ID: 1091440008

View in Genome Browser
Species Human (GRCh38)
Location 12:505392-505414
Sequence CAGTGGGAACAGAGGAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 826
Summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 733}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091440008_1091440022 13 Left 1091440008 12:505392-505414 CCCCCTTTCCTCTGTTCCCACTG 0: 1
1: 0
2: 7
3: 85
4: 733
Right 1091440022 12:505428-505450 TGGACTCCCTAAGCCCAGAGGGG 0: 1
1: 0
2: 2
3: 17
4: 183
1091440008_1091440023 18 Left 1091440008 12:505392-505414 CCCCCTTTCCTCTGTTCCCACTG 0: 1
1: 0
2: 7
3: 85
4: 733
Right 1091440023 12:505433-505455 TCCCTAAGCCCAGAGGGGAAAGG 0: 1
1: 0
2: 1
3: 34
4: 242
1091440008_1091440021 12 Left 1091440008 12:505392-505414 CCCCCTTTCCTCTGTTCCCACTG 0: 1
1: 0
2: 7
3: 85
4: 733
Right 1091440021 12:505427-505449 CTGGACTCCCTAAGCCCAGAGGG 0: 1
1: 0
2: 4
3: 13
4: 216
1091440008_1091440026 22 Left 1091440008 12:505392-505414 CCCCCTTTCCTCTGTTCCCACTG 0: 1
1: 0
2: 7
3: 85
4: 733
Right 1091440026 12:505437-505459 TAAGCCCAGAGGGGAAAGGAAGG 0: 1
1: 0
2: 4
3: 35
4: 415
1091440008_1091440014 -7 Left 1091440008 12:505392-505414 CCCCCTTTCCTCTGTTCCCACTG 0: 1
1: 0
2: 7
3: 85
4: 733
Right 1091440014 12:505408-505430 CCCACTGCAGCCTCCAACCCTGG 0: 1
1: 6
2: 71
3: 691
4: 3388
1091440008_1091440027 23 Left 1091440008 12:505392-505414 CCCCCTTTCCTCTGTTCCCACTG 0: 1
1: 0
2: 7
3: 85
4: 733
Right 1091440027 12:505438-505460 AAGCCCAGAGGGGAAAGGAAGGG 0: 1
1: 0
2: 6
3: 69
4: 694
1091440008_1091440020 11 Left 1091440008 12:505392-505414 CCCCCTTTCCTCTGTTCCCACTG 0: 1
1: 0
2: 7
3: 85
4: 733
Right 1091440020 12:505426-505448 CCTGGACTCCCTAAGCCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091440008 Original CRISPR CAGTGGGAACAGAGGAAAGG GGG (reversed) Intronic
900383693 1:2399201-2399223 CTGTGGGAACAGAGACAAAGCGG - Intronic
900797117 1:4714827-4714849 CAAAGGGAAGAGAGGAAATGCGG + Intronic
900890507 1:5446405-5446427 CAGGAGGAAGAGAGCAAAGGGGG + Intergenic
900928441 1:5720397-5720419 CAATGGGAACAGGGGAGAGGTGG + Intergenic
901004398 1:6164900-6164922 CAGGGGGAAGAGAGAAAAGACGG + Intronic
901029650 1:6299537-6299559 CAGAGGGCACAGAGGACAGTCGG + Intronic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902421871 1:16287131-16287153 CAGAGTGAACAAAGGAGAGGAGG - Intronic
902511436 1:16969049-16969071 CAGTGGGAGCAGAGGTATAGAGG + Intronic
902688225 1:18092846-18092868 CAGTGGGGACAGAGGAGAATGGG - Intergenic
903066305 1:20701622-20701644 CCTTGGGAACTGAGGAGAGGTGG + Intronic
904083006 1:27883770-27883792 CAGTGGGAGCACAGAAGAGGAGG - Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
905009731 1:34739247-34739269 CAGCAGGCCCAGAGGAAAGGCGG - Intronic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905319450 1:37105569-37105591 GAGTGGGCACAGATGCAAGGAGG + Intergenic
906013111 1:42548108-42548130 GAGTGTGAAGAGAGGAAATGGGG + Intronic
906082937 1:43106224-43106246 CAGGAGGAAAAGAGCAAAGGTGG + Intergenic
906119408 1:43378589-43378611 CAGTGGGAATAAAGGAATGGAGG + Intergenic
906178560 1:43798154-43798176 CATTGTGAAGACAGGAAAGGGGG - Intronic
906858182 1:49330909-49330931 CATGGAGAACAGAGGAAAGCAGG + Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
907964549 1:59316528-59316550 CAGTGTGAAAAAAGGAAAAGGGG - Intronic
908649211 1:66313689-66313711 AACTGGGAACTGAGGAAATGGGG + Intronic
908877948 1:68699249-68699271 CAAGGGGAAGAGAGGAAATGAGG - Intergenic
909235693 1:73150706-73150728 CTGTGGGAACAGAGTAAATCAGG - Intergenic
909289293 1:73861755-73861777 CAGGAGGAACAGAGAAAAGGGGG + Intergenic
909329600 1:74395796-74395818 CCTAGGGAACAGAGGAAAGAGGG + Intronic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
910479883 1:87646925-87646947 TTGTGGGGAAAGAGGAAAGGAGG + Intergenic
910493079 1:87794776-87794798 GAGTGGGAACAAATGAAAGCTGG + Intergenic
910989032 1:93035915-93035937 GAGTGGGAACTGAGGAAGGATGG + Intergenic
911735384 1:101331234-101331256 CAGGAGGAAGAGAGCAAAGGAGG + Intergenic
912005597 1:104896110-104896132 CAGTGGGAAAAGGGGGAATGGGG + Intergenic
912412533 1:109488629-109488651 AGGTGGGAACAGTGGGAAGGAGG + Intronic
912687022 1:111775833-111775855 CACTGGGGCCAGAGGAAGGGAGG - Exonic
912872410 1:113321194-113321216 GTGTGAGAACAGAGAAAAGGGGG - Intergenic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
913240396 1:116825237-116825259 CATTGGGAAAGGAGGAAAGGGGG - Intergenic
914937418 1:151993409-151993431 GAGTGGGAAAGTAGGAAAGGTGG + Intronic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915164387 1:153940556-153940578 CAGCGGGCACAGAGGAATGTAGG + Exonic
915516028 1:156413221-156413243 CTGTGGGAACAGAGAAGAGGAGG - Intronic
915919296 1:159962185-159962207 CAAGGGGAACAGAGGATGGGAGG + Intergenic
915969923 1:160347427-160347449 CTGTGGGGACAGACGAAAGAAGG - Intronic
916127987 1:161588480-161588502 CACTGGGAGGAGAGGAAAAGGGG - Intronic
916137905 1:161670310-161670332 CACTGGGAGGAGAGGAAAAGGGG - Intronic
916379096 1:164188725-164188747 GAGTGAGAGCAGAGGACAGGAGG - Intergenic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
917576102 1:176323322-176323344 CCCTGGGAGCTGAGGAAAGGTGG - Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918569730 1:185975405-185975427 CAGAAGGAAGAGAGCAAAGGGGG + Intronic
918967389 1:191369282-191369304 CACAGGGAACAAAGGAAAGCAGG - Intergenic
919159742 1:193813395-193813417 CAGTGTGAAAAGAGGAAAAGAGG + Intergenic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
919730244 1:200909022-200909044 CAGATGGAAAAGTGGAAAGGTGG + Intronic
919956056 1:202417384-202417406 CATGTGGAACAAAGGAAAGGTGG + Intronic
920186236 1:204161159-204161181 CAGTGGGCACAGAGGCAGAGAGG + Intronic
921098595 1:211909163-211909185 CAGAGGGCCCAGAGCAAAGGTGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921832425 1:219743040-219743062 CAGAAGGAAGAAAGGAAAGGAGG + Intronic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922004156 1:221511872-221511894 CAATGGAAACAGAGGTAAGGGGG - Intergenic
922093032 1:222415717-222415739 CAGTGGGAAGAAAGAAAATGAGG + Intergenic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
923051745 1:230394980-230395002 GAGTGGGAGGAGAGGAAGGGAGG - Intronic
923124451 1:231023043-231023065 CAGTGGGAACTGAGGACTGGAGG - Intronic
923779373 1:237008563-237008585 CAGTGAGACCAGAGAAAACGGGG - Intergenic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924426964 1:243960188-243960210 CAGTTGGAACAGATGACAGTGGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924508821 1:244711560-244711582 CAGAGGGCACATTGGAAAGGGGG - Intergenic
924577399 1:245292792-245292814 CAGCGAGAACCGAGGGAAGGTGG - Intronic
1062772184 10:111010-111032 CAGGAGGAAGAGAGCAAAGGAGG + Intergenic
1062889793 10:1049410-1049432 CAATGGAAACGGAGGAAAGGCGG + Intergenic
1063153585 10:3357983-3358005 CAGGAGGAAGAGAGCAAAGGGGG + Intergenic
1064458272 10:15508662-15508684 CAGTGGGAAGAGCAGATAGGTGG + Intergenic
1065257409 10:23884975-23884997 AAATGGGAGAAGAGGAAAGGTGG - Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067059911 10:43072983-43073005 CAGAGGGGAAAGAAGAAAGGAGG + Intergenic
1067250751 10:44584683-44584705 ATGTGGGAAAAGAGGAGAGGGGG - Intergenic
1067517836 10:46968832-46968854 CAGTGGGAACTGAGAGATGGGGG - Intronic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067644412 10:48082997-48083019 CAGTGGGAACTGAGAGATGGGGG + Intergenic
1067748317 10:48953080-48953102 CAGGGGGAAGTGAGGAGAGGCGG - Intronic
1067851511 10:49757871-49757893 CAGTGGGAACTGAGCAGATGAGG + Intronic
1067991934 10:51224069-51224091 GAGTGGGAAAATAGGAAAAGAGG + Intronic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1068373926 10:56154847-56154869 AAGAGGGAAGAGAGGAAAAGAGG - Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068927933 10:62559256-62559278 CTGTGGGAACACAGCATAGGGGG - Intronic
1069621453 10:69840039-69840061 CAGTGGTGACAGAGGAAATGGGG + Intronic
1069627988 10:69880203-69880225 CAGTGAGAACACAGGACATGGGG - Intronic
1069628009 10:69880296-69880318 CAGAGGGCACAGGGGCAAGGAGG - Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070776668 10:79113776-79113798 GAGGGGGCTCAGAGGAAAGGGGG - Intronic
1072152763 10:92696445-92696467 GAGGGGGAACAGAGGAACGAGGG + Intergenic
1072867985 10:99084824-99084846 CAGTGGTAACAGGGGCAAGTTGG - Intronic
1073074631 10:100816041-100816063 CAGAGGGAAGAGATGAAGGGAGG - Intronic
1073275964 10:102311692-102311714 GAGTGGGAACAGAAGAAATTAGG - Intronic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1074539487 10:114352802-114352824 CTGTCGGAGCAGTGGAAAGGGGG - Intronic
1074547070 10:114409318-114409340 CTGGGGCAAGAGAGGAAAGGGGG - Intergenic
1074619006 10:115098290-115098312 CAGTCAGGGCAGAGGAAAGGAGG - Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075372574 10:121950382-121950404 GAGTTGGGACAGAGGCAAGGTGG + Intergenic
1075742542 10:124704628-124704650 CAGTGGGGACCGAGCAGAGGGGG + Intronic
1076013814 10:127012014-127012036 GAGAGGGAACAGAGCAAATGAGG - Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076378313 10:130007464-130007486 CAGGAGGAAGAGAGCAAAGGGGG - Intergenic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1078697025 11:13644585-13644607 CAGGAGGAAGAGGGGAAAGGGGG + Intergenic
1078867165 11:15308544-15308566 CAGAGGGAAAGGAGAAAAGGTGG - Intergenic
1078942203 11:16020121-16020143 CAATGTGAACACAGGAAAGGAGG - Intronic
1079035037 11:17013893-17013915 CGGCGGGAGCAGAGGAAGGGCGG + Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079141859 11:17816262-17816284 TAATGGGAACTGAGGAAAGAGGG - Intronic
1079569283 11:21922495-21922517 AAGTGGGAAAAAAGGAAATGAGG + Intergenic
1080336464 11:31203044-31203066 GGGTGAGCACAGAGGAAAGGAGG + Intronic
1081230251 11:40577527-40577549 TAGTGAAAACAGAGGAAAAGGGG + Intronic
1081541394 11:44037084-44037106 CAGTGGGAGATGGGGAAAGGAGG - Intergenic
1082053857 11:47796520-47796542 AAGGGGGAAGAAAGGAAAGGAGG + Intronic
1082108372 11:48244648-48244670 CAGTGGAAACAGATTAGAGGAGG - Intergenic
1082771034 11:57207520-57207542 GATTGGGGACAGAGGAAAAGGGG - Intergenic
1082775377 11:57240755-57240777 CAGTGGGAACAGCTGAGGGGAGG - Intergenic
1083330536 11:61896388-61896410 CAGATGGAAGAGAGGAAAGCAGG - Intergenic
1084020301 11:66413362-66413384 CAGCTGGAAGAGAGGCAAGGGGG + Intergenic
1084369652 11:68732203-68732225 GCATTGGAACAGAGGAAAGGAGG - Intronic
1084389508 11:68865869-68865891 CAGAGGGAAGGTAGGAAAGGAGG - Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085265937 11:75238105-75238127 AAGTGGGAAGAGAGGAGAGGAGG + Intergenic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1085939234 11:81188337-81188359 AAGTGGGAAAAGAGGAAAAAAGG + Intergenic
1085961921 11:81470852-81470874 GAGTTGGAGGAGAGGAAAGGGGG + Intergenic
1086160769 11:83719565-83719587 CAGTGAGAAAAGAGGCAAGGTGG + Intronic
1086265368 11:84991587-84991609 AAGAGGGAACAGAGGAAAGTGGG + Intronic
1086546425 11:87972969-87972991 CAGAAGGAAGAGAGGAAAGGGGG - Intergenic
1086799264 11:91151755-91151777 CAGAAGGAATAGAGTAAAGGGGG + Intergenic
1087195811 11:95303292-95303314 CAGTGAGCACAGAAGACAGGAGG + Intergenic
1087645154 11:100800331-100800353 CACTGGGAACAGAGGGGAGTTGG + Intronic
1087884476 11:103462141-103462163 CAGTGGTAATAAATGAAAGGTGG - Intronic
1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG + Intergenic
1088311766 11:108467586-108467608 GAGCGCGAATAGAGGAAAGGCGG - Intergenic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1088762468 11:112945288-112945310 CAGAAAGAACTGAGGAAAGGTGG + Intergenic
1088841311 11:113629814-113629836 TAGCCGGAACAGAGGACAGGAGG + Intergenic
1089098893 11:115943576-115943598 TGGTGGCAAAAGAGGAAAGGGGG - Intergenic
1089133031 11:116226964-116226986 CAGTGGGAAAGGAGGAGGGGCGG + Intergenic
1089261763 11:117228481-117228503 AGGTGGGAACAGAGTCAAGGAGG + Intronic
1089736047 11:120550812-120550834 GAGTGGGAGGAGAGGAACGGAGG + Intronic
1090024968 11:123159674-123159696 CAGGGGGCACACAGGAAGGGTGG + Intronic
1090244010 11:125202865-125202887 CTGGGGGTAGAGAGGAAAGGTGG - Intronic
1090900535 11:131026959-131026981 AAGTGGGAACTGAAGAAAGCTGG + Intergenic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1092736158 12:11585027-11585049 CAATGGGGACAGAGGCAGGGAGG + Intergenic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1093322715 12:17734017-17734039 CAGTGGTAGCAGAGAAGAGGAGG - Intergenic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1094239950 12:28211196-28211218 CAGTTTGAACAGAGAAAAAGAGG + Intronic
1094250092 12:28349826-28349848 CAGTTGTAACAGAGGAATGAGGG - Intronic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1096594750 12:52687764-52687786 CCGTGGGACCACAGGAAGGGTGG - Intergenic
1096639157 12:52980406-52980428 GTATGGGAACAGAGGAAGGGAGG + Intergenic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1099685014 12:85874142-85874164 CAGGGGGGACAAAGGAAAAGGGG + Intergenic
1099974116 12:89528588-89528610 CAGGAGGAAGAGAGCAAAGGGGG - Intergenic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100679644 12:96905662-96905684 CAGTGAGGACAGAGGAATGGAGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100828461 12:98496456-98496478 TTGTAGGAACAGAGGAAATGTGG - Intronic
1101012731 12:100467670-100467692 CAGTGGGGACAGAGGCCAGTTGG + Intergenic
1101063405 12:100995099-100995121 CTATGGGAACAGAGAAAAAGAGG + Intronic
1101073885 12:101107875-101107897 AAGTGGGGACAGTGGAGAGGAGG + Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1102652512 12:114452070-114452092 TAGTGGGAAGAGAGAAGAGGTGG - Intergenic
1103214909 12:119194511-119194533 CACAGGGGACAGAAGAAAGGGGG - Exonic
1103562809 12:121800887-121800909 CCGGGGGGACGGAGGAAAGGAGG + Intronic
1103796402 12:123506173-123506195 CAGAGGCCACAGAGGAAAGGAGG + Intronic
1104280826 12:127374752-127374774 AACTGGGAACAGAGGAAGGGAGG - Intergenic
1104622949 12:130331926-130331948 TGGAGGGAAAAGAGGAAAGGAGG + Intergenic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1105209596 13:18249992-18250014 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1105285021 13:18996421-18996443 AAGGAGGAACACAGGAAAGGGGG + Intergenic
1105422583 13:20266194-20266216 CAGGAGGAACAGAGGAGCGGAGG + Intergenic
1105422709 13:20266919-20266941 CAGGAGGAACAGAGGAGCGGAGG + Intergenic
1105707588 13:22977608-22977630 CAGTGGGCACAGTGAAAAGCTGG + Intergenic
1105760814 13:23512662-23512684 TGGTGAGCACAGAGGAAAGGCGG - Intergenic
1106142064 13:27019882-27019904 CAGAGAGAAAAGAGGAAAGTTGG + Intergenic
1106356043 13:28984332-28984354 CAGAAGGAAGAAAGGAAAGGAGG - Intronic
1106634941 13:31518594-31518616 CAGTGGAATCTGAGGAAAGCTGG + Intergenic
1107912707 13:45120501-45120523 CACTGGGAACCGAGGAAAAGAGG - Exonic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108669577 13:52670989-52671011 AAGTGGGAGAAGAGAAAAGGAGG - Intronic
1110920263 13:81075416-81075438 TAGTGGGAAAAGAGGAGATGTGG - Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1111504781 13:89173548-89173570 TAATTGGAGCAGAGGAAAGGTGG - Intergenic
1111586690 13:90291392-90291414 CTGTGTGAACAGTGGAACGGGGG + Intergenic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112067209 13:95806002-95806024 CAGAGAGAACAGAGATAAGGGGG + Intronic
1112707287 13:102085105-102085127 CAAAGGGGGCAGAGGAAAGGTGG - Intronic
1113510401 13:110849975-110849997 GATTGGGAACAGAGGAGTGGGGG - Intergenic
1113606334 13:111610244-111610266 CAGGAGGAAGAGAGCAAAGGGGG - Intronic
1113802314 13:113093017-113093039 CAGTGGGAACAAAAAAAGGGGGG - Intronic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1114326763 14:21596911-21596933 CTGAGGAAACAGAGCAAAGGTGG + Intergenic
1114373631 14:22118565-22118587 GAGTGGCATCAGAGAAAAGGAGG - Intergenic
1114635400 14:24184240-24184262 CAGTGGGAAGACAGGAGGGGAGG + Intronic
1115664668 14:35534214-35534236 CTCTGGGACAAGAGGAAAGGGGG - Exonic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116970365 14:51058555-51058577 CAGTGGGAACAGATGACGGGAGG - Intronic
1117268192 14:54113092-54113114 CAGGAGGAAGAGAGGAAAGGGGG - Intergenic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1119517592 14:75260401-75260423 CAGAGGAGATAGAGGAAAGGAGG - Intronic
1119552667 14:75526224-75526246 CAGAGTGAAGAGAGGTAAGGTGG - Intronic
1120035412 14:79691356-79691378 CAGGAGGGAGAGAGGAAAGGAGG + Intronic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121120392 14:91372415-91372437 CACTGGGAGCAGAGGAGAGCGGG + Intronic
1121797087 14:96744184-96744206 CTGTGGGAAGAGAAGTAAGGAGG + Intergenic
1123910600 15:24963079-24963101 TAGTGGGGAGAGAGGAAGGGAGG + Intronic
1124027676 15:25981961-25981983 CAATGGGACCCGAGCAAAGGGGG - Intergenic
1124133775 15:27015343-27015365 GAGCGGCAAGAGAGGAAAGGAGG - Intronic
1124140280 15:27071304-27071326 CAGAGGGAAGAGAGGAGAAGGGG - Intronic
1124715592 15:32058180-32058202 CAGAGGGAAAGGAGGCAAGGAGG - Intronic
1124906997 15:33878780-33878802 CAGTAGGAAAATAGGAAAAGGGG + Intronic
1124998965 15:34752313-34752335 CAATGGGAAAGGAGGAAAAGTGG - Exonic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125588642 15:40840343-40840365 CAGTGGGAACAGACAAGAGATGG + Intergenic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126989264 15:54353725-54353747 CAGTGAGGTCAGAGGAAAGCTGG - Intronic
1127455007 15:59149004-59149026 TAGTGAGATCAGAGCAAAGGTGG + Intronic
1127655448 15:61051275-61051297 GAGTGGGAACAGCAGAAAGTAGG + Intronic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128341839 15:66827712-66827734 CAAGGAGAACAGAGGAAAGAAGG - Intergenic
1128348100 15:66867492-66867514 CAGTTGGAGCACAGGAAAGATGG + Intergenic
1128574132 15:68758703-68758725 GGGTGGGAACAGAGGAATTGGGG + Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129228096 15:74181419-74181441 GAGGGGGAAGAGAAGAAAGGTGG + Exonic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129532314 15:76278299-76278321 CAGTGGGGTCAGAGGAATGTTGG - Intronic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130282961 15:82533291-82533313 GAGTGGGCAAAGAGGCAAGGAGG + Intergenic
1130359275 15:83166775-83166797 CAGGAGGAAGAGAGAAAAGGGGG + Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1130742448 15:86615392-86615414 CAGTGGGATCTGGGGTAAGGAGG + Intronic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132588566 16:716523-716545 AAGTGGGGGCAGAGGAAGGGTGG - Intronic
1132629257 16:908914-908936 CAGAGGGCAGAGAGGAAAGCTGG + Intronic
1133042090 16:3066196-3066218 CGGAGGGAACCCAGGAAAGGAGG - Intronic
1134131040 16:11650496-11650518 CAGTGGGATCAGAGGCCAGCTGG + Intergenic
1135222777 16:20627247-20627269 CACTGGGGACAGAGGTAAGATGG - Exonic
1135256322 16:20944419-20944441 CAGTGGGCACACAGGATTGGAGG - Intronic
1135471252 16:22733182-22733204 GAGAGGGCACAGTGGAAAGGGGG - Intergenic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1136071170 16:27788182-27788204 GAGTGGGAGAAGAGGAAAGTTGG - Exonic
1136145265 16:28312697-28312719 CTGTTGGAACAGGGGCAAGGAGG + Intronic
1136296519 16:29307159-29307181 CTGTGGGGACTGAGGAAATGAGG + Intergenic
1136402440 16:30025881-30025903 CAGAGGGGAAAGAGGAAGGGCGG - Intronic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137534013 16:49303689-49303711 AAGTAGGAACAGAGTAAAGAAGG + Intergenic
1137582058 16:49639583-49639605 CAGTGGGAACAAAGAAAACAAGG - Intronic
1137697797 16:50473872-50473894 CAGTGGAGACAGAGGTTAGGAGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138067144 16:53954168-53954190 CAAGGGGAAAAGGGGAAAGGTGG + Intronic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138345008 16:56315399-56315421 CACTGGGCTCAGGGGAAAGGAGG + Intronic
1138465175 16:57185240-57185262 CAGTCCACACAGAGGAAAGGGGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138706824 16:58923600-58923622 CAGCAGGATCAGAAGAAAGGGGG + Intergenic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1139329486 16:66176350-66176372 CAGGGGGCACAGAGGACAGCAGG - Intergenic
1139352084 16:66343135-66343157 GAGTGGGAACCCAGGAACGGTGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140829972 16:78741992-78742014 GGGTGGGAAGAGAGGATAGGAGG - Intronic
1140882414 16:79210912-79210934 CAATGGGACCACAGGTAAGGGGG - Intronic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141774568 16:86114233-86114255 AAGAGGGAAAAGAGGAAGGGTGG + Intergenic
1141882182 16:86867413-86867435 GAGTGGGAGCAGTGGAAATGAGG - Intergenic
1142428203 16:90011783-90011805 CAGAGGGCACAGGGGACAGGGGG + Intronic
1142490581 17:276076-276098 CAGTTGGTACAGAGGAAATCGGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142803917 17:2361826-2361848 AAGTGGGAAGAGCTGAAAGGAGG - Intronic
1142945548 17:3423395-3423417 CAGGTGGAACACAGGAAAGGAGG - Intergenic
1143003888 17:3814264-3814286 CAGTGAGAGCAGAGGACAGTGGG - Intronic
1143196392 17:5079062-5079084 GAGGGAGAAGAGAGGAAAGGAGG + Intronic
1143412025 17:6714666-6714688 CCCTGGGGACACAGGAAAGGCGG - Intergenic
1143478341 17:7215529-7215551 CAGCGGGAGCAGAGGAAACCAGG + Intronic
1144005383 17:11094892-11094914 CAGTGGGAGCAGAGCAGGGGAGG - Intergenic
1144202775 17:12956227-12956249 CATTGGGATGAGGGGAAAGGAGG + Intronic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144588542 17:16504121-16504143 ATGTGGAAACAGAGGAAATGTGG - Intergenic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145995895 17:29104770-29104792 GAGTGAGAACAGAGTCAAGGGGG + Intronic
1146582947 17:34055918-34055940 CATTGGGAATAGAGTAGAGGGGG + Intronic
1147497099 17:40927055-40927077 CAGTGAGCAAAGAGGTAAGGAGG - Intronic
1147650184 17:42057601-42057623 CATTGGGAGGAGAGGCAAGGGGG + Intronic
1147962063 17:44173820-44173842 AAGTGGGAAGAGAGGTATGGGGG + Intronic
1148107109 17:45124571-45124593 CAGGGCCAACAGAGGTAAGGAGG + Intronic
1148341284 17:46875043-46875065 AAGGGGGAAGAGAGGAAAGGAGG - Intronic
1148513994 17:48198856-48198878 AAGTGGCAACAGAGCAAAGTGGG + Intronic
1148568493 17:48647593-48647615 CACAGGGAACAGAAGAAAGGAGG - Intergenic
1148769325 17:50057704-50057726 CAGTGGGGTCAGAGGCCAGGTGG - Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1150042731 17:61880807-61880829 AAGGGGGAAAGGAGGAAAGGGGG + Intronic
1151138135 17:71967159-71967181 CAGAGGGAGCAGAGGAGAGTGGG + Intergenic
1151172008 17:72254648-72254670 CAGGAGGAAGAGAGCAAAGGGGG - Intergenic
1151842788 17:76629533-76629555 CACCGGAGACAGAGGAAAGGAGG - Exonic
1152795630 17:82304712-82304734 CATGGGGAAGAGAGGAAGGGAGG - Intergenic
1152807603 17:82363879-82363901 TGGTGGGAACAGAGGATAGAAGG + Intergenic
1152825285 17:82460868-82460890 CATTGGGAACAAAGAAAACGTGG + Intronic
1153051761 18:907495-907517 GGGTGGGAGCAGAGGTAAGGAGG - Intronic
1153248423 18:3096119-3096141 CAGTGGGCACGGAGCAAATGTGG + Intronic
1153300966 18:3591738-3591760 CATTTGGAAAAGAAGAAAGGGGG + Intronic
1153466528 18:5394573-5394595 GTGAGAGAACAGAGGAAAGGAGG + Intronic
1153624247 18:7008165-7008187 CACTGGGGAGAGAGGAAATGGGG + Intronic
1154063414 18:11084522-11084544 CCGTGGGAGGTGAGGAAAGGGGG - Intronic
1155047508 18:22115759-22115781 GAGGGAGAAGAGAGGAAAGGAGG + Intergenic
1155424220 18:25689457-25689479 AAGGGGGAAGAGAGGAAAGCAGG + Intergenic
1155429303 18:25738712-25738734 CAGTAGGAAAAGGGCAAAGGAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1156781373 18:40854475-40854497 AAGTAGGTACAGAGGCAAGGTGG - Intergenic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157056775 18:44238702-44238724 GAGTGGGATCAGAGGAATGCTGG + Intergenic
1157065525 18:44345018-44345040 CACTGGCAACAGAGGAATGTTGG - Intergenic
1157505417 18:48222844-48222866 CATTGGGTACAGAGCATAGGAGG - Intronic
1157551090 18:48582328-48582350 CCGTGGGAACAGAGAAGAAGGGG + Intronic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1158410779 18:57203966-57203988 CAGTGGAAAGAGAGATAAGGGGG + Intergenic
1160089193 18:75810009-75810031 CAGTCAAAGCAGAGGAAAGGCGG - Intergenic
1160306763 18:77747403-77747425 CAGTGGGGACAGCAGAAAGCAGG - Intergenic
1160373582 18:78394104-78394126 GAGTAGGAACAGCAGAAAGGAGG + Intergenic
1160878741 19:1310088-1310110 CAATGGGATCACAGGGAAGGCGG - Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161711574 19:5851462-5851484 AAGTGGGAACAGAGAAGAGGAGG + Exonic
1162187927 19:8921843-8921865 CAGGGGGAAGAGGGGACAGGGGG - Intronic
1162777239 19:12987340-12987362 CTGTGGGAACAGAGGAGGAGAGG + Intergenic
1163130728 19:15271203-15271225 CAGTGGGAACTGAAGCAGGGAGG - Intronic
1163169229 19:15519163-15519185 ATGTGGGCACAGAGGAAAGGGGG + Intronic
1163771741 19:19195279-19195301 GAGTGGGGAGAGGGGAAAGGAGG - Intronic
1164024244 19:21336104-21336126 AAGGGAGAACAAAGGAAAGGAGG + Intergenic
1164234908 19:23323397-23323419 AAGTAGGAACAAAGAAAAGGAGG - Intronic
1164484704 19:28645003-28645025 TAGTGGGAAAAGAGGAAACAAGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166562826 19:43744707-43744729 CACTGGGAGCAGGGGCAAGGTGG - Intronic
1167312912 19:48747367-48747389 CAGTGGGAGGAGAGGACTGGGGG + Intergenic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1168701449 19:58442011-58442033 CAGAGGGAACAATGGAAAGGCGG - Intergenic
925004675 2:432362-432384 CAGAGGCAATAGAGGAAATGTGG + Intergenic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
925718495 2:6806740-6806762 CAGTGGGGACAGAGGATGGGAGG + Intergenic
925786510 2:7436370-7436392 CCGTGGGAACATGGGAAAGAAGG - Intergenic
926411907 2:12613468-12613490 AAGTAAGAACAGGGGAAAGGGGG + Intergenic
926611214 2:14950159-14950181 CAGGGGGAAGAGTGGAAGGGAGG - Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
927241122 2:20920246-20920268 CAGTGGGAACAAAGGCATAGAGG + Intergenic
927667952 2:25045141-25045163 GAGTTGGCAGAGAGGAAAGGAGG - Intronic
927704197 2:25286882-25286904 CTGTGGAGACAGGGGAAAGGAGG - Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929087113 2:38179281-38179303 CAGTGAGGTCAGAGGAAAAGGGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930226168 2:48795877-48795899 CAGTGGGCACAGGATAAAGGAGG - Intergenic
930543035 2:52731502-52731524 AAGTGCGAAGAGATGAAAGGCGG + Intergenic
931076405 2:58718328-58718350 CATTGTGAAAAGAGGAAAAGGGG + Intergenic
931445742 2:62325750-62325772 AAGGGAGAACAAAGGAAAGGAGG + Intergenic
932417807 2:71584263-71584285 GAGTGGGAGCAGAGGCAAAGCGG + Intronic
932741781 2:74296356-74296378 AAGTGAGAAAAGAGAAAAGGAGG - Intronic
933837793 2:86259851-86259873 AAGTGGGAAGAGGGGAATGGGGG + Intronic
933884203 2:86702668-86702690 CAGTGTGAACAGACAAAATGAGG + Intronic
934641478 2:96029664-96029686 CAGTGGGAACAGGGGCAGTGAGG - Intronic
934655113 2:96113289-96113311 CAGTTGGAAGTGTGGAAAGGAGG - Exonic
934761014 2:96857307-96857329 CAATAGGAACAGAGGAAGGCGGG - Intronic
934776748 2:96943772-96943794 CAGTGGGAACAAAGACGAGGTGG - Intronic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
935487838 2:103679813-103679835 CAATGGGAATATTGGAAAGGAGG + Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937290754 2:120780402-120780424 CAGTGTGAAAGGAGGAAGGGAGG + Intronic
939355969 2:141102407-141102429 CACTGGGAACAGAGCAAATTAGG + Intronic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940448129 2:153802895-153802917 TAGTGGCAACAGAGGAAGAGAGG + Intergenic
941231373 2:162915923-162915945 GAGTTGGAGGAGAGGAAAGGGGG - Intergenic
941264263 2:163340290-163340312 CAGTGGGAAAAGTGGAAAAGTGG + Intergenic
942022335 2:171878645-171878667 CAGTTGGAACAAAGTAATGGAGG - Intronic
942548336 2:177088643-177088665 CAGTGGTAACAGTGAAAATGAGG - Intergenic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942730405 2:179055939-179055961 CATTGGGAACAGAGACTAGGGGG + Intergenic
942828553 2:180210517-180210539 TAGTGGGAAGAGAGAAAAGTAGG + Intergenic
943157997 2:184209335-184209357 GAATGAGAACAGAGGGAAGGAGG - Intergenic
944003968 2:194878799-194878821 CAATGAGAGCAGAGTAAAGGGGG - Intergenic
945739944 2:213647101-213647123 GAGAGGGAACAGAGGAAATGAGG + Intronic
946138514 2:217667991-217668013 AAGTGGGAAAAGAGGAAGGTGGG + Intronic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946716606 2:222559821-222559843 CACTGTGAAGAGATGAAAGGTGG + Exonic
946953705 2:224905782-224905804 GAGTGGGCAGAGAGGAAAGCGGG - Intronic
947030182 2:225783430-225783452 AAGGGGGAAGGGAGGAAAGGGGG - Intergenic
947512284 2:230767358-230767380 CAGTGGGAACAAGGAAAATGGGG - Intronic
947536634 2:230943784-230943806 GAGTGGGAGCAGAGGAGGGGTGG - Intronic
948515355 2:238500047-238500069 CACTTAGAACAGAGGAAAAGAGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948795973 2:240402268-240402290 CAATGGCAACGGAGGAAAGGGGG - Intergenic
948874031 2:240818035-240818057 CAGTGGGGAAGGGGGAAAGGAGG + Intronic
948920491 2:241063925-241063947 CAGCGGGAAGAAGGGAAAGGAGG - Intronic
1168737101 20:149875-149897 CAGTGAGGATAGAGGATAGGAGG + Intergenic
1168833989 20:864779-864801 CAGTGGGATCCTGGGAAAGGTGG + Intergenic
1169745817 20:8941655-8941677 CAGTAGGAACAAATGCAAGGTGG + Intronic
1169794956 20:9452024-9452046 CAGTGGGAACAAAGGCTAGGTGG - Intronic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1170497541 20:16940812-16940834 CAGTGGGAGAAGAGGAGACGTGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1170987519 20:21272131-21272153 AAGTGACCACAGAGGAAAGGAGG - Intergenic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1171302901 20:24079184-24079206 CAGCGGGAGAAGAGGCAAGGAGG + Intergenic
1171327739 20:24310581-24310603 CAGGGGAAACTGAGGAAAGGGGG - Intergenic
1171950342 20:31415819-31415841 CAGTGTGAACTGAGGAGTGGTGG + Intergenic
1173094824 20:40015409-40015431 CAGTCTGAACAGATGAAAGGGGG + Intergenic
1173456062 20:43202477-43202499 CAGTGGCAAGACAAGAAAGGAGG - Intergenic
1175279520 20:57793812-57793834 CAGTGAGAACTGAAGAGAGGCGG + Intergenic
1175504613 20:59472741-59472763 CAGTGGGAAGTGGGGTAAGGGGG + Intergenic
1175717151 20:61262801-61262823 GAGAGGGAAGAGAGGAAAGGAGG - Intronic
1176184234 20:63769382-63769404 CCCTGGGAACACAGGAAAGGAGG + Intronic
1176382698 21:6121121-6121143 CTGTGGGAACAGAGGACAGGTGG - Intronic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177772911 21:25536927-25536949 CAGAGGGAAAAGAGGAAGTGTGG + Intergenic
1178147868 21:29760314-29760336 AAGTGGCAAGAGAGTAAAGGTGG + Intronic
1178757945 21:35370660-35370682 CAGGGGGAACCCATGAAAGGAGG + Intronic
1178824654 21:36005007-36005029 CAGGGGGGGCAGGGGAAAGGGGG + Intergenic
1178870068 21:36366179-36366201 CAGTGGGGAGAGAGGAAGGGAGG - Intronic
1178939617 21:36894130-36894152 CAGGAGGAAGAGAGCAAAGGGGG - Intronic
1179049799 21:37879439-37879461 CAGTGGGCAGAGTGGTAAGGGGG + Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179619721 21:42605479-42605501 AAGGGAGAACAAAGGAAAGGAGG + Intergenic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1179740771 21:43417118-43417140 CTGTGGGAACAGAGGACAGGTGG + Intronic
1179945680 21:44672845-44672867 CAGGAGGAAGAGAGAAAAGGGGG - Intronic
1180612229 22:17105565-17105587 CAATGAGAACAGAGGAAAAAGGG - Intronic
1180766668 22:18349407-18349429 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1180779645 22:18512971-18512993 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1180812361 22:18770292-18770314 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181198520 22:21204539-21204561 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181401218 22:22651261-22651283 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1181648312 22:24245630-24245652 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181703183 22:24632341-24632363 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1181881246 22:25982049-25982071 CAGGAGGAAGAGAGAAAAGGGGG + Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182568994 22:31222025-31222047 AAGTGGGAAGTGAGGAAATGAGG + Intronic
1182760859 22:32721273-32721295 GGGTGGGCACAGAGGAAAGAGGG + Intronic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183440823 22:37822313-37822335 CAGAGGGGGCAGAGGAGAGGAGG + Intergenic
1183832392 22:40425230-40425252 AGATGGGAACAGAGGCAAGGAGG + Intronic
1184240872 22:43210680-43210702 CAGTGGGAACTGATGAACGATGG + Intronic
1185032434 22:48451488-48451510 TAGTGGGAACAGCGGAAACAGGG + Intergenic
1203228285 22_KI270731v1_random:90298-90320 CAGTCTGCACAGAGGACAGGGGG - Intergenic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
950041212 3:9920626-9920648 CAGAGGGGACAGAGGCTAGGGGG - Intronic
950204484 3:11068228-11068250 GAGTGGGTGCAGAGGTAAGGAGG - Intergenic
950844760 3:16003886-16003908 CATTGGAAACAGAGGAAGTGGGG + Intergenic
951942662 3:28097619-28097641 CAATAGTAAAAGAGGAAAGGAGG - Intergenic
952161754 3:30700848-30700870 CAGTTGGAACAAAGGGGAGGGGG + Intergenic
952609957 3:35196709-35196731 AAGAAGAAACAGAGGAAAGGAGG - Intergenic
953434243 3:42865951-42865973 AAGTAGGAAGGGAGGAAAGGAGG - Exonic
953621300 3:44535205-44535227 GAGAGGCAACAAAGGAAAGGAGG - Intergenic
953701143 3:45196731-45196753 TAGTGGAGACAGAAGAAAGGAGG + Intergenic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
954174625 3:48834265-48834287 CAGTGTGAACCAAGCAAAGGAGG + Intronic
955074867 3:55603997-55604019 CAGTGGGAACTGAATAAACGTGG - Intronic
955827807 3:62966751-62966773 CAGAAGGAAGAGAGCAAAGGGGG + Intergenic
955962637 3:64356600-64356622 AAGGGGGAATAGGGGAAAGGAGG + Intronic
955995250 3:64673992-64674014 AAGTGGGAACAAATGAAAGAAGG + Intronic
955995599 3:64677434-64677456 CATTGGGTACAGAGGAAACAAGG + Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956129381 3:66039344-66039366 CAGTGGGACCTGCGGCAAGGGGG - Intergenic
956192711 3:66622488-66622510 CAGAGAGAGCAGAGGAAAGTGGG - Intergenic
956687527 3:71844058-71844080 GTGAGAGAACAGAGGAAAGGAGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958678361 3:97294215-97294237 CAGTGGGGGCTGAGAAAAGGTGG - Intronic
960564000 3:119114970-119114992 CAGGAGGAAGAGAGTAAAGGGGG + Intronic
960598545 3:119431337-119431359 AAGTGGAAACACAGGAAAAGTGG + Exonic
961134084 3:124494169-124494191 AGGTGGGAGCAGAGAAAAGGTGG - Intronic
961160709 3:124722335-124722357 AAGTGAGAAGACAGGAAAGGAGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961806543 3:129493340-129493362 CAGTGGGCACAGAGCTGAGGAGG + Intronic
962006355 3:131353794-131353816 CAGTGGGCTCAGAGTAAAGGAGG + Intergenic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962207216 3:133444866-133444888 CTGTGGGAAGAGAGGATTGGAGG - Intronic
962386740 3:134938000-134938022 AAATGGGAAAGGAGGAAAGGGGG + Intronic
962853577 3:139325675-139325697 CAGTGGAAACAGGTGCAAGGAGG + Intronic
963065879 3:141264169-141264191 CAGTGGGAAAAGAGGAAAAGAGG + Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963352860 3:144174061-144174083 CAGTGGGAGTTGAAGAAAGGTGG + Intergenic
963661809 3:148135825-148135847 CAGAAGGCACAGAGTAAAGGAGG + Intergenic
965057275 3:163737714-163737736 CAGTGGAAACAGAGAACTGGAGG + Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965379760 3:167973943-167973965 CAGTGGGAGCAGAGGATGAGTGG - Intergenic
965585511 3:170314372-170314394 CAGTGTGCACAGGAGAAAGGAGG - Intergenic
966473101 3:180314398-180314420 AAGTGGGAAGAGAGGAAGGTGGG - Intergenic
968652546 4:1766003-1766025 CCGTGGGCACAGGGGACAGGAGG + Intergenic
968724186 4:2234512-2234534 GATGGAGAACAGAGGAAAGGTGG - Intronic
968772217 4:2514691-2514713 CAGTGGGAACTGAGGACTGGAGG - Exonic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969481452 4:7448983-7449005 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
969481512 4:7449132-7449154 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
969481519 4:7449157-7449179 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
970344284 4:15138064-15138086 CAGGAGGAAGAGAGCAAAGGTGG - Intergenic
970449059 4:16149053-16149075 CAAAGGGTACAGAGGAAAGAGGG - Intergenic
970455461 4:16219325-16219347 CAGTGGGAGCACAGGTAAAGGGG - Intronic
970635696 4:18007033-18007055 TAGTGGAAACAGAGAAGAGGGGG - Intronic
970699011 4:18712687-18712709 CAGCTAGGACAGAGGAAAGGAGG + Intergenic
971129021 4:23785413-23785435 AAGTGGGAAAGAAGGAAAGGTGG - Intronic
971617289 4:28808160-28808182 CAGTAGTTACAGAAGAAAGGAGG + Intergenic
971681048 4:29701148-29701170 CAGCAGGAAGAGAGCAAAGGGGG - Intergenic
972110233 4:35549108-35549130 CAGAGGGATCAGAGCAAAAGGGG + Intergenic
972736669 4:41848731-41848753 TAGTGGAAACAGAGGATAGGAGG + Intergenic
972950962 4:44321757-44321779 CAGAGGCTACAAAGGAAAGGAGG - Intronic
975093153 4:70426479-70426501 CAGGAGGAAGAGAGCAAAGGGGG - Intergenic
975457871 4:74614102-74614124 CAGTGAGTACAGATCAAAGGTGG - Intergenic
975517937 4:75267599-75267621 CAGGAGGAAGAGAGAAAAGGGGG - Intergenic
975558323 4:75686383-75686405 CAGTGAGAACAGAGGAAATGGGG + Intronic
975599363 4:76083233-76083255 GAGTGGAAATTGAGGAAAGGTGG - Intronic
975804696 4:78099667-78099689 CAGTGAGAACATAGTAAAGTGGG + Intronic
975991060 4:80260953-80260975 AAGTGGGAATAGAGGATGGGGGG - Intergenic
976636638 4:87293001-87293023 CAGTTGGAAAAGAGGCAAGCAGG + Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
978345006 4:107757419-107757441 CAGGAGGAAGAGAGCAAAGGGGG - Intergenic
978740820 4:112136090-112136112 CAGAGGCAAAAGAGAAAAGGCGG - Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
978965391 4:114734729-114734751 CAGTGGGAACAGATGGTGGGAGG + Intergenic
978973857 4:114844512-114844534 GAGTGAGAATAGAAGAAAGGTGG - Intronic
979567491 4:122171422-122171444 AATTGGAAACAGAGGAAATGAGG + Intronic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980089150 4:128423718-128423740 GTGTGGGAACAGTGGAATGGGGG + Intergenic
981076971 4:140601943-140601965 CACAGGGAACAAAGGAAAGCAGG + Intergenic
982343609 4:154331945-154331967 CAGGGGAACCAGAGGAAAAGGGG - Intronic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
984179564 4:176464958-176464980 AAGAGGGAACAGAGAAAAGAGGG - Intergenic
984511067 4:180679353-180679375 CGGAGGGAACAGAGTAAAGCTGG + Intergenic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
985370985 4:189284884-189284906 CAGTAAGAACTTAGGAAAGGAGG - Intergenic
985907700 5:2853794-2853816 CAGCAGGAACAGAGGAGAGCAGG + Intergenic
986383950 5:7212734-7212756 CAGTATGAAGAGAGGAACGGAGG - Intergenic
986547482 5:8914345-8914367 CAGTAGGAAGAGAGCAAAGTGGG + Intergenic
987297728 5:16568687-16568709 AAGGGGGAACAGGGGAAAGGGGG + Intronic
987799226 5:22671769-22671791 CAAAGGGAACAGTGGAAAAGTGG + Intronic
987909088 5:24118183-24118205 GAATGGGGAAAGAGGAAAGGTGG - Intronic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988786572 5:34570727-34570749 CAGTGGGAAGAGAGGAAGGGCGG + Intergenic
989180474 5:38571568-38571590 CAGTAGGAGCAAAGGAGAGGAGG - Intronic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989641831 5:43590305-43590327 CAGTAGGAACAGGGCAGAGGAGG + Intergenic
989770606 5:45140179-45140201 CAAGAGGAAGAGAGGAAAGGGGG - Intergenic
990236910 5:53778531-53778553 CACTGGGCTCAGAGGACAGGTGG + Intergenic
990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG + Intergenic
990851463 5:60209705-60209727 GAGTGGGAGGAGAGGAAAAGAGG + Intronic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
991043433 5:62198190-62198212 CAATGGAAACTCAGGAAAGGTGG - Intergenic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
991970486 5:72136222-72136244 GGGTGGGAATAGAGGAAATGAGG - Intronic
992192237 5:74304557-74304579 CAGTGGAGAAAGAGGAAAGGAGG + Intergenic
992205827 5:74429636-74429658 CAGTGGGTGCAAAGGAATGGGGG - Intergenic
992520825 5:77549127-77549149 CAGGGGGAAAGGGGGAAAGGGGG + Intronic
992541144 5:77765431-77765453 CTCTGGGAACACAGAAAAGGGGG + Intronic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
992778272 5:80106480-80106502 GAAGGGGAACAGAGGAAGGGAGG + Intergenic
993017428 5:82550963-82550985 GAGTGGGAGAAGAGGATAGGTGG - Intergenic
994137370 5:96303157-96303179 CAGGAGGAAGAGAGCAAAGGGGG + Intergenic
994409424 5:99388166-99388188 AAGGGGGAAAAGGGGAAAGGGGG - Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995295251 5:110513091-110513113 CAATGGAAAGACAGGAAAGGAGG + Intronic
995408852 5:111832178-111832200 CAGTAGGTACAGAGGAAAAAAGG + Intronic
995477914 5:112566375-112566397 CAGGAGGAAGAGAGCAAAGGGGG + Intergenic
995645496 5:114306662-114306684 AAGTGTGAACTGATGAAAGGTGG - Intergenic
995737705 5:115320164-115320186 CAGAGGGAAGAGACGAAAGCAGG + Intergenic
997517503 5:134501463-134501485 CTGTGGGGACAGAGGAAAAGAGG + Intergenic
997574568 5:134964309-134964331 CATGGGGAACTGAGGAAGGGAGG - Intronic
997599545 5:135130042-135130064 CATGGGGAACAAAGGGAAGGAGG - Intronic
998026398 5:138819934-138819956 CAGGAGGAAGAGAGCAAAGGGGG - Intronic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998770082 5:145533228-145533250 CATTAGGAACAGAGGAAAATAGG - Intronic
999383325 5:151137111-151137133 CAAATGGATCAGAGGAAAGGAGG + Intronic
999459402 5:151744977-151744999 CAGTGTGAAATGAGGAAAGTTGG + Intronic
999563665 5:152833557-152833579 CAGGGGGAAGAGGGTAAAGGGGG + Intergenic
999624676 5:153507620-153507642 CAGTGGGAAAAGAAGAAAATGGG - Intronic
999719848 5:154391602-154391624 CAATGGGATAAGAGGAAAAGGGG - Intronic
999979657 5:156945600-156945622 CAGTGGGAAGAGAGGAAGTAGGG + Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000706844 5:164523176-164523198 CAGTAGGAACAAAGGCATGGAGG + Intergenic
1001155850 5:169271976-169271998 AAGTGGGTACAGAGGAGAGTAGG + Intronic
1001285311 5:170418744-170418766 CAGTGTGAACAAAGGCTAGGAGG - Intronic
1001338096 5:170817783-170817805 CAGAAGGAAGAGAGAAAAGGGGG - Intergenic
1001436551 5:171703780-171703802 CATGGGGAGCAGAGGAAAAGAGG - Intergenic
1001995710 5:176156013-176156035 CAGCAGGGACAGAGGAAGGGCGG - Intergenic
1002614479 5:180442238-180442260 GAGAGGGAACACAGCAAAGGAGG + Intergenic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1003005602 6:2378185-2378207 AAGAGGGAAGGGAGGAAAGGAGG + Intergenic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1003477583 6:6498366-6498388 GAGTGGGAACAGGGGAGGGGTGG - Intergenic
1003805300 6:9721331-9721353 CAATGGGAACAGGGGAAAATAGG - Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004240430 6:13916388-13916410 CTGAGGCAACAGAGGAAGGGAGG - Intergenic
1005805227 6:29468320-29468342 CTGTGGAGCCAGAGGAAAGGAGG - Intergenic
1005828633 6:29652375-29652397 GCCTGGGAACAGTGGAAAGGAGG + Intergenic
1006050338 6:31337241-31337263 AATGGGGAACAAAGGAAAGGAGG + Intronic
1006423528 6:33949939-33949961 CACTGGGAACAGTGGAGAGTTGG + Intergenic
1007341544 6:41194122-41194144 CAGGAGGGACAGGGGAAAGGAGG - Intronic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008401132 6:51064437-51064459 TAGTTTGAACAGAGGAAAGGTGG - Intergenic
1008906509 6:56683157-56683179 TAGTGGGAAGAGAGAAAATGGGG - Intronic
1010415665 6:75608488-75608510 AAGAGGAAAAAGAGGAAAGGAGG + Intronic
1010490824 6:76475000-76475022 AATTGTCAACAGAGGAAAGGAGG - Intergenic
1011013833 6:82732877-82732899 CAGCAGGAAGAGAGCAAAGGGGG - Intergenic
1011112020 6:83849329-83849351 AAGAGAGAAAAGAGGAAAGGAGG - Intergenic
1011531136 6:88322298-88322320 ATGTGGGAAAAGAGGAGAGGAGG + Intergenic
1011626618 6:89288322-89288344 GAGTGGAAAAGGAGGAAAGGAGG + Intronic
1011970065 6:93211447-93211469 AAGTGGGGAAAGGGGAAAGGGGG + Intergenic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1014246590 6:119077114-119077136 GATTCGGAAGAGAGGAAAGGAGG - Intronic
1015068683 6:129062175-129062197 CACTGGCAACAGAGAAAATGTGG + Intronic
1015471043 6:133606854-133606876 AAATGGGAACTGAGAAAAGGTGG - Intergenic
1015533088 6:134240832-134240854 CAGTGAGGGCAGAGGAAGGGTGG + Intronic
1015769581 6:136754826-136754848 CAGATGGAACAGAGGAAACGGGG + Intronic
1015873233 6:137797998-137798020 CAGGGGGAAGAGAGACAAGGGGG + Intergenic
1016098656 6:140069910-140069932 AACTGGAAACTGAGGAAAGGGGG - Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1017605788 6:156131416-156131438 AAGTGGGGACAGAGGAACGCAGG + Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1018362695 6:163087643-163087665 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018362721 6:163087775-163087797 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018437943 6:163779965-163779987 CAGTGGGAATAAAAGAAAGCTGG + Intergenic
1018445553 6:163854951-163854973 GAGGGGGAAAAGAGGAAGGGAGG + Intergenic
1018595195 6:165471645-165471667 CAGAGGGAAGAAAGGAAAGGAGG - Intronic
1018839419 6:167507829-167507851 AAGAGGGAACAGGGGAAGGGAGG - Intergenic
1018994580 6:168701305-168701327 CAGATGGAACAGGGGAGAGGCGG - Intergenic
1019173235 6:170146524-170146546 CAGTGGGCCCACAGGAACGGTGG + Intergenic
1019254838 7:42815-42837 CAGTAAAAACAGAGAAAAGGTGG + Intergenic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019608193 7:1920688-1920710 CAGTGAGAAGAGAGGACAGGAGG + Intronic
1019853927 7:3585629-3585651 CAGTGGTAACAGAGAACAGAGGG + Intronic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1020435358 7:8156674-8156696 CAGAAGTAAGAGAGGAAAGGAGG + Intronic
1020678163 7:11204352-11204374 CAGTGAGGACAGAGGAGTGGAGG + Intergenic
1020747764 7:12099429-12099451 CGGGAGGAACAGAGCAAAGGGGG - Intergenic
1020915030 7:14182892-14182914 TAGTGGGTACTGAAGAAAGGGGG + Intronic
1021564006 7:21998967-21998989 CAGAGGGAAAAGAGGAAATGGGG + Intergenic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022409973 7:30131909-30131931 CTATGGGAACACAAGAAAGGGGG + Intergenic
1023130457 7:36997740-36997762 CAGTGGTAGGAGAGGAAAAGAGG + Intronic
1023277822 7:38539412-38539434 CAGAGGGAACTGATCAAAGGAGG + Intronic
1023609592 7:41959326-41959348 CACTGGGTGCTGAGGAAAGGTGG + Intergenic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1024794710 7:53007526-53007548 CAGAGGGAGCAGAGAACAGGTGG + Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1026375408 7:69745455-69745477 CAGTGGTAACAGTGCAAAGGAGG - Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1027640380 7:80725976-80725998 CAGAAGGAAAAGAGGAAAAGAGG - Intergenic
1028405270 7:90467319-90467341 CAGTGAAGAGAGAGGAAAGGAGG + Intronic
1028619362 7:92807081-92807103 TAAGGGGAACAGAGGACAGGTGG - Intronic
1028952511 7:96652843-96652865 AAGTGGAAACAAAGAAAAGGGGG - Intronic
1029405305 7:100371435-100371457 GATTGGGATCAGAGGAAAGCAGG + Intronic
1029532106 7:101132258-101132280 TAATGGGAACAGAAGACAGGAGG + Intronic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1030938705 7:115618069-115618091 CAGGGGCAAAAGAGTAAAGGTGG + Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031310885 7:120195624-120195646 CAGTAGGAAAAGAGTAAAGAGGG - Intergenic
1031583605 7:123506551-123506573 CAGGGGGAAGAGAGCAAAGGGGG + Intronic
1032082186 7:128865239-128865261 CAGAGGGCACAGAGGACAAGGGG - Intronic
1032228435 7:130052754-130052776 CAATGGGCAAAGAGGAAAGTGGG + Intergenic
1032539208 7:132689424-132689446 GAATGGGATGAGAGGAAAGGGGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1034121627 7:148633225-148633247 CAGGAGCAATAGAGGAAAGGGGG - Intergenic
1034709416 7:153177705-153177727 CATTAGAAAAAGAGGAAAGGAGG - Intergenic
1035124047 7:156595056-156595078 AAGGGGGAGCACAGGAAAGGAGG - Intergenic
1035201997 7:157273619-157273641 CAGTGGGACCACCAGAAAGGCGG - Intergenic
1035339430 7:158151061-158151083 CAGGGGCAAGAGTGGAAAGGCGG - Intronic
1035444756 7:158932680-158932702 AGTTGGGAACAGAGGAAGGGAGG + Intronic
1035563277 8:624665-624687 CAGGAGGAAGAGAGTAAAGGGGG + Intronic
1035701006 8:1639269-1639291 CAGAAGGAGCAGTGGAAAGGTGG + Intronic
1035824437 8:2629367-2629389 CACTGGGAAAAGAGCAGAGGGGG - Intergenic
1036215759 8:6878442-6878464 TAGTGGGAAAAGAGAAAAGTTGG - Intergenic
1037480226 8:19298241-19298263 CATTGTGATGAGAGGAAAGGAGG + Intergenic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1037974588 8:23200441-23200463 CTGTGGGAACAGAAGAAGGCAGG + Intronic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038849159 8:31257448-31257470 CAGTGGGAAAAGATGCGAGGAGG + Intergenic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039425213 8:37479684-37479706 CAGGGGGAGCACAGGACAGGTGG + Intergenic
1039608161 8:38899993-38900015 CGGTGTTAACAGAGGAAAGGCGG - Intergenic
1039721498 8:40169305-40169327 CAGTGGGGTCAGGGGAAAGTGGG + Intergenic
1039722280 8:40176971-40176993 AAGAGGGAGCAGAGGAAATGGGG + Intergenic
1039809752 8:41036008-41036030 CAGAGGAAACAGTGGAAATGAGG - Intergenic
1040064454 8:43133765-43133787 CAGGGGGCAAAGAGGAAAGAGGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1041192427 8:55367133-55367155 CGGTGGGCACACAGGGAAGGAGG - Intronic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1041317872 8:56582868-56582890 CAGGAGGAAGAGAGCAAAGGTGG - Intergenic
1041608127 8:59809539-59809561 AAATGGGAAAAGAGGAAAGTAGG - Intergenic
1041760479 8:61361042-61361064 CAGAAGGAAGAGAGAAAAGGGGG + Intronic
1041827595 8:62114140-62114162 CAGGAGGAAGAGAGTAAAGGGGG - Intergenic
1043356593 8:79420284-79420306 GAGTAGGAACAAAGAAAAGGAGG - Intergenic
1043486207 8:80701541-80701563 CAGTGGGAACAGGAGAGAGGAGG - Intronic
1043720731 8:83544914-83544936 CAGTGGGAACAGAGACTAGTGGG - Intergenic
1044291671 8:90478919-90478941 CAGTGGGAAATGAGGAAATCAGG - Intergenic
1045234058 8:100334424-100334446 AGGTAAGAACAGAGGAAAGGAGG - Intronic
1045549784 8:103161218-103161240 CAAAGGAATCAGAGGAAAGGGGG - Intronic
1045569751 8:103356630-103356652 CAGGAGGAAGAGAGTAAAGGAGG + Intergenic
1045674696 8:104594015-104594037 CAGGAGGAAGAGAGTAAAGGGGG - Intronic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048291073 8:133182175-133182197 CATTGAGGACAGAGAAAAGGCGG + Intergenic
1048518684 8:135134308-135134330 CAGTGGTAAGATATGAAAGGAGG + Intergenic
1048999654 8:139816529-139816551 CAGAGGGGACAGAGGAGAGGTGG + Intronic
1049207602 8:141370718-141370740 CAGTGGGAACCAAGGAAACTGGG + Intergenic
1049233623 8:141496932-141496954 CAGTGAGAGCAGAGCAAGGGAGG + Intergenic
1049311884 8:141937798-141937820 AAGTGGGATCAGAGAAGAGGGGG - Intergenic
1049397039 8:142405695-142405717 CAGAGGGTAGAGAGGAAGGGTGG - Intergenic
1049575767 8:143388949-143388971 GAGTGGGGAAAGAGGAAGGGAGG + Intergenic
1049716130 8:144093631-144093653 AAGGGAGAACAGAGGAAAAGAGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049955468 9:688916-688938 CAGTGGGAAAGAAGGAAAGCAGG - Intronic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1051518714 9:17960095-17960117 CAATGGAAACACAGGAAAGAAGG - Intergenic
1052062666 9:23979855-23979877 CAGTGGGAAAAAAAAAAAGGAGG - Intergenic
1052736486 9:32347595-32347617 CATTGGGAACAGATGAGAGCTGG - Intergenic
1052738747 9:32373127-32373149 AAGTGGCAACAGAGCAGAGGCGG + Intergenic
1052760465 9:32585413-32585435 CGGTGGGAAAAGAGAAAAGAAGG - Intergenic
1052977388 9:34421292-34421314 CTGGGGGTACAGAGGTAAGGAGG + Intronic
1053036337 9:34829772-34829794 CAGTAAAAATAGAGGAAAGGGGG + Intergenic
1053158527 9:35796916-35796938 AGGTGGCAATAGAGGAAAGGAGG + Intronic
1053302311 9:36960821-36960843 CTGTGGGAAGAGAGGAATGCAGG - Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053595026 9:39551818-39551840 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1053674313 9:40407809-40407831 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1053852808 9:42306846-42306868 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1054385421 9:64547876-64547898 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054510308 9:65968481-65968503 CAGTGGGAGGAGAGGAAAAGGGG - Intergenic
1054929379 9:70620025-70620047 CAGGGGGAGAGGAGGAAAGGTGG - Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055857634 9:80710060-80710082 CAGGGGACACAGAGGAGAGGAGG - Intergenic
1056412546 9:86345332-86345354 CAGTGGTAACAGAGGATAGGTGG + Intronic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1057695195 9:97318244-97318266 AAGCGGGGACAGAGGAATGGAGG - Intronic
1057834351 9:98432289-98432311 CAGAGGGGACAGAGAAAAAGGGG + Intronic
1057838480 9:98466028-98466050 CAGGAGGAAGAGAGCAAAGGGGG - Intronic
1058551709 9:106122022-106122044 CAGTCGGAGAAGAGGAAAAGAGG + Intergenic
1058784635 9:108374968-108374990 CAGTGGGGAGAGGGGAAATGGGG - Intergenic
1059030245 9:110685619-110685641 TACTGGGAAAAGAAGAAAGGGGG - Intronic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059305512 9:113350296-113350318 CAGGGGGAAGAGGCGAAAGGAGG - Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059786655 9:117593601-117593623 CAGGAGGAAGAGAGCAAAGGGGG - Intergenic
1060100129 9:120833175-120833197 AAGAGGGAGCAGAGGAGAGGGGG + Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1061361258 9:130143776-130143798 GAGTGGGAACGGAGGAGACGTGG - Intergenic
1061442182 9:130613176-130613198 CAGAAGGATCAGAGCAAAGGTGG + Intronic
1061630086 9:131866883-131866905 CTGAGGGACCCGAGGAAAGGAGG - Intronic
1062702180 9:137913052-137913074 CAGTGGGGACACAGGAATGAAGG + Intronic
1185504925 X:625029-625051 CAGAGGGAGGAAAGGAAAGGAGG - Intronic
1185683263 X:1906486-1906508 CAGGAGGAAGAGAGCAAAGGGGG - Intergenic
1186566330 X:10666823-10666845 TAGTGGAAACAGAGAACAGGTGG - Intronic
1186659769 X:11657813-11657835 GAGTGGGAAGAAAGGTAAGGAGG + Intronic
1186900158 X:14045882-14045904 CAGTGGGAGAAGAGAAAAAGGGG + Intergenic
1187350571 X:18511756-18511778 TAATGGGAAAAGAGAAAAGGTGG + Intronic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1187462631 X:19501621-19501643 CAGTGGGCACAGATGACAGCTGG - Intronic
1189110513 X:38285812-38285834 CAGGAGGAACAGAGAAGAGGAGG - Exonic
1190756386 X:53405402-53405424 CAGGGGGAAGAGAGAAGAGGGGG + Intronic
1190758901 X:53423518-53423540 GAGAGGGAAGAGAGGTAAGGTGG - Intronic
1191077689 X:56472849-56472871 CAGGAGGAAGAGAGCAAAGGAGG - Intergenic
1191088905 X:56599020-56599042 CAGTGGGTACATACGCAAGGGGG - Intergenic
1192172612 X:68866315-68866337 TAATGGGAAGAGTGGAAAGGAGG + Intergenic
1192194571 X:69019613-69019635 CAGTGGCCTCAGAGGAAAAGTGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1193861266 X:86671539-86671561 CAGGAGGAACAGAGTAAAGGGGG - Intronic
1195199722 X:102536040-102536062 AAATGGGAACAAAGGAAAGAAGG + Intergenic
1195384419 X:104300311-104300333 CAGGGATAACAGTGGAAAGGAGG - Intergenic
1195499130 X:105573664-105573686 GAGGGGGAATATAGGAAAGGGGG + Intronic
1196002203 X:110797441-110797463 CACTGTTAACAAAGGAAAGGGGG + Intergenic
1196014737 X:110926072-110926094 CGGTGGAAAAAGAGGAAAAGGGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197771182 X:130090475-130090497 CAGTGTGAACACAGGCACGGAGG - Intronic
1198176168 X:134157841-134157863 GAGAGAGAACAGAGGAAAGCAGG - Intergenic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1198776810 X:140188392-140188414 GGGTGGGAACAGGGCAAAGGTGG - Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199463102 X:148105352-148105374 CAGGAGGAATAGAGCAAAGGGGG - Intergenic
1199527688 X:148810848-148810870 CTTTGGTAACTGAGGAAAGGGGG - Intronic
1199969661 X:152850242-152850264 CTGTGGAAAGAGAGGAACGGTGG - Intronic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic
1202578547 Y:26353799-26353821 CAGGTGGAACAAAGGAAAGGTGG - Intergenic