ID: 1091436544

View in Genome Browser
Species Human (GRCh38)
Location 12:477949-477971
Sequence TGTTTGGAAGATTATAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091436544 Original CRISPR TGTTTGGAAGATTATAGAGG GGG Intronic
903077765 1:20785718-20785740 TGCTTGGAAGATTGTAGGGCTGG - Intronic
904494791 1:30880488-30880510 GGTTTGGAAAATTACTGAGGTGG - Intronic
904532575 1:31179285-31179307 TTTTTGGATGAGTATAGAGAGGG + Intergenic
905637868 1:39567333-39567355 TATTTTGAAGATTTTGGAGGTGG - Intronic
907529513 1:55080001-55080023 TCTTTGAAAGATTATGGAGTGGG - Intronic
908120195 1:60979107-60979129 TCTTTGCAAGAGTAGAGAGGGGG + Intronic
908197081 1:61755711-61755733 TTCTTGAAAGATTATAGAGTGGG - Intronic
909150081 1:71991260-71991282 TATTAAGAAGATTATAGAGGAGG - Intronic
909473201 1:76052931-76052953 TTTTTGGAAGATGATCTAGGGGG + Intergenic
909720380 1:78761333-78761355 AGTTTGCAAGATTATAGGGAAGG - Intergenic
910126553 1:83848974-83848996 TGTTTGGAAGTCTATAGCAGAGG + Intergenic
911055946 1:93708740-93708762 TGTTTGGGGGATTATTGAGATGG - Intronic
912625031 1:111199558-111199580 TGTTTGGAAGGTGGTAGGGGTGG - Intronic
912708926 1:111935913-111935935 TGTTGGGATGATTACATAGGGGG - Intronic
916017214 1:160760826-160760848 TGTGTGGAATATTATAATGGTGG + Intergenic
916749589 1:167712593-167712615 TGTGTGGAACATGATAGAGGTGG - Intergenic
917225343 1:172775667-172775689 TGTTAGGAAGAAAATAGAGCTGG - Intergenic
917852022 1:179072746-179072768 TGTTTTGATGATCTTAGAGGAGG + Exonic
919610065 1:199734376-199734398 TTTTTGGATGATCAAAGAGGTGG + Intergenic
924327856 1:242913566-242913588 TGTTTGGAGGACTAGGGAGGGGG + Intergenic
924640359 1:245827619-245827641 TCCTTGGAAGATCATAGAGTAGG - Intronic
1063078674 10:2743347-2743369 TTTTTGGTAGTTTAAAGAGGAGG - Intergenic
1064341158 10:14486831-14486853 TGTTAGAAATATTATGGAGGAGG - Intergenic
1068032790 10:51724096-51724118 TATTTCAAAGATCATAGAGGGGG + Intronic
1068633244 10:59320191-59320213 TCTTTGGAAGAGTCTAAAGGAGG - Intronic
1069067007 10:63952430-63952452 TCTTTGGAAAATCATAGTGGTGG + Intergenic
1069528390 10:69195001-69195023 TGTTGTGAGGATTAAAGAGGAGG + Intronic
1070805442 10:79268035-79268057 TGTTTGGGAGCTGAAAGAGGAGG + Intronic
1072441356 10:95458844-95458866 TGTTAAGAAGACTATAGAGATGG + Intronic
1073830133 10:107374363-107374385 TGTTTGAAGGATTTTATAGGTGG - Intergenic
1074099926 10:110346816-110346838 TGTTTGGGAGGTGATGGAGGTGG - Intergenic
1074113224 10:110437310-110437332 TCTTGTGAAGATTACAGAGGAGG + Intergenic
1074823786 10:117200508-117200530 CCTTTGAAAGATGATAGAGGCGG + Intronic
1076114706 10:127887121-127887143 TGTTTTGAAAGTAATAGAGGGGG + Intronic
1076815117 10:132910800-132910822 TGTTTGGAAGTTTATCCAGAAGG - Intronic
1078293363 11:10039147-10039169 TATTTGGAAGCCTAAAGAGGGGG - Intronic
1078894236 11:15584054-15584076 AGTTAGGAAGTTTGTAGAGGTGG - Intergenic
1080110825 11:28565942-28565964 TTTTTGGAAAAGTATAGAAGTGG + Intergenic
1083181686 11:60990144-60990166 TGTCTGGAAGATTCTACAAGAGG - Intronic
1083187736 11:61027196-61027218 TGTGTGGAAGAATGAAGAGGAGG - Intergenic
1083971537 11:66079630-66079652 GAACTGGAAGATTATAGAGGGGG - Intronic
1085677029 11:78531933-78531955 TGTTTGGAACTTAACAGAGGTGG + Intronic
1086502335 11:87466234-87466256 TATTTGGAAGACTTTAGATGTGG + Intergenic
1086862292 11:91939254-91939276 TGTTTGGCAGGTTAAAGAGAGGG - Intergenic
1090375049 11:126282744-126282766 TGTTAGGAAGATTAAATGGGCGG + Intergenic
1091436544 12:477949-477971 TGTTTGGAAGATTATAGAGGGGG + Intronic
1092920190 12:13224213-13224235 AATTTGGCAGATTATACAGGGGG + Intergenic
1093529213 12:20140916-20140938 TGATTGTGAGATTATAGAGCTGG + Intergenic
1095277129 12:40299633-40299655 TGTTTTGTATACTATAGAGGGGG + Intronic
1095659358 12:44711628-44711650 TGTTTGGCAAATTATAGACATGG - Intronic
1097586788 12:61524979-61525001 TGTTTTGAAGATTAAAGAGATGG + Intergenic
1100719891 12:97346477-97346499 TGTTTCAAAGATCATAGAAGTGG + Intergenic
1101047627 12:100826567-100826589 TGTTTGGGAGATTCTAGGGATGG + Intronic
1101228733 12:102717037-102717059 TTTTTGGAAGAATTTTGAGGTGG + Intergenic
1102079656 12:110087499-110087521 TGTTTGTTTGTTTATAGAGGGGG - Intergenic
1104277364 12:127341882-127341904 TGTTTGAAAGAGTAGAGACGGGG - Intergenic
1105597641 13:21854405-21854427 TCCTTGAAAGATTACAGAGGAGG - Intergenic
1106430249 13:29674129-29674151 TGTTAGGAAGATTAGGGATGGGG - Intergenic
1111161583 13:84401515-84401537 TGCTTTGAAGAATATAGAGATGG + Intergenic
1111368356 13:87281204-87281226 TGTTTGGAAAATTAGGGAGCAGG - Intergenic
1112714746 13:102170722-102170744 GGTTTGGAAGAATATAGTGCTGG - Intronic
1114166570 14:20224624-20224646 TGTTTCGAAGACTATAGATAAGG - Exonic
1115114215 14:29860141-29860163 TGTTTTGCAGATTGTAGATGTGG - Intronic
1117498013 14:56324916-56324938 TGTTGGTAAGATTATGGGGGTGG - Intergenic
1118383570 14:65237414-65237436 TGTTTGGAAGCATATAGGGAAGG + Intergenic
1120845878 14:89124514-89124536 TATTTGGAACTTGATAGAGGTGG - Intergenic
1124552978 15:30699047-30699069 TGTTTGGGAGTTTTAAGAGGAGG + Intronic
1124617916 15:31255959-31255981 CGTTGGGAAAATTATAGAGTAGG - Intergenic
1124678265 15:31706623-31706645 TGTTTGGGAGTTTTAAGAGGAGG - Intronic
1127249352 15:57214153-57214175 TCTTTGAAAAATTAAAGAGGGGG - Intronic
1131327169 15:91459222-91459244 AGTTTGGAAGATTTCATAGGGGG - Intergenic
1133586796 16:7203566-7203588 GAATTGGAAAATTATAGAGGTGG + Intronic
1133855247 16:9543574-9543596 TGGCTGGAACATTATAGTGGAGG - Intergenic
1134306701 16:13039500-13039522 TTTTTTGAAACTTATAGAGGAGG + Intronic
1134492601 16:14706517-14706539 TATTTGGTAGATTATATGGGCGG - Intergenic
1134497982 16:14745639-14745661 TATTTGGTAGATTATATGGGCGG - Intronic
1134582587 16:15383441-15383463 TATTTGGTAGATTATATGGGCGG + Intergenic
1135540250 16:23324573-23324595 TGTTTGGAGGCTTATGTAGGAGG - Intronic
1138945741 16:61847513-61847535 TGATTGGAAGCTTACAGAAGGGG - Intronic
1140701108 16:77582343-77582365 TGATAGGAAGATCATGGAGGCGG - Intergenic
1140870555 16:79102399-79102421 TGTATGGAATATTATTGAGCTGG + Intronic
1141136585 16:81469535-81469557 TGTTACCAAGATTACAGAGGAGG + Intronic
1141904528 16:87015367-87015389 TGTTTGGATGAGCATAGGGGTGG + Intergenic
1144192717 17:12861158-12861180 TTTTTGTATGTTTATAGAGGTGG + Intronic
1146181727 17:30702771-30702793 TGTTTAAAAGATTATAGGGCTGG - Intergenic
1147191679 17:38741632-38741654 TATTTGGCAGACTTTAGAGGAGG - Intronic
1147492281 17:40881202-40881224 TGTATGTAAGATTGTAGAGGAGG - Intronic
1147687478 17:42295324-42295346 TGTTTGGAATACTCTAGTGGAGG + Intronic
1148019465 17:44543595-44543617 TGTTTGGAAGAGTTTGGAGGAGG + Intergenic
1152148305 17:78582732-78582754 TGTTTGAAAGATGATAGAAGAGG - Intergenic
1153082184 18:1240333-1240355 TCTTTGGAAGATAAAAGATGAGG + Intergenic
1153147618 18:2051682-2051704 TGTTTGAAAGGTTGTAGAGATGG + Intergenic
1153936098 18:9924415-9924437 TCTTTGGAAGTTTAGAGTGGAGG + Intronic
1154048793 18:10933580-10933602 TGTCTGGATGGATATAGAGGAGG - Intronic
1155381617 18:25228501-25228523 TGTTTGGAAAGTTCAAGAGGTGG + Intronic
1156301306 18:35838709-35838731 GGTTTAGAAGAGGATAGAGGTGG - Intergenic
1157185779 18:45539094-45539116 TTTTTGGAACATTATAGTGCTGG - Intronic
1157851010 18:51050746-51050768 TGTTTGTAGAATTTTAGAGGTGG + Intronic
1158770813 18:60514810-60514832 TGTTTAGAAGATCCTAGATGTGG + Intergenic
1159395293 18:67847391-67847413 TTTTTGGTAGATTTTTGAGGCGG - Intergenic
1160966834 19:1750397-1750419 GGTGTGGAGGATTAAAGAGGGGG + Intergenic
1162464841 19:10833423-10833445 AATTTGGAAGCTTATAGAAGAGG - Intronic
1162977106 19:14213034-14213056 TGTTTAAAAGATTATAGGGCTGG + Intergenic
1164920847 19:32087552-32087574 TATTTGGAAGCTTAGAAAGGAGG - Intergenic
1166020380 19:40023487-40023509 CTGTTGGAAGATGATAGAGGAGG + Intergenic
1166422471 19:42649813-42649835 TCTTGGGAACTTTATAGAGGTGG - Intronic
1168137198 19:54359720-54359742 TGTTTTGCATATTAGAGAGGAGG + Intronic
1168160878 19:54509365-54509387 TGTTTTGCATATTAGAGAGGAGG - Intronic
931592090 2:63895544-63895566 TGTTTGGAACTAGATAGAGGTGG + Intronic
931619216 2:64193145-64193167 TTTTTGGAACATGATAGATGGGG + Intergenic
932512883 2:72312941-72312963 AATTTGGAACATTAAAGAGGAGG - Intronic
935280507 2:101513319-101513341 TTTTAGGAAGATTATCCAGGTGG - Intergenic
936277531 2:111113348-111113370 TGTGTGCCAGATTACAGAGGAGG - Intronic
938176146 2:129131930-129131952 TGGTTTGAAGATTCTAGTGGTGG + Intergenic
939628022 2:144502369-144502391 TGTTTGGAAGTTTCTAAAAGTGG + Intronic
939910286 2:147974330-147974352 TGTTTGAAAGATTAAAAAAGGGG + Intronic
943831599 2:192471131-192471153 TGATTGGAAGATTATTGTAGAGG - Intergenic
944076412 2:195736556-195736578 TGTTTTGAAGTTCATAGAGTAGG - Exonic
945747461 2:213735874-213735896 TGTTTTGAATATTATGGATGGGG + Intronic
1169405954 20:5321470-5321492 TGTTTGGTAGATTATAGAAAGGG + Intergenic
1170724036 20:18910134-18910156 TTTTTGGAAGATAATAAATGTGG + Intergenic
1175003694 20:55659046-55659068 TATTTGAAAGATCAAAGAGGTGG - Intergenic
1175566190 20:59979070-59979092 TGTTTAGAACATCATAGAGACGG + Intronic
1177522726 21:22250146-22250168 TTTTTGGAGCATTATAGAGAAGG + Intergenic
1180296677 22:10944426-10944448 AGTTGAGAAGACTATAGAGGAGG + Intergenic
1184372387 22:44090689-44090711 TGTGTGGAGGATTACACAGGTGG - Intronic
949390781 3:3559783-3559805 TCTTGGGCAGAGTATAGAGGGGG + Intergenic
949760371 3:7463930-7463952 TGCTGGGAAGATAATGGAGGGGG + Intronic
950815973 3:15702772-15702794 TGATGGGAAGAGTAGAGAGGAGG - Intronic
952301474 3:32107486-32107508 TGTTTGGGTGAATGTAGAGGTGG + Intronic
953443466 3:42940979-42941001 TGTTTAGAAGCTCATAGCGGAGG + Intronic
954907419 3:54074710-54074732 GGTTTAGAAGAGGATAGAGGTGG - Intergenic
954986594 3:54799760-54799782 TGTTTGGCAGGTTATAGACATGG - Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955367093 3:58320242-58320264 TGTTATGAACATTATAGAAGAGG + Intergenic
955864046 3:63362958-63362980 TGTTTGGATAATTCTAGTGGTGG - Intronic
957564726 3:81869678-81869700 TGTTTGGGAAATTTTAAAGGTGG + Intergenic
959508648 3:107183820-107183842 TGTTTTGAAAATTATAAAAGGGG - Intergenic
961149535 3:124625548-124625570 TTTTTGGAAGAAGATAGAGATGG - Intronic
965114067 3:164465396-164465418 TGTTTGGATGATTATGGAAGTGG + Intergenic
965455137 3:168890137-168890159 TTTTTGGAACATTTAAGAGGTGG - Intergenic
966404986 3:179587479-179587501 TGTTTGGATGGTTCTGGAGGAGG + Intronic
966675787 3:182587577-182587599 CTTTTGGAAAATTAAAGAGGAGG + Intergenic
968617858 4:1588276-1588298 TGTTTGTAAGATAATTGTGGTGG + Intergenic
970542481 4:17093826-17093848 TGTATGGAAGGTTTTAGAGCAGG + Intergenic
972346778 4:38198945-38198967 AGTTGGTAAGATTATGGAGGAGG + Intergenic
973318962 4:48790416-48790438 TGTTCAGAAGATGACAGAGGAGG - Intergenic
975816200 4:78218780-78218802 TGTTTGGGAGATTAGTGAGAAGG + Intronic
977193054 4:94024205-94024227 TGTCCGAAAGATAATAGAGGAGG + Intergenic
977761141 4:100738704-100738726 GGTTTCGATGATGATAGAGGAGG - Intronic
977936294 4:102809433-102809455 TGTTTGGTAGGTCATAGAGATGG + Intronic
978061930 4:104349794-104349816 TGTTAGGAAGAAGATAGAGATGG + Intergenic
978784895 4:112598506-112598528 TGCCTGGAAGAATATAAAGGAGG + Intronic
980854319 4:138421173-138421195 TGTTTGTAATATTTTAGTGGAGG + Intergenic
981162705 4:141517897-141517919 TATTTGGAAGATTGAAGTGGGGG - Intergenic
981510557 4:145552725-145552747 TGTTTGGAAAATTTTAGAAAGGG - Intronic
981649134 4:147036267-147036289 TGGTGGGAAGAATATGGAGGAGG - Intergenic
982986258 4:162211152-162211174 TGTTTGGAATAGGAGAGAGGGGG - Intergenic
985230806 4:187814486-187814508 TGTTTGGATGACGATGGAGGAGG - Intergenic
986273842 5:6256646-6256668 TCTTTGGAAGATTCTGGAGCTGG - Intergenic
986931975 5:12836391-12836413 TCTTTGTAAAATGATAGAGGAGG - Intergenic
986968135 5:13300580-13300602 TGATTGGCAGAGGATAGAGGTGG + Intergenic
990760366 5:59122771-59122793 TGTTTGGAACTAGATAGAGGTGG - Intronic
991216277 5:64160145-64160167 GGTTTAGAAGAGGATAGAGGTGG - Intergenic
993294041 5:86110930-86110952 TGTTTGACAGATTTAAGAGGAGG - Intergenic
994647496 5:102489267-102489289 TGTTTGGAAGTTTGAAGAGAAGG - Intronic
995252256 5:110006799-110006821 TGTTTGGAAAATTTTAGCAGTGG + Intergenic
996169314 5:120268973-120268995 TGTTTTGAAGATCATAGAAAGGG - Intergenic
996349551 5:122523313-122523335 TGTTTGGAAGATTTTTCAGAAGG - Intergenic
997089030 5:130834451-130834473 TTTTTGGAAGACTAGAGAGAGGG - Intergenic
997373767 5:133382544-133382566 TGTTTGGAAAATTGGAGAGAGGG + Intronic
998245474 5:140499339-140499361 TATTGGTAAGATTATAGAGTAGG + Intronic
998936614 5:147235736-147235758 TGTTTGTAAAATCATAGAAGGGG + Intronic
999299073 5:150479399-150479421 TGTGAGGAAGACTATAGAAGAGG + Intergenic
1001780792 5:174367459-174367481 TGTTTGGCAGATTATAGGTTGGG + Intergenic
1005527659 6:26666955-26666977 TGTTTTGAAGATGAAAGAAGAGG - Intergenic
1006744884 6:36334535-36334557 TCTTTGGAACATTACAGAGGAGG - Intronic
1007248073 6:40476633-40476655 TGTCTGGAAAGTTATAAAGGAGG - Intronic
1008686043 6:53927377-53927399 TGTGTGGAAGATTGGAGATGAGG + Intergenic
1009033789 6:58092553-58092575 TTTTTAAAAGATTATAGAGATGG + Intergenic
1009209398 6:60844256-60844278 TTTTTAAAAGATTATAGAGATGG + Intergenic
1010720577 6:79278886-79278908 TGTTTGGAAGCTTCTAGATTAGG + Intergenic
1011581385 6:88870134-88870156 TGATTTGAAGATTATATAGGTGG - Intronic
1011772485 6:90690526-90690548 TTATGGGAGGATTATAGAGGAGG - Intergenic
1012637331 6:101560894-101560916 TGTTTTGAAGAATATAGACTTGG + Intronic
1012896614 6:104956407-104956429 ATTTTGGAAAATTTTAGAGGGGG - Intergenic
1013457485 6:110343834-110343856 AGTCTGGAAGATTAGAGAAGCGG + Intronic
1014755566 6:125298871-125298893 ACTTTGGAAGAGTATAGAGAAGG - Intronic
1015188597 6:130447361-130447383 TATTTGGGAGATAAGAGAGGAGG + Intergenic
1015996220 6:138997910-138997932 AGTTTGGAAAATTAGAGTGGAGG + Intergenic
1016218640 6:141636520-141636542 TGTTTTTAAGATTATAGATTGGG - Intergenic
1017957667 6:159192207-159192229 TGGATGGTAGATTTTAGAGGTGG - Intronic
1019309107 7:351667-351689 TGTTTGGAAGATACTGGGGGTGG - Intergenic
1020623310 7:10545190-10545212 TGGATGGAAGAATATATAGGAGG - Intergenic
1021209603 7:17831090-17831112 TGGTGGGAAGATTTAAGAGGTGG - Intronic
1021293099 7:18869728-18869750 TGTATTGAAGATTATTGTGGTGG + Intronic
1021867007 7:24968145-24968167 TCTTTTGAAGATTATACAAGAGG - Intronic
1022857357 7:34328535-34328557 TGTTTAGAAGATTTTTGATGGGG + Intergenic
1023377352 7:39570500-39570522 TTTTAGGAAGGTTATAGAGATGG + Exonic
1028056294 7:86248830-86248852 TGATTGGTAGATAATAGAGAGGG - Intergenic
1030104964 7:105979377-105979399 GGTATGGAAGATTGTCGAGGGGG - Intronic
1030804256 7:113894918-113894940 TGTTTGGAAGAGTTTGGAGAAGG + Intronic
1033598617 7:142873694-142873716 TGTCTGGAAGATGATATAGAAGG + Exonic
1037867508 8:22457661-22457683 AGTACGGAAGATTATAAAGGGGG - Intronic
1042481205 8:69304886-69304908 TGTGTGGAAGATTTGACAGGTGG + Intergenic
1045566944 8:103327904-103327926 TTTGTGGTAGATTATAGTGGGGG + Intronic
1045985086 8:108240575-108240597 GGTTTGAGAGATTATAGAGCTGG - Intronic
1046396283 8:113644483-113644505 TGTTTGCAAAATAATAGAGAGGG + Intergenic
1046517136 8:115277080-115277102 TTTTTGGAAGCTTATATGGGAGG + Intergenic
1046710878 8:117510052-117510074 TAGTTGGTAGATTCTAGAGGTGG - Intergenic
1048326898 8:133446872-133446894 TATTTAGAAGGTTATAGATGTGG + Intergenic
1048334898 8:133495216-133495238 TGTGTGGAAAAGAATAGAGGAGG - Intronic
1048349569 8:133605207-133605229 TGTTTGGAACTAGATAGAGGTGG + Intergenic
1048475028 8:134735133-134735155 TGTTGGAAAGATTTTACAGGAGG + Intergenic
1048855851 8:138686073-138686095 TGTTGGGAAGATTTCAGAGAAGG - Intronic
1049231330 8:141485152-141485174 TGTTTTCAAGAAAATAGAGGAGG - Intergenic
1050259875 9:3829615-3829637 TGCTTGGAAGATTCTACAGGTGG - Intronic
1051023991 9:12583534-12583556 TGTTTGAAAGAATATACAGCAGG + Intergenic
1052873412 9:33531213-33531235 TGTTGGGAAAATTCTTGAGGTGG + Intronic
1053502688 9:38613533-38613555 TGTTGGGAAAATTCTTGAGGTGG - Intergenic
1055972555 9:81926307-81926329 TTTCTGCCAGATTATAGAGGCGG - Intergenic
1055974308 9:81941379-81941401 TTTCTGCCAGATTATAGAGGCGG - Intergenic
1057682517 9:97202811-97202833 TGTTGGGAAAATTCTTGAGGTGG - Intergenic
1057734195 9:97638495-97638517 AGTTAGGAAGACTGTAGAGGTGG + Intronic
1059079440 9:111232863-111232885 TGTTTAGAACATCATAAAGGGGG - Intergenic
1060004201 9:119985330-119985352 TGTCTGGAACATTATCGTGGAGG - Intergenic
1186387514 X:9125074-9125096 TGTTTGGAAGACTTAAGAGATGG + Intronic
1186516380 X:10168820-10168842 TGTTTGGAACTTTATAGGGATGG + Intronic
1186655754 X:11609982-11610004 TGTTGGTATGATTTTAGAGGAGG + Intronic
1187357592 X:18591734-18591756 TGTTGGGAGCATTATAGAGATGG - Intronic
1187675938 X:21716640-21716662 TGTTTGGAAGATAGAAAAGGAGG - Intronic
1189450556 X:41125008-41125030 TGTTTGGAAGATTTTACTGGTGG + Intronic
1189723010 X:43939904-43939926 TTTTGGGAAGATTATATAGATGG + Intergenic
1192118762 X:68435109-68435131 TGTTTTGAAGATTAGTGAGATGG - Intergenic
1193607487 X:83586153-83586175 TGTGTGGTAGATTTTAGAGTAGG - Intergenic
1193951380 X:87804245-87804267 TGGTTGGAAGATGATAGATGGGG + Intergenic
1194108651 X:89803251-89803273 TGTATGGAATATTATAATGGTGG + Intergenic
1194589294 X:95777979-95778001 TTTTTGCAAGATTTTAGTGGCGG - Intergenic
1195582034 X:106515976-106515998 TGTCTGGAAGATAATGGAAGAGG + Intergenic
1195772182 X:108363193-108363215 TGGTAGGAATATTATAGAGGAGG + Intronic
1195780959 X:108463557-108463579 TGTTTTGAAGATGATATAGGTGG + Intronic
1196750316 X:119110452-119110474 TGTATGGGAGATTATAGACCGGG + Intronic
1196982565 X:121231455-121231477 TTTCTGGAAGATTTTAGAGGGGG + Intergenic
1197112355 X:122791311-122791333 TGTTTTGAAGACTGTAGAGAAGG - Intergenic
1197133584 X:123034707-123034729 GGTTTGCAAGAGTTTAGAGGAGG - Intergenic
1199534229 X:148884176-148884198 TGTTTTGAAGATCTTAGAGAAGG - Intronic
1201225267 Y:11812527-11812549 TGTTTGGAGGACTAGGGAGGGGG + Intergenic