ID: 1091442193

View in Genome Browser
Species Human (GRCh38)
Location 12:519947-519969
Sequence CTTGTTATGTCCTCTGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091442189_1091442193 4 Left 1091442189 12:519920-519942 CCTTTCATATTCTCAGCTTTCTA 0: 1
1: 0
2: 0
3: 48
4: 415
Right 1091442193 12:519947-519969 CTTGTTATGTCCTCTGTGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
1091442187_1091442193 15 Left 1091442187 12:519909-519931 CCGGGTTAGTCCCTTTCATATTC 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1091442193 12:519947-519969 CTTGTTATGTCCTCTGTGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
1091442188_1091442193 5 Left 1091442188 12:519919-519941 CCCTTTCATATTCTCAGCTTTCT 0: 1
1: 0
2: 2
3: 57
4: 650
Right 1091442193 12:519947-519969 CTTGTTATGTCCTCTGTGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091442193 Original CRISPR CTTGTTATGTCCTCTGTGTA GGG Intronic
900872118 1:5311618-5311640 CTTCTTATTTCCTATTTGTAGGG - Intergenic
902071950 1:13747959-13747981 GTTGTTATGTCTTATGTGTTTGG + Intronic
904004776 1:27358002-27358024 CTTGTTGTGTCCTCTCAGTGCGG - Intronic
904087261 1:27917648-27917670 ATTGGTATGTACTCTGTGTGTGG + Intergenic
904651404 1:32008685-32008707 ATTGTTATATCCTCTGTTTTTGG + Intergenic
905540898 1:38759774-38759796 CTTGTGTTGTCCTCTCTGTGGGG - Intergenic
907586624 1:55623740-55623762 CTTCTTTTGTCCTTTGTGTGTGG + Intergenic
908032418 1:60015601-60015623 CTTGCTGTGTTCTCTGTGCATGG + Intronic
910727779 1:90356521-90356543 CTTGTTATTTCCTCAGTATTTGG + Intergenic
911384269 1:97155091-97155113 CTGGTTATTTCCTCTTTGCAGGG + Intronic
916888600 1:169095074-169095096 CATGCTATTTCCTCTGTGTCTGG - Intergenic
918005573 1:180539298-180539320 CTTGTCATGTACTCTGAGCAGGG - Intergenic
919589734 1:199485995-199486017 CAAGTTATTTCCTCTGTCTAGGG - Intergenic
920302952 1:205000582-205000604 CTTGTCATGTCAACAGTGTAAGG - Intronic
921778203 1:219127473-219127495 ATTGTCATGTCTCCTGTGTACGG - Intergenic
923202256 1:231724157-231724179 ATTGTCATATCCTCTGTGTGGGG + Intronic
923541642 1:234892656-234892678 TTTTTTGTGTCCTCTATGTAGGG - Intergenic
924155291 1:241169016-241169038 CAGTTTATGTCCTCTGTTTAGGG - Intronic
924388648 1:243526098-243526120 CTAGTTATGTTGTCTCTGTAAGG + Intronic
1062863492 10:829078-829100 CTTGCATTGTACTCTGTGTAGGG + Intronic
1063919554 10:10918757-10918779 ATTGTTATTTTCTCTATGTAAGG + Intergenic
1068092805 10:52453957-52453979 CTTGTTCTGTGCACTGTGTCGGG - Intergenic
1072015185 10:91339905-91339927 CGTGTTATTTCCTCTATGTGGGG + Intergenic
1078558274 11:12349023-12349045 CTTGTTTTCCCCTCTGCGTATGG + Intronic
1078937761 11:15966436-15966458 TGTTTTATGACCTCTGTGTATGG - Exonic
1079583480 11:22095612-22095634 ATTGTGATGGCCTTTGTGTATGG + Intergenic
1080344494 11:31309312-31309334 CTGGTTATATCCAATGTGTAGGG - Intronic
1083691381 11:64411013-64411035 CTTGCTATGTCCTCATTGTGTGG - Intergenic
1087342778 11:96929684-96929706 TTTCTTATATCCTCTGTGAATGG + Intergenic
1088458935 11:110062389-110062411 TTGGTTAAGTGCTCTGTGTATGG - Intergenic
1090326414 11:125889793-125889815 CTTATTATGCCCTGTGTGTTGGG - Intronic
1091442193 12:519947-519969 CTTGTTATGTCCTCTGTGTAGGG + Intronic
1094356510 12:29583779-29583801 CTTGCTATTTCTTCAGTGTAGGG + Intronic
1095117186 12:38368645-38368667 CATGTTATGTAATCTATGTAAGG - Intergenic
1096732376 12:53625160-53625182 CTTGTTATGTTCTCTGACTGGGG - Intronic
1097306043 12:58070293-58070315 GTTTTTATGTTCTCAGTGTATGG + Intergenic
1097354740 12:58588438-58588460 CTTGATGTGTTCTCTGTGCAAGG - Intronic
1098529212 12:71521425-71521447 CTTGTTTTGCCTTCTGTGGAAGG + Intronic
1099014476 12:77327696-77327718 CTTGTGATTTCTTCTGTGCATGG + Intergenic
1099851443 12:88102140-88102162 CTTGTTCTGTCCTCAGTAAAAGG + Intronic
1101051229 12:100866200-100866222 CTTCCTGTGTCCTCTGTGAAGGG - Intronic
1103781600 12:123402450-123402472 CTGGTTTGGGCCTCTGTGTAGGG + Intronic
1104261784 12:127190412-127190434 CTTGTTAGATCCTCTGGGTTGGG + Intergenic
1105729372 13:23197050-23197072 CTTATTATGATCTGTGTGTATGG + Intronic
1108027606 13:46194823-46194845 CTAATTATGACCTCTGTGTTAGG - Intronic
1109552477 13:63921410-63921432 CTTGTCATGGCCTTTGTGCAAGG + Intergenic
1111134345 13:84020847-84020869 CTTGTTTTAGCCCCTGTGTATGG - Intergenic
1115767785 14:36641784-36641806 ATTATTATATCCTCTGTGCAAGG - Intergenic
1115829096 14:37314917-37314939 CCTGTTATGTGCTGTGTGTTGGG + Intronic
1121304200 14:92895439-92895461 GTTGTAATGGCCTCTGTGCAAGG + Intergenic
1121753817 14:96384683-96384705 TCTGTTATGTCCTCTATCTAAGG + Intronic
1121893451 14:97621470-97621492 TTTGCTCTGGCCTCTGTGTATGG - Intergenic
1122237167 14:100338002-100338024 CTTGTTATGCTTTCTGTGTGGGG - Intronic
1123678261 15:22734911-22734933 CTGGATATCTGCTCTGTGTAAGG + Intergenic
1124066979 15:26353880-26353902 CTTTCTGTGTCCTCTGTGTGTGG + Intergenic
1124330453 15:28809178-28809200 CTGGATATCTGCTCTGTGTAAGG + Intergenic
1128087570 15:64896549-64896571 CTTGCTGGGTCCTCTGTGTAGGG + Intronic
1129655558 15:77522668-77522690 CTTATTATGTTATCTCTGTATGG - Intergenic
1130266551 15:82410061-82410083 CTTGTCATGTCCTCTTTGGGAGG + Intergenic
1130505477 15:84536824-84536846 CTTGTCATGTCCTCTTTGGGAGG - Intergenic
1130522184 15:84671736-84671758 CTGGATATCTCCTATGTGTAAGG - Intronic
1131189873 15:90305931-90305953 CTGGATATGTTCTTTGTGTAAGG - Intronic
1132170774 15:99651969-99651991 CTTTTTATGTCATATGTGTCAGG + Intronic
1134355001 16:13474015-13474037 CTTGTTAGGGCTTCTGAGTATGG - Intergenic
1134888138 16:17813026-17813048 CCTGATAGGTTCTCTGTGTATGG - Intergenic
1134899089 16:17918581-17918603 CATTCTATGTCCACTGTGTAAGG - Intergenic
1137730482 16:50686108-50686130 TTTTTTAGGTCCTCTGTGCAAGG - Intergenic
1150171128 17:62996036-62996058 CATGTTTTTTCCTCTGTGAAAGG - Intergenic
1150203288 17:63379155-63379177 CTTGTAATGCCATCTGTGTGTGG + Intronic
1151759256 17:76091248-76091270 CTTCTTATCTCCTCTCTGTGTGG - Intronic
1154039447 18:10839348-10839370 TTTGCTGTGTCCTCTGTGTTGGG + Intronic
1156575186 18:38306551-38306573 CTTTTCATGTCTTCTGTGTGGGG - Intergenic
1156751440 18:40461477-40461499 GTTGTGATGACCTTTGTGTAAGG - Intergenic
1156846670 18:41673508-41673530 CTTGGTATGTCTTATGTGAATGG + Intergenic
1159949489 18:74471925-74471947 CTTTTTTTCCCCTCTGTGTATGG + Intergenic
1160415624 18:78708334-78708356 GTTGTTATCTCCTCTCTGTTTGG + Intergenic
1161718987 19:5892887-5892909 CTTGTTCTGTCCTCAGAGGACGG - Exonic
925835731 2:7944797-7944819 CTTGTTCTATCATCTGTGTTGGG + Intergenic
929551344 2:42895018-42895040 ATAGCTTTGTCCTCTGTGTAAGG - Intergenic
930928905 2:56856822-56856844 CTTGTTATGTCTATTGTGAATGG + Intergenic
931035373 2:58236022-58236044 CCTTTTCTGTCCTCTGTGTTGGG - Intronic
932200112 2:69818906-69818928 CTTTGTATGTCCTATGTGAAAGG + Intronic
933468054 2:82681442-82681464 CATGTAATGTCCTCTGTAAATGG - Intergenic
935059992 2:99599009-99599031 CTTCTGCAGTCCTCTGTGTAGGG + Intronic
936991538 2:118372119-118372141 CTTGTTTTGTCATCTGTTTGAGG - Intergenic
937131023 2:119513270-119513292 CTTGTTTTGTTCTCTTTGTATGG + Intronic
937420962 2:121755149-121755171 CTTTTAATGTCTTCTCTGTATGG - Intronic
937722091 2:125112390-125112412 ATAGTTATGTCATCAGTGTATGG + Intergenic
939671570 2:145018916-145018938 CTTGTTATTCCCTCTGTAAAGGG - Intergenic
939788256 2:146542380-146542402 CATATTATTTCCTCTGTGAAAGG - Intergenic
944947830 2:204710731-204710753 CTTGTCCTATCCTCTGTGTTGGG + Intronic
1170696538 20:18664483-18664505 CTTGTAATGTCCTCGGTGATGGG + Intronic
1177521328 21:22231040-22231062 CTAGTTATGTCATCTGTGTGTGG + Intergenic
1178472113 21:32903126-32903148 GTTGTGATGGCCTCTGTGCAGGG - Intergenic
1178703604 21:34854702-34854724 CTTGTGATGTGGTCTGTTTAAGG - Intronic
1179117719 21:38509452-38509474 CTTCTTATGTCCTTTCTGTTGGG - Intronic
1179531417 21:42022150-42022172 CTTGATTTGTCCTCTGTATCTGG - Intergenic
1183986631 22:41573891-41573913 CCTTTTCTGTCCTCTGAGTAGGG + Intronic
1184451177 22:44583801-44583823 CTTGTTTTGTCCTCTGGGAAGGG - Intergenic
952488896 3:33846354-33846376 CTGGATATCTGCTCTGTGTAAGG + Intronic
952564314 3:34636326-34636348 CTTGTTCTTTCATCTGTGAATGG - Intergenic
954413196 3:50380295-50380317 CTTGTTGTGTCCTCTGCCTCAGG + Intronic
955468901 3:59265459-59265481 CATGTCATGTCCTGTGTGTATGG + Intergenic
957440407 3:80239239-80239261 CTTTTTCTGTCCTCTGTGATTGG + Intergenic
963197580 3:142550469-142550491 CTGATTATGTCATCTGTGAAAGG - Intronic
964132369 3:153303712-153303734 CTTGTTATGTTTTCAGTGAAAGG - Intergenic
970291975 4:14582712-14582734 CTTGTTTTGACCTCTGTGCTAGG - Intergenic
971482359 4:27125988-27126010 CTTGTTATGTCTCATGTGGAGGG - Intergenic
972983263 4:44731541-44731563 CCTGTTTTGGCCACTGTGTAGGG - Intergenic
979112253 4:116774734-116774756 ATTATTATGTCCTCTCTGTTAGG - Intergenic
980469655 4:133234446-133234468 CCTGTTATGGCCTCTGCCTAGGG + Intergenic
982238965 4:153279525-153279547 CTTTTTATATCCAATGTGTAGGG + Intronic
983165045 4:164465311-164465333 CTTGTTTTGTCATCTGAGTAAGG - Intergenic
983700621 4:170589149-170589171 ATTGTTATGTGCTCTGATTATGG + Intergenic
988226477 5:28418532-28418554 GTTGTAATGGCCTTTGTGTAAGG + Intergenic
992037988 5:72800245-72800267 CTTTTTATGTTGTCTTTGTATGG + Intergenic
993430598 5:87827884-87827906 TTTGTTATGTCCTCACTGCATGG - Intergenic
994961326 5:106607556-106607578 TTTTTTATGTTCTTTGTGTAAGG + Intergenic
995118674 5:108512041-108512063 CTTTTTATGTCCTTTCTGTATGG + Intergenic
997087231 5:130816035-130816057 CTTGTTATTTCCTCTGCCTCAGG - Intergenic
997665022 5:135623700-135623722 CTGGGTGTCTCCTCTGTGTAAGG - Intergenic
998566249 5:143218361-143218383 CTTGTTCTGTGCTATGTGCAAGG + Intronic
998918356 5:147040680-147040702 CTTGTTAGGTACTCCGTGTGAGG + Intronic
1000953905 5:167519295-167519317 CCTGTTATGTGCTCAGTGTTGGG - Intronic
1007088751 6:39168804-39168826 CTTGTTTGGGCCTCTGTGCAGGG + Intergenic
1008020189 6:46567628-46567650 CTTGTTATTTTCTTTGTTTACGG + Intronic
1009788103 6:68364261-68364283 CTTGGGATGTTCTCTGTGCATGG + Intergenic
1011960574 6:93083897-93083919 CTTGTTATTCTCTCAGTGTAGGG - Intergenic
1013489334 6:110629938-110629960 CTTCTTATTTCCTCAGGGTAAGG - Intronic
1015299419 6:131635529-131635551 CTTGTTCTGGACTTTGTGTAAGG - Intronic
1019046235 6:169148973-169148995 ATTGGTATATCTTCTGTGTATGG + Intergenic
1020931914 7:14407911-14407933 CTTCTAAGGTCTTCTGTGTAGGG - Intronic
1021763960 7:23928460-23928482 CTTTTAATGTCATCTCTGTAAGG + Intergenic
1022562629 7:31365519-31365541 ATTGGTATGTCCTCTATGGAGGG - Intergenic
1022995429 7:35750383-35750405 CTTGTTACTTACTCTGTGTGAGG + Intergenic
1023293303 7:38689391-38689413 TTTGTTCTGTCCTCTGTTTGAGG - Intergenic
1026281546 7:68926803-68926825 CATGTTTCGTCGTCTGTGTAAGG + Intergenic
1028003502 7:85531779-85531801 CTTCATATGTACTCTGTGAAAGG - Intergenic
1028019989 7:85758443-85758465 CTTGATTTGACCTTTGTGTATGG - Intergenic
1030358735 7:108571463-108571485 TTTTCTATCTCCTCTGTGTATGG + Intronic
1031144334 7:117981177-117981199 CTTGGTATGGCATGTGTGTAGGG + Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033617347 7:143029340-143029362 CTTGTTCTGGCCCCTGTGCATGG - Intergenic
1038909041 8:31941073-31941095 TTTGTTATGTCCTCTGGCTTTGG - Intronic
1039183364 8:34890975-34890997 ATGGTTAAGTCCTCTGTGAAAGG - Intergenic
1039477244 8:37845942-37845964 CATGTTTTGTGCTCTGTGCATGG - Intronic
1042918812 8:73901579-73901601 GTTGTGATGGCCTTTGTGTAGGG + Intergenic
1043116782 8:76265652-76265674 CTTGGTATGTCCTCTATTTGAGG - Intergenic
1043519357 8:81027469-81027491 CTTTTTATGTAGCCTGTGTAAGG - Intronic
1044240515 8:89882836-89882858 CTTGTTATGTACTCAGGATATGG - Intergenic
1046576684 8:116038724-116038746 CTTGCTTGGTACTCTGTGTATGG + Intergenic
1046969287 8:120203687-120203709 TCTTTTTTGTCCTCTGTGTAAGG + Exonic
1048576595 8:135695227-135695249 ATTGTTATATACTCTGTGTATGG - Intergenic
1052023090 9:23546805-23546827 CTTCCTATTTCCTCTGTGTGGGG - Intergenic
1055589860 9:77800984-77801006 TCTGTTCTGACCTCTGTGTACGG - Intronic
1057413793 9:94843491-94843513 CTTATTATGTCCTCAGTGCTGGG + Intronic
1060563775 9:124570571-124570593 CTTCTTATCTCCTCTATGTGGGG + Intronic
1186270768 X:7885501-7885523 CTTGTTTTGTCTGCTTTGTATGG + Intergenic
1186957872 X:14702888-14702910 CTTGTCCTCTCCTCTCTGTATGG - Intronic
1193558912 X:82993269-82993291 CTTTTTATGTCAACTGTGAATGG + Intergenic
1193790605 X:85811715-85811737 CTTTTTATGTCTTTTGTGAATGG - Intergenic
1196585806 X:117426291-117426313 TTTGTTATCTCCTCTGTGCTAGG - Intergenic
1198296289 X:135290947-135290969 TATATTATGTCCTCTGTTTATGG - Intronic
1198686710 X:139235400-139235422 CTTGTGCAGTCCTCTGTGCAGGG - Intergenic
1199043066 X:143137830-143137852 ATTACTATGTCCTCTGTTTAGGG - Intergenic
1200361454 X:155611509-155611531 CTTGTTTTGGCCTCTGTTTCAGG - Intronic
1201169549 Y:11244015-11244037 CTTGCTATGGCCTTTGTGCAAGG - Intergenic
1202364477 Y:24147798-24147820 CTTGTCATGTCCTCTTTGGGAGG + Intergenic
1202506304 Y:25522324-25522346 CTTGTCATGTCCTCTTTGGGAGG - Intergenic