAGAGAGGGGAAGAGG - Intergenic
1090541968 11:127716278-127716300 GTGATGTGAGGGAGTGAACCAGG - Intergenic
1091208852 11:133839525-133839547 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
1091318106 11:134630064-134630086 CTGTTGTGGGGTGGGGGACGGGG + Intergenic
1091362589 11:134989445-134989467 GTGTGGGGAGGGCGGGGGCGTGG - Intergenic
1091371648 11:135065311-135065333 CTGTTGTGAGGTGGGGGAAGCGG - Intergenic
1091436107 12:474332-474354 GTGTTGTGAGGGAGGGGACGGGG - Intronic
1091679344 12:2515643-2515665 GTGGTGTGAGGCTGGGGAGGTGG + Intronic
1092424695 12:8365361-8365383 GTGTGGTGGGGGAGGGGATGTGG - Intergenic
1092468788 12:8760091-8760113 CTGTTGTGGGGTAGGGGAAGGGG - Intronic
1093088255 12:14890993-14891015 GTTTTCTGGGGGTGGGGACGGGG - Intronic
1093125500 12:15322979-15323001 GTCTTGAGAGGTAGGGGGCGGGG + Intronic
1093827384 12:23710387-23710409 CTGTTGTGGGGTAGGGGAAGCGG - Intronic
1094162921 12:27410589-27410611 CTGTTGTGGGGTAGGGGAAGAGG + Intronic
1094382128 12:29854451-29854473 CTGTTGTGGGGTAGGGGAAGGGG + Intergenic
1095855374 12:46854544-46854566 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1096178941 12:49540133-49540155 GGGATGTGAGGGAGAGGAGGAGG - Intronic
1096742279 12:53702541-53702563 CTGTTGTGAGGCAGGGTACCTGG - Intergenic
1096788113 12:54029407-54029429 GTGTGGTGGGGGGGGGGGCGGGG - Intronic
1096826097 12:54279486-54279508 GGGTTGTGAGGAAGGGGAGTCGG - Intronic
1101100955 12:101392036-101392058 CTGTTGTGAGGTGGGGGAAGGGG + Intergenic
1101563391 12:105881682-105881704 GTGTGCTGAGGGTGGGGACAGGG - Intergenic
1102151029 12:110689196-110689218 GGGCTGTGGGGGCGGGGACGGGG - Intronic
1102379917 12:112456244-112456266 GTGTTCTGAGGGAAGGGAGTTGG + Intronic
1103858504 12:123992223-123992245 GTGGTCTGAGGGTGGAGACGAGG + Intronic
1104506147 12:129334424-129334446 GTGTTGTCATGCAGGGGATGTGG - Intronic
1104953870 12:132454444-132454466 GTGTTGGGGGTGAGGGGGCGGGG + Intergenic
1105009243 12:132744470-132744492 GTGTTGCCAGGGAGTGGAGGCGG - Intronic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105386785 13:19937785-19937807 CTGTTGTGAGGTGGGGGGCGGGG - Intergenic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1106080593 13:26497382-26497404 TTGTTGTGAGGCAGGGCAGGAGG - Intergenic
1106480920 13:30136174-30136196 GTGAGTTGAGGGTGGGGACGGGG - Intergenic
1107030864 13:35852442-35852464 ATGTTGTGAGGCAGGGCACTGGG - Intronic
1107552578 13:41491077-41491099 GTGGAGTGGGGGAGGGGGCGCGG + Intergenic
1109679694 13:65733969-65733991 CTGTTGTGGGGTAGGGGACAAGG + Intergenic
1111091269 13:83451469-83451491 CTGTTGTGGGGGAAGGGAGGAGG - Intergenic
1111580800 13:90220653-90220675 CTGTTGTGGGGGTGGGGAGGGGG + Intergenic
1112432411 13:99361729-99361751 GTTATGTGAAGGAGGGGAGGGGG - Intronic
1112881905 13:104117999-104118021 CTGTTGTGGGGTGGGGGACGGGG + Intergenic
1112981851 13:105394360-105394382 GTGTGGTGAGGGGGGGGTTGGGG + Intergenic
1113150481 13:107257777-107257799 GTGGTGGGAGGTAGGGGATGGGG + Intronic
1113180356 13:107618340-107618362 GTGTTGTGAGCAAAGGGAGGAGG + Intronic
1113898086 13:113778227-113778249 GAGATGTGAGGGAGGGAAAGGGG + Intronic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1114473181 14:22977745-22977767 GGGTAATGAGGGAGGGGAGGGGG + Intronic
1114553896 14:23550814-23550836 GCGTGGAGTGGGAGGGGACGTGG - Intronic
1115334399 14:32230713-32230735 GTGTTGTCAGGATGGGGATGGGG - Intergenic
1115784138 14:36805281-36805303 GTGTTGTGAGAGAGAGGCTGGGG + Intronic
1116242260 14:42359820-42359842 CTGTTGTGGGGTAGGGGAAGGGG + Intergenic
1116384600 14:44314900-44314922 CTGTTGTGGGGTGGGGGACGGGG + Intergenic
1116513018 14:45770068-45770090 CTGTTGTGGGGTGGGGGACGGGG - Intergenic
1117006588 14:51426835-51426857 CTGTTGTGAGGAATGGGATGGGG + Intergenic
1117305796 14:54471934-54471956 GTGTACTGAGGGTGGGGAGGAGG + Intergenic
1119273161 14:73327896-73327918 GTGTGGTGGGGGAGGGCAGGCGG - Intronic
1119960701 14:78853214-78853236 CTGTTGTGGGGTAGGGGAAGAGG - Intronic
1120408116 14:84115177-84115199 GTGTTTTGAGGTGGGGGAAGCGG - Intergenic
1121159774 14:91726702-91726724 GTAATGTGAGGGAGGGGAAGGGG + Intronic
1122087240 14:99316507-99316529 GAGTGGTGAGGGTGTGGACGAGG - Intergenic
1122308550 14:100780497-100780519 GTGTCGTGGGGGAGTGGATGCGG + Intergenic
1122369761 14:101222990-101223012 GTGTTGTCAGGGAGGAGAGTTGG - Intergenic
1122412623 14:101533731-101533753 GTGTGGTGAGGGAGGGAGAGTGG + Intergenic
1122882785 14:104697521-104697543 GTGTGGTGTGGGTGGGGACAGGG - Intronic
1123152841 14:106199407-106199429 CTGTTGTGAGAGAGGTGAGGGGG + Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124437583 15:29663707-29663729 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1124647388 15:31448058-31448080 GTGCTGTGAAGGTAGGGACGTGG - Intergenic
1126164671 15:45644706-45644728 GTATTGTGAGGCAGGGGAAAGGG + Intronic
1126464475 15:48948981-48949003 GTGTTGAGAGGGAACGGATGAGG - Intronic
1126604803 15:50465341-50465363 GGGTGGTGGGGGAGGGGAGGGGG + Intronic
1127058807 15:55161081-55161103 GTGAGGTGAGGGAGGGGATGGGG + Intergenic
1127313821 15:57776460-57776482 GTGCTGGGAGGGTGGGGAGGAGG + Intronic
1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG + Intronic
1128659138 15:69485054-69485076 GTGGTGTGAGGGAGTGGACTGGG - Intergenic
1129031371 15:72620386-72620408 GTCTTGTTGGGGAGGGGACATGG - Intergenic
1129619721 15:77133058-77133080 ATGTTGTGAGGCAGGTGATGCGG - Exonic
1130850540 15:87789404-87789426 CTGTTGTGAGTGGGGGGAGGGGG + Intergenic
1131371674 15:91887049-91887071 GTGTTTTGTGGGAGGGCACAGGG + Intronic
1131599161 15:93829291-93829313 GTGTTCTGAGCTAGGGGATGTGG - Intergenic
1131827017 15:96330430-96330452 GGGTTGGGGGGGCGGGGACGGGG - Intronic
1132542791 16:519126-519148 GTGCTGTGTGTGAGGGAACGGGG + Intronic
1132692867 16:1189334-1189356 GAGATGTGAGGAAGGGGAGGTGG + Intronic
1133092299 16:3413912-3413934 GTGCTGGGAGGGAGGGAACGCGG + Intronic
1133703543 16:8331965-8331987 GTGCAGTGAGGGAGGTGAAGGGG - Intergenic
1133708191 16:8375699-8375721 GTTTTGTGAGGGAGGGGTGCAGG - Intergenic
1135001200 16:18778362-18778384 CTGTTGTGGGTGGGGGGACGGGG + Intergenic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1137253455 16:46757042-46757064 GTGTGGTGCGGGCGGGGAGGTGG - Intronic
1138229508 16:55326941-55326963 GTGTTGTGGGGCAGGGGGCGGGG + Intronic
1139138593 16:64234067-64234089 GTGTGGTGAGTTGGGGGACGGGG - Intergenic
1139239446 16:65375901-65375923 GTGTCTTTAGGGAGGGGAAGAGG - Intergenic
1139422810 16:66859372-66859394 GTGTTGGGAGTCAGGGGAGGTGG + Intronic
1139497146 16:67327918-67327940 GTTTTGGGAGGGTGGGGAGGAGG + Intronic
1139796040 16:69483699-69483721 CTGTTGTGAGGGTGGGGATTAGG - Intergenic
1140225102 16:73070803-73070825 GAGTGGTGGGGGAGGGGACCGGG - Intergenic
1140954708 16:79851716-79851738 TTGTTGGGAGGTAGGGGATGAGG - Intergenic
1141276540 16:82593457-82593479 GTGATGTGAGGGATGGGATGGGG + Intergenic
1141787666 16:86212738-86212760 GTGGTGTGAGGAAGGGGCCATGG - Intergenic
1141787729 16:86213026-86213048 GTGGTGTGAGGAAGGGGCCACGG - Intergenic
1141951529 16:87343030-87343052 GTGTGGTGAGGGAGGGGTCGTGG - Intronic
1142143482 16:88482971-88482993 GTGTGCTGAGGGAGGGCACTCGG + Intronic
1142434482 16:90047780-90047802 GGGTGGTGGGGGCGGGGACGGGG + Intergenic
1142717721 17:1756030-1756052 GTGAAGTGGGGGAGGGGGCGGGG + Intergenic
1143125967 17:4641098-4641120 GTGGTGAGAGGGAAGGGATGGGG - Intronic
1143402515 17:6655725-6655747 GTGGTGAGAGGGAAGGGATGGGG + Intergenic
1143783184 17:9240075-9240097 GTGGGGGGAGGGAGGGGGCGGGG + Exonic
1144035932 17:11366083-11366105 GTGGTGTGAGGGAGGGAAGCTGG + Intronic
1144343972 17:14333589-14333611 GTGCTGTGGGTGAGGGGGCGGGG + Intronic
1144886663 17:18467607-18467629 GTGCCGTGAGGGAGGGGTTGTGG - Intergenic
1145145548 17:20476700-20476722 GTGCCGTGAGGGAGGGGTTGTGG + Intergenic
1146263618 17:31437237-31437259 GTGTTGGCAGGGAGAGGAAGGGG + Intronic
1146630151 17:34463808-34463830 GTGCTGTGACGGAGGTGGCGGGG - Intergenic
1146845751 17:36181166-36181188 GTAATGTGAGGGATGGGAAGTGG + Intronic
1146936189 17:36814030-36814052 GTGTGGTGAGGGGGTGGACAGGG - Intergenic
1148480250 17:47955433-47955455 GTGCTCTGAGGGAGGGGGTGGGG - Intronic
1148625549 17:49066466-49066488 ATGTTGAGAAGGAGGGGACAAGG + Intergenic
1148671597 17:49414709-49414731 GACTTGTGAGGGAGGGGAGAAGG - Intronic
1149781252 17:59398181-59398203 GTGTGGTGAGGGAGGGGACTGGG + Exonic
1150246691 17:63681320-63681342 GTATTTTGAGGGTGGGGACCAGG - Intronic
1150343735 17:64388295-64388317 GTGTGGTCTGGGAGGGTACGAGG + Intronic
1151267105 17:72965092-72965114 CTGTTGTGAGGTGGGGGAAGGGG + Intronic
1151696646 17:75721446-75721468 GGGTTGGGGGGGTGGGGACGAGG - Exonic
1151705037 17:75762977-75762999 GTGCAGGGCGGGAGGGGACGAGG + Intronic
1151938661 17:77279886-77279908 GTGCTGTAAGGGAGGGGAGCAGG - Intergenic
1151954841 17:77375037-77375059 GTGTTGTGGGGGAGGGGGGCGGG - Intronic
1152077682 17:78169099-78169121 GTGGGGTAAGGGAGGGGGCGGGG + Intronic
1152701031 17:81819888-81819910 GTGAGGAGGGGGAGGGGACGCGG - Intergenic
1152885735 17:82848165-82848187 GTGTTGGAAGGGAGGAGCCGGGG - Intronic
1152910481 17:83002638-83002660 GCCGTCTGAGGGAGGGGACGTGG - Intronic
1203170356 17_GL000205v2_random:143027-143049 GTGTTGTGAGAGAGGGGCTCAGG - Intergenic
1153434955 18:5059184-5059206 GTGTGGTGAGGCAGGGAAGGAGG - Intergenic
1155057122 18:22194704-22194726 GTGTTGGGAGGGGGGGGCGGAGG - Intronic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1156122583 18:33863265-33863287 CTGTTGTGGGGTAGGGGAAGGGG + Intronic
1156370410 18:36467537-36467559 GTGCTGTGAGGGAGCGAAGGGGG + Intronic
1157012555 18:43668834-43668856 CTGTGGTGAGGCAGGGGAAGAGG - Intergenic
1157046191 18:44104293-44104315 TTGTTGTGTGGGAGGAGATGTGG - Intergenic
1157349239 18:46870100-46870122 GTGTGGTTAGGGAGGGCACGGGG - Intronic
1157540907 18:48505814-48505836 GTGGTGGGAGGGTGGGGAAGGGG - Intergenic
1158109141 18:53920568-53920590 GTGTGGTGTGGGGGGGGACTGGG + Intergenic
1158546674 18:58403515-58403537 GAGCTGTGAGGGAGGGGGCCTGG - Intergenic
1159365052 18:67455072-67455094 GTTTTGTCAGGGAGGGGGAGAGG + Intergenic
1159558139 18:69966437-69966459 CTGTTGTGGGGGGGGGGAGGGGG + Intergenic
1160051841 18:75440966-75440988 GTGTGGTGAGGGAGGGATGGAGG + Intergenic
1160310673 18:77787067-77787089 GAGTTGTGAGGCAAGGGAGGAGG - Intergenic
1160749234 19:726215-726237 GTGTGGTCAGGGTGGGGAAGTGG + Intronic
1161022379 19:2016106-2016128 CTGTTGCAGGGGAGGGGACGGGG + Intronic
1161806067 19:6443732-6443754 GGGTAGTGGTGGAGGGGACGGGG + Intronic
1162968225 19:14165715-14165737 GTGTGGTGAGGGGGCGGACCTGG + Intronic
1164364635 19:27563068-27563090 GTGGGGTGGGGGAGGGGAGGGGG + Intergenic
1165089498 19:33375831-33375853 GTGGTGTGAGGGAGGAGAGAGGG + Intronic
1166367845 19:42286272-42286294 GAGTTGGAGGGGAGGGGACGTGG + Intronic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1168099537 19:54133917-54133939 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168099605 19:54134102-54134124 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
925425890 2:3748378-3748400 GTGTGGTGGGGGAGGTGATGCGG + Intronic
925989101 2:9239449-9239471 GTGTGGTGATGGAGGGGTGGTGG + Intronic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
927650114 2:24907463-24907485 GTGTTGTGGAGGAGAGGAAGGGG + Intronic
927985805 2:27409585-27409607 GAGCTGTGAGGGAGCGGAAGCGG + Exonic
928449685 2:31367187-31367209 TTGTTGTGGGGGTGGGGATGAGG - Intronic
929074030 2:38062764-38062786 CTGTTGTGGGGGGGGGGAAGGGG - Intronic
929479526 2:42291198-42291220 ATGCTGTGAGGGAGGGGTCAAGG - Intronic
929561915 2:42961446-42961468 GGGGAGAGAGGGAGGGGACGGGG - Intergenic
929817587 2:45247310-45247332 GTGCTGGGGGGGAGGGGAGGGGG - Intergenic
929896917 2:45968757-45968779 TTTTTGTGTGGGAGGAGACGTGG + Intronic
931014775 2:57964091-57964113 GTGTTGGGGGAGAGGGGAAGGGG - Intronic
931452580 2:62380575-62380597 GTGTTATGAGGGTAGGCACGAGG - Intergenic
931960923 2:67481799-67481821 CTGTTGTGAGGTAGGGGGAGAGG + Intergenic
932707819 2:74040255-74040277 GTGTGGTCAGGGAGGGGGCTTGG + Intronic
934935405 2:98461636-98461658 GTGTCTTAAGGGAGGGGACATGG - Intronic
935353126 2:102172329-102172351 GTGTTGTGAAGGAGAGGTCATGG - Intronic
936140460 2:109935616-109935638 GTGGAGTGAGTGAGGGGAAGGGG + Intergenic
936177151 2:110233561-110233583 GTGGAGTGAGTGAGGGGAAGGGG + Intergenic
936204234 2:110435870-110435892 GTGGAGTGAGTGAGGGGAAGGGG - Intronic
937073297 2:119082295-119082317 GTGATGTCAGGGAGAGGACCTGG + Intergenic
937135692 2:119550093-119550115 GTGTTGTTGGGGAGGGGCGGAGG + Intronic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
937978649 2:127597421-127597443 CAGGTGTGAGGGAGGGGGCGTGG - Intronic
940098925 2:150010910-150010932 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
940896670 2:159087702-159087724 GTGTTGGACGGGAGGGGACAAGG + Intronic
942116742 2:172735790-172735812 GTGGGGAGAGGGAGGGGACCCGG - Intronic
943212347 2:184983961-184983983 ATGTTCTAAGGGAGGGGACAGGG - Intergenic
943946162 2:194068595-194068617 GTGTGGTGGGGGACGGGAGGAGG - Intergenic
944680664 2:202073806-202073828 GTGTTGTTAGTGAGGTGGCGGGG + Intronic
945780980 2:214172242-214172264 CTGTTGTGGGGTAGGGGAAGTGG - Intronic
946127018 2:217571756-217571778 GTGTTGTCATGGAGAGGAGGAGG + Intronic
946563582 2:220939921-220939943 GTGATCTGAGGGAGGGGCCATGG - Intergenic
946746553 2:222852318-222852340 GAGGTGTGAGGGAGAGGACAAGG + Intergenic
947611290 2:231526493-231526515 ATGTTTTCAGGGAGGGGACGGGG + Intronic
947697336 2:232202712-232202734 GTGTGGTGAGGCTGGGGAAGTGG + Intronic
948230442 2:236345282-236345304 CTGCTGTGAAGGAAGGGACGTGG - Intronic
948864867 2:240770152-240770174 CTGTTGTGAGGAAGGGGATGGGG - Intronic
948889559 2:240900333-240900355 GCGGTGTGAGAGAGGGGAAGGGG + Intergenic
948945177 2:241215752-241215774 AGGTTGGGAGGGAGTGGACGAGG - Intronic
1169224701 20:3848703-3848725 GGGTTGTCAGGGAGGGAAGGAGG - Intronic
1169323581 20:4656139-4656161 CTGTTGTGAGGTAGGGGGAGCGG - Intergenic
1170664024 20:18370180-18370202 CTGTTGTGGGGGGGGGGGCGGGG + Intergenic
1170702024 20:18712386-18712408 GTGTTGTGGGGGTGGGGGTGGGG + Intronic
1172118149 20:32583797-32583819 GTGGCGTGGGGGAGGGGGCGGGG - Intronic
1172148217 20:32772405-32772427 CTGCTGTGAGGGAGGGGCCAAGG + Intronic
1172775027 20:37402325-37402347 GTGTGGGGAGGGTGGGGAAGGGG + Intronic
1173179186 20:40789461-40789483 GTGTAGTGAAGGAAGGGAAGAGG + Intergenic
1175409200 20:58754832-58754854 GGGTTGTGGGGGAGGGGGGGGGG + Intergenic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1176131981 20:63500044-63500066 GGGTTGTGAGGAAGGGGATGTGG + Intergenic
1176233354 20:64042793-64042815 GGGTCGTGGGGGACGGGACGGGG + Intronic
1176233375 20:64042835-64042857 GGGTCGTGGGGGACGGGACGGGG + Intronic
1176233407 20:64042898-64042920 GGGTCGTGGGGGACGGGACGGGG + Intronic
1176233427 20:64042939-64042961 GGGTCGTGGGGGACGGGACGGGG + Intronic
1176233455 20:64043001-64043023 GGGTCGTGGGGGACGGGACGGGG + Intronic
1176299477 21:5091766-5091788 TTGTTGTGATGGCGGCGACGCGG + Intergenic
1176326347 21:5504858-5504880 GTGTTGTGAGAGAGGGGCTCAGG - Intergenic
1176401410 21:6316093-6316115 GTGTTGTGAGAGAGGGGCTCAGG + Intergenic
1176435747 21:6673011-6673033 GTGTTGTGAGAGAGGGGCTCAGG - Intergenic
1176460009 21:7000081-7000103 GTGTTGTGAGAGAGGGGCTCAGG - Intergenic
1176483570 21:7381859-7381881 GTGTTGTGAGAGAGGGGCTCAGG - Intergenic
1176861164 21:14012286-14012308 GTGCTGTGGGGCAGGGGCCGGGG + Intergenic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1178389393 21:32185803-32185825 GAGTTCAGAGGGAGGGGAGGTGG - Intergenic
1179061821 21:37986150-37986172 ATGTTGTGAGGGAGTATACGGGG + Intronic
1179381220 21:40901117-40901139 GTGTTGTGGGGGGGGGGGAGGGG - Intergenic
1179857549 21:44170181-44170203 TTGTTGTGATGGCGGCGACGCGG - Intergenic
1180377293 22:12105972-12105994 CTGTTGTGAGGTGGGGGAAGGGG - Intergenic
1180669126 22:17539506-17539528 CTGTTGTGAGGTGGGGGAAGAGG + Intronic
1181478485 22:23182461-23182483 GTCTTGTGAGGGATGGGAGGTGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183614363 22:38934378-38934400 GTGGTGTGGGGCAGGGGATGGGG - Intergenic
1183799913 22:40153754-40153776 ATGTTGTGAGGGTGGGGCAGGGG + Intronic
1183959744 22:41404211-41404233 TTCTGGGGAGGGAGGGGACGTGG + Intergenic
1184015222 22:41780934-41780956 GTGATGTGAGAGAGGGGATGTGG + Intronic
1184420774 22:44381760-44381782 GTGTGGGGAGGAAGGGGAAGGGG + Intergenic
1184598199 22:45526823-45526845 GTGTTGGGTGGGAGGGTGCGGGG - Intronic
1184661548 22:45967703-45967725 GTGGTGGGTGGGAGGGGAAGGGG + Intronic
1184886219 22:47345932-47345954 CTGTTGTGAGGTGGGGGAAGGGG - Intergenic
1184978641 22:48080868-48080890 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1185418957 22:50724602-50724624 GTGCTGAGAGTGAGGGGAGGGGG + Intergenic
949673732 3:6428650-6428672 CTGTTGTGGGGTAGGGGAAGTGG - Intergenic
950653911 3:14424853-14424875 GCATTGGGAGGGAGGGGACGGGG + Intronic
950751907 3:15135841-15135863 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
951455421 3:22886768-22886790 GTGGTGTGTGTGAGGGGAGGTGG - Intergenic
954106051 3:48410335-48410357 GCTTGGTGAGGCAGGGGACGAGG + Exonic
954798155 3:53172000-53172022 GTGGGGTGAGGGAGGGGCCCAGG + Intronic
955422993 3:58758684-58758706 CTGTTGTGGGTGAGGGGAAGGGG - Intronic
957012381 3:75022669-75022691 GTGTTGTGGGGTGGGGGAAGTGG + Intergenic
957544957 3:81625082-81625104 ATGTTATGAGGGAGGGGGAGGGG + Intronic
957857212 3:85894340-85894362 CTGTTGTGGGGTAGGGGAAGTGG + Intronic
958990644 3:100840104-100840126 GTGGTTTTAGGGCGGGGACGGGG + Intronic
960459279 3:117913706-117913728 GTGCTATGAGGAAGGGGAAGAGG - Intergenic
961046336 3:123711194-123711216 GTGGTGTGGGGCAGGGGACGGGG + Intronic
961284707 3:125791857-125791879 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
962434284 3:135350210-135350232 TTTTTCTGAGGGAGGGTACGTGG - Intergenic
963522531 3:146373161-146373183 GGGTTGTGTGGGAGGGGGTGAGG - Intergenic
963603753 3:147397400-147397422 GTGGGGTGAGGGAGGGAAAGAGG - Intronic
964144502 3:153442733-153442755 GTGTTGTGCTGGTGGGGAGGGGG - Intergenic
964783453 3:160366901-160366923 GGGTTGTGAGGGAGGTGGGGTGG - Intronic
966960981 3:184938470-184938492 GTCTAGTGAGGGAGGGTAGGAGG + Intronic
967511989 3:190322830-190322852 GTGTGATGGGGGAGGAGACGCGG - Intronic
967565437 3:190965825-190965847 CTGTTGTGGGGTGGGGGACGGGG + Intergenic
967863103 3:194168044-194168066 GTGTTGGGAGGAAGGGGAAGAGG + Intergenic
968466087 4:752078-752100 GTTTTCCGAGGGAGGGGATGGGG + Intronic
968915030 4:3493596-3493618 GTGTTCTGTGGGAGGGACCGGGG + Exonic
969013034 4:4083004-4083026 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
969079471 4:4607282-4607304 GTGTGGTGGGGGTGGGGACTCGG - Intergenic
969142727 4:5093556-5093578 CTGTTGTGAGGTGGGGGAAGGGG + Intronic
969411597 4:7031992-7032014 GTGCTGGGAAGGAGGGCACGGGG - Exonic
969573277 4:8022547-8022569 GTGCTGGGAGGGAGGGACCGAGG - Intronic
969683129 4:8654160-8654182 ATGTGGTGAGGGAGGGCACCAGG - Intergenic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
969716492 4:8870647-8870669 GTGTTGTGGGGGTGGGGCCGGGG - Intronic
969740810 4:9024790-9024812 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
970305552 4:14728183-14728205 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
970815673 4:20152926-20152948 GTGTGGTGAGGATGGGGACAGGG + Intergenic
972117177 4:35650910-35650932 CTGTTGTGGGGCAGGGGAAGGGG + Intergenic
972433091 4:39002878-39002900 CTGTTGTGGGGGGGTGGACGGGG + Intronic
972750748 4:41986183-41986205 GTGTTGTAAGGGATGGGCTGGGG + Exonic
973867469 4:55127751-55127773 GTGCTGTGTGGGAGGGAATGTGG - Intergenic
974142400 4:57903758-57903780 GTGTTGTGTGAGAGAGGAAGGGG + Intergenic
974750478 4:66134008-66134030 CTGTTGTGAGGTGGGGGAAGAGG + Intergenic
976616864 4:87086920-87086942 GTGTTGTAATGAAGGGGAAGTGG + Intronic
976781218 4:88760835-88760857 GGGTTGCGGGGGAGGGGTCGTGG + Intronic
977039497 4:91997980-91998002 GTGTTGATAGGGTGGGGATGAGG + Intergenic
978117176 4:105033618-105033640 CTGTTGGGAGGTAGGGGACTAGG + Intergenic
978781007 4:112554199-112554221 GTGTTGTGGGTGGGGGGAGGGGG - Intronic
978789345 4:112644297-112644319 GTGTTGCGATGGAGAGGAGGGGG + Intronic
979048832 4:115903616-115903638 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
981583396 4:146273360-146273382 GTGGTGTGATGGAAAGGACGTGG + Intronic
982194435 4:152896056-152896078 GTGTTGCGGGGGAGGGGCTGGGG + Intronic
982353765 4:154444630-154444652 GTGTTGTGAGGGTGGTGCTGGGG - Intronic
982924413 4:161318174-161318196 CTGTTGTGAGGTGGGGGATGGGG - Intergenic
983263473 4:165482810-165482832 GTGGTGTCAGGGAGGGGAAGTGG + Intronic
1202758898 4_GL000008v2_random:91431-91453 CTGTTGTGAGGTGGGGGAAGGGG - Intergenic
985850980 5:2389037-2389059 GGGTCCTGAGGGAGGGGATGTGG - Intergenic
986846019 5:11754421-11754443 GTTTTTTGGGGGAGGGGGCGGGG + Intronic
987071174 5:14338358-14338380 GTGTTGAGCGGGAGGGGTCCTGG - Intronic
988210362 5:28196301-28196323 CTGTTGTGGGGTAGGGGAAGCGG - Intergenic
988287757 5:29242495-29242517 CTGTTGTGGGGTAGGGGAAGCGG - Intergenic
989212162 5:38866710-38866732 CTGATGAGAGGGAGGGGGCGGGG + Intronic
990090245 5:52036581-52036603 ATGGTGTGAGGGAGGGGCTGAGG - Intronic
991707126 5:69369274-69369296 GGGAGGCGAGGGAGGGGACGCGG - Intronic
992130419 5:73686306-73686328 CTGTTTTGAGGTAGGGGAGGAGG - Intronic
992149623 5:73890254-73890276 GTGTTGCAGGGGAGGGGAGGTGG - Intronic
992347595 5:75896210-75896232 CTGTTGTGGGGTAGGGGGCGGGG - Intergenic
992400501 5:76406930-76406952 ATGTTGTGGGGGCGGGGAAGGGG + Intronic
992755077 5:79896608-79896630 GGGTAGTGGGGGAGGGGAAGTGG - Intergenic
994133805 5:96262285-96262307 GGGTTGGGAGGGAGGAGAAGGGG + Intergenic
994531437 5:100977769-100977791 CTGTTGTGGGGGAGGGGGAGGGG - Intergenic
997240517 5:132303427-132303449 GTGCTGGGAGGAAGGGGAAGGGG - Intronic
997614460 5:135237003-135237025 GTGTAGAGAGGAAGGGGCCGAGG + Intronic
998051681 5:139041233-139041255 ATGTGGTGTGGGAGGGCACGTGG - Intronic
998165824 5:139842973-139842995 GTGATGTGAGGCAGGAGACCTGG - Exonic
998861971 5:146453182-146453204 GTGTTGAGAGTGAGGGGTGGTGG + Intronic
999700803 5:154225977-154225999 CTGTTGTGGGGTAGGGGAAGGGG + Intronic
999731361 5:154478458-154478480 GTGTTGAGGGGGCGGGCACGGGG + Intergenic
1001315610 5:170639269-170639291 GTGTTGTGGGGGCGTGGATGAGG - Intronic
1001771701 5:174301813-174301835 GTGTGGTGGGGGATGGGAGGGGG - Intergenic
1002400501 5:178989201-178989223 GGGTGGTGAGGGTGGGGAGGGGG - Intronic
1005931359 6:30487178-30487200 GAGTGGAGAGGGTGGGGACGTGG + Intergenic
1006291719 6:33143021-33143043 GTGTTGTGAGGAAGGACATGAGG + Intergenic
1006372852 6:33656193-33656215 TTGCTGTGAAGGAGGGGATGTGG + Intronic
1006898839 6:37487012-37487034 GGGTTGGGGGGCAGGGGACGGGG + Intronic
1007498874 6:42280411-42280433 GTGCTCTGAGGGAGGGCAGGGGG + Intronic
1007631517 6:43275720-43275742 GTGGGGTGGGGCAGGGGACGCGG - Intronic
1007920525 6:45605431-45605453 GTGTTGTTAGGGATGTGTCGGGG - Intronic
1008318126 6:50072123-50072145 GGGTAGTGAGGGAGGGGAGGAGG + Intergenic
1008494275 6:52116880-52116902 ATGTTCTGAGTGAGGGGAGGGGG + Intergenic
1008627869 6:53335487-53335509 GTGGGGTGGGGGAGGGGATGAGG - Intronic
1009894661 6:69733615-69733637 GTGTATAGAGGGAGGGGAAGAGG - Intronic
1010292279 6:74151279-74151301 CTGTTGTGAGGTAGGGGGAGGGG + Intergenic
1010463287 6:76138046-76138068 CTGTTGTGAGGTAGGGGAAGGGG - Intergenic
1010513453 6:76745796-76745818 CTGTTGTGGGGTGGGGGACGGGG - Intergenic
1010696270 6:78977370-78977392 CTGTTGTGGGGTGGGGGACGGGG + Intronic
1010729724 6:79378042-79378064 GTGTTTTGGGGGAGGGGAAAGGG + Intergenic
1010970025 6:82253324-82253346 GAGGTATGAGGGAAGGGACGTGG - Intergenic
1011766703 6:90627951-90627973 CTGTTGTGAGGTGGGGGAAGGGG + Intergenic
1012498794 6:99865272-99865294 TTGGTGTGAGGGATGGGGCGGGG + Intergenic
1013681790 6:112532441-112532463 CTGTTGTGGGTGGGGGGACGGGG - Intergenic
1015380803 6:132565757-132565779 GTGTTGTGAGGAAGGGTTTGGGG - Intergenic
1015918940 6:138247493-138247515 GTGTTATGATGGAGGGGAACTGG - Intronic
1016414208 6:143816017-143816039 CTGTTGAGAGGGAGGGAATGGGG - Intronic
1017289584 6:152720431-152720453 GTGTTGTGAGACTGGGGAAGAGG - Intronic
1017963922 6:159247219-159247241 GGGTGGGGAGGGAGGGAACGGGG - Intronic
1018647402 6:165961106-165961128 GTGGTGGGAGGGTGGGGATGGGG + Intronic
1019474761 7:1238740-1238762 GAGTTGTCGGGGAGGGGACGCGG + Intergenic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019887488 7:3918166-3918188 GTGTTGAGAGGGAAGACACGTGG - Intronic
1020014069 7:4820865-4820887 GTGGTGAGAGGGAGGTGGCGGGG - Intronic
1020531040 7:9335950-9335972 CTGTTGTGGGGTAGGGGATGGGG - Intergenic
1021080755 7:16361677-16361699 GAGCTGGGAGGGAGGGGAAGAGG + Intronic
1022407383 7:30103728-30103750 GTGATGTGAGGTAGGGGTTGAGG - Intronic
1022509352 7:30925359-30925381 GAGTTGTGATGGAGGGGAGAGGG + Exonic
1022752692 7:33247448-33247470 GTGTTGGGAGGGGAGGGACTGGG - Intronic
1023160166 7:37289235-37289257 GGATTGTGAGAGAGGGGAAGGGG - Intronic
1023721421 7:43099244-43099266 AGGTTGTAAGGGAGGGGAGGTGG - Intergenic
1023863967 7:44230068-44230090 GAGCAGTGAGGGAGGGGACCTGG - Intronic
1023924352 7:44654856-44654878 GTGCTGTGAGGGAGGAGAGAGGG - Intronic
1024257546 7:47549917-47549939 GGGGTGGGAGGGCGGGGACGTGG - Intronic
1024974948 7:55104697-55104719 GGGTTGGGAGAGAGGGGAAGAGG - Intronic
1025597459 7:62949261-62949283 CTGTTGTGGGGTAGGGGAAGGGG - Intergenic
1025813396 7:64889325-64889347 CTGTTGGGGCGGAGGGGACGCGG - Intronic
1025819332 7:64947690-64947712 GTGTGGGGGCGGAGGGGACGCGG + Intergenic
1026910601 7:74089681-74089703 GTGTTGAGCTGGAGGGGACATGG + Intronic
1027025790 7:74851164-74851186 GAGGTGTGAGGGTGGGGGCGGGG - Intronic
1027061971 7:75092955-75092977 GAGGTGTGAGGGTGGGGGCGGGG + Intronic
1027276360 7:76561346-76561368 CTGTTGTGGGGTAGGGGAAGGGG - Intergenic
1028187348 7:87802430-87802452 GTCTTATGAGGGAGGGAAAGTGG + Intronic
1029071691 7:97904638-97904660 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1029780643 7:102728537-102728559 CTGTTGTGAGGTGGGGGAAGCGG + Intergenic
1029879304 7:103790178-103790200 CTGTTGTGGGGGCGGGGACAAGG + Intronic
1030710439 7:112742632-112742654 TTATTGTGGGGGAGGGGAGGGGG + Intergenic
1032562085 7:132902662-132902684 CTGTTGTGAGGTAGGGGGAGTGG + Intronic
1032618703 7:133503820-133503842 GTGGTTTGGGGGAGGGTACGTGG + Intronic
1034278110 7:149832923-149832945 GTCTGGGCAGGGAGGGGACGGGG + Intergenic
1034849240 7:154478432-154478454 GTGATGTGAGGAAGAGGAGGAGG - Intronic
1035000485 7:155608878-155608900 GTGTTGTGAGGGAAAGGTGGAGG + Intergenic
1035049357 7:155989764-155989786 GGGTTATGAGGGAGGGGGTGAGG + Intergenic
1036079838 8:5543052-5543074 GTGTTGGGAGGGTGGGCACAGGG - Intergenic
1036165606 8:6429847-6429869 CAGGTGTGAGGGAGGGGTCGTGG - Intronic
1036246015 8:7117358-7117380 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
1036254784 8:7197105-7197127 GTGTGGTGGGGGAAGGGATGTGG - Intergenic
1036362703 8:8090402-8090424 GTGTGGTGGGGGAAGGGATGTGG + Intergenic
1036888255 8:12576670-12576692 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1036895852 8:12634769-12634791 GTGTGGTGGGGGAGGAGATGTGG - Intergenic
1037900081 8:22682979-22683001 GTGTTTGGAGGAAGGGGACGGGG + Intergenic
1038232779 8:25719664-25719686 TTGGTGTGAGGTAGGGGATGAGG + Intergenic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040777444 8:51063005-51063027 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1043511605 8:80955521-80955543 CTGTTGTGGGGTAGGGGAGGGGG + Intergenic
1045708734 8:104958776-104958798 CTGTTGTGAGGTTGGGGAAGTGG - Intronic
1045716999 8:105058520-105058542 TTGTCGTGGGGCAGGGGACGCGG + Intronic
1045888422 8:107126686-107126708 GATTTGGGAGGGAGGGGACAGGG - Intergenic
1045947797 8:107816454-107816476 CTGTTGTGGGGTAGGGGAGGGGG - Intergenic
1046514809 8:115244732-115244754 GTGTTGAGATGGTGGGGAGGTGG - Intergenic
1047335786 8:123934757-123934779 GTGTTGGGGGGGAGGGGTCCTGG + Intronic
1047998390 8:130357924-130357946 GAGCTGGGAGGAAGGGGACGCGG - Intronic
1048799385 8:138182056-138182078 GTGCTGTGAGTGAGGGAACAAGG - Intronic
1049146831 8:141006565-141006587 GTATTTTGAAGGAGGGGATGTGG - Intergenic
1049156150 8:141067883-141067905 GTGTTGAGAGAGAGGGGCCCAGG + Intergenic
1050999354 9:12261079-12261101 GTGTTGTGGGAGAGTGGAGGAGG - Intergenic
1051049254 9:12912103-12912125 GTGTTGTTAGGGTTGGGAAGTGG + Intergenic
1052278388 9:26704540-26704562 GAGTTCTGAGGGAGGAGACCAGG - Intergenic
1053348548 9:37395999-37396021 GCATTGTGTGGGAGGGGAGGGGG - Intergenic
1053349958 9:37407236-37407258 ATGCAGTGATGGAGGGGACGAGG - Intergenic
1053414631 9:37939334-37939356 GTGTTGTCAGGGAGGGGCAGAGG - Intronic
1056464905 9:86844208-86844230 GATTTGTGAGGAAGGGAACGTGG - Intergenic
1057195805 9:93115256-93115278 TTGGTGTGAGGGAGGGGTTGTGG + Intergenic
1057195943 9:93115688-93115710 GAGGAGTGAGGGAGGGGATGAGG + Intergenic
1057222286 9:93263787-93263809 GTGTGGTGGGGGTGGGGCCGTGG + Intronic
1057986525 9:99721203-99721225 GTGGTGTGAGGTAGGGGTCAAGG - Intergenic
1058090596 9:100801520-100801542 CTGTTGTGAGGTGGGGGGCGGGG + Intergenic
1059620272 9:115997151-115997173 TTTTTCAGAGGGAGGGGACGGGG + Intergenic
1060176260 9:121499550-121499572 GGGTGGTGAGGGAGTGGAGGCGG - Intergenic
1060234569 9:121853407-121853429 GCTCTGTGAGGGAGGGGACCTGG + Intronic
1060239154 9:121888089-121888111 GTCTGGTGAGGAAGGGGAGGGGG - Intronic
1060952502 9:127612809-127612831 GTGGGGTGAGGGAGGGGTGGAGG - Intronic
1062100204 9:134724021-134724043 GTGGTGCGAGGCAGGGGCCGAGG - Intronic
1062703133 9:137918499-137918521 GTGCTGTCAGGGTGGGGAGGGGG + Intronic
1203366285 Un_KI270442v1:260007-260029 CTGTTGTGAGGTGGGGGAGGGGG + Intergenic
1186121536 X:6368306-6368328 GTGTTATCAGGGATGTGACGGGG - Intergenic
1186297990 X:8169860-8169882 GTGTGGTGAGGGAGGGAGGGAGG - Intergenic
1186947225 X:14582213-14582235 CTGTTGTGGGGGTGGGGAGGGGG - Intronic
1187596962 X:20783798-20783820 GTGTTGGGGGGGCGGGGAGGGGG + Intergenic
1188194023 X:27208437-27208459 CTGTTGTGGGGGGGGGGAGGGGG + Intergenic
1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG + Intronic
1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG + Intronic
1190623197 X:52309308-52309330 CTGTTGTGAGGTGGGGGAAGGGG + Intergenic
1192218469 X:69180217-69180239 ATGGCGTGAGGGAGGGCACGAGG - Intergenic
1192459350 X:71303693-71303715 GAGGGGTGAGGGAGGGGACTGGG + Exonic
1192864389 X:75115782-75115804 GTGTTGGGGGGGGGGGCACGGGG + Intronic
1193326789 X:80187691-80187713 CTGTTGTGGGGTAGGGGAAGGGG - Intergenic
1193612421 X:83648868-83648890 CTGTTGTGGGGTAGGGGACAGGG - Intergenic
1193956647 X:87871882-87871904 GTGTTGTGGGGTAGGGGGAGGGG + Intergenic
1196600611 X:117597715-117597737 CTGTTGTGAGGTGGGGGAAGGGG + Intergenic
1197096559 X:122603824-122603846 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1197983575 X:132244182-132244204 CTGTTGTGAGGTAGGGGGAGGGG - Intergenic
1198178118 X:134175045-134175067 GTGGTCTGGGGGAGGGGACGGGG - Intergenic
1199417057 X:147597422-147597444 GTGATGTTAGGAAGGGGACATGG + Intergenic
1200022875 X:153226472-153226494 GTGCGGTGAGTGAGGGGGCGTGG + Intergenic
1200022932 X:153226751-153226773 GTGATGAGAGGGAGGGGGTGTGG + Intergenic
1200216022 X:154368613-154368635 GTGGGGTGAGGCAGGGGAAGTGG + Intronic
1200977152 Y:9225615-9225637 CTGTTGTGAGGTGGGGGAGGGGG - Intergenic
1201415088 Y:13740867-13740889 CTGTTGTGAGGTGGGGGAGGGGG - Intergenic
1201535668 Y:15045541-15045563 GTGTTGTGGGGTAGGGGGAGAGG + Intergenic
1201771117 Y:17617996-17618018 GTGTTGTGAGAGAGGGGCTCAGG - Intergenic
1201830438 Y:18287990-18288012 GTGTTGTGAGAGAGGGGCTCAGG + Intergenic
1202017644 Y:20428321-20428343 GTATTGGGAGGGAGGGGAAGAGG + Intergenic
1202041450 Y:20689628-20689650 CTGTTGTGGGGTAGGGGACAGGG - Intergenic
1202596996 Y:26550601-26550623 CTGTTGGGAGGGAGGGGATGGGG + Intergenic