ID: 1091443018

View in Genome Browser
Species Human (GRCh38)
Location 12:526392-526414
Sequence TCTTCTTTCTGGCCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091443018_1091443023 -1 Left 1091443018 12:526392-526414 CCTGTCCCAGGCCAGAAAGAAGA 0: 1
1: 0
2: 0
3: 22
4: 296
Right 1091443023 12:526414-526436 ATAGGAAAAGACAAGCCTAGCGG 0: 1
1: 0
2: 1
3: 19
4: 231
1091443018_1091443024 0 Left 1091443018 12:526392-526414 CCTGTCCCAGGCCAGAAAGAAGA 0: 1
1: 0
2: 0
3: 22
4: 296
Right 1091443024 12:526415-526437 TAGGAAAAGACAAGCCTAGCGGG 0: 1
1: 0
2: 4
3: 13
4: 167
1091443018_1091443026 27 Left 1091443018 12:526392-526414 CCTGTCCCAGGCCAGAAAGAAGA 0: 1
1: 0
2: 0
3: 22
4: 296
Right 1091443026 12:526442-526464 GAAAAGTCAGTACTGACCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 146
1091443018_1091443027 28 Left 1091443018 12:526392-526414 CCTGTCCCAGGCCAGAAAGAAGA 0: 1
1: 0
2: 0
3: 22
4: 296
Right 1091443027 12:526443-526465 AAAAGTCAGTACTGACCTGAGGG 0: 1
1: 0
2: 3
3: 30
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091443018 Original CRISPR TCTTCTTTCTGGCCTGGGAC AGG (reversed) Intronic
900458925 1:2790882-2790904 TCTTCTCTCAGGTCTAGGACTGG + Intronic
901753909 1:11429363-11429385 GCTTCTCACTGGCCTGGGCCTGG + Intergenic
902299639 1:15492876-15492898 GCCTCTTTCAGGCCTGGGGCAGG + Exonic
904014761 1:27410850-27410872 TCCTCTTTCAGGCCTGGGTCAGG - Intronic
904670769 1:32163304-32163326 TCCTCTTTCTTACCTGGGTCTGG - Exonic
904744345 1:32702138-32702160 TCTCCCGTCTGGCCTGGGATGGG - Intronic
905939820 1:41854162-41854184 TCTCAGTTCTGGGCTGGGACAGG + Intronic
906534606 1:46544537-46544559 TCTTCTTTCTGGAGCGGGGCTGG + Intergenic
907178817 1:52552755-52552777 ACTTCTTTCTTTCCTGGAACGGG - Intronic
907425864 1:54378970-54378992 TCTTGTGTCTGGCCTGGGTGGGG - Intronic
907809254 1:57852083-57852105 TCTTCTTTCTCCCCTGAGATGGG + Intronic
908068851 1:60436358-60436380 CCTTCTTTCTCGCCTGTTACAGG + Intergenic
912500280 1:110117113-110117135 TCTTCCTTCTGTGCTGGGAGAGG + Intergenic
914284403 1:146209619-146209641 TCTTCTTTCTAGTCTGGTAAAGG + Intronic
914545435 1:148660360-148660382 TCTTCTTTCTAGTCTGGTAAAGG + Intronic
915117242 1:153608647-153608669 TCTGCTTTGTTGCCTGGGGCTGG - Intronic
915476576 1:156156132-156156154 TGCTCTTCCAGGCCTGGGACAGG - Intronic
915952905 1:160201768-160201790 CCTTCCTTCTGGCCAAGGACAGG - Exonic
917028263 1:170664534-170664556 TTGTCTTTCTGGCCGCGGACGGG - Intronic
918142502 1:181731457-181731479 TCTTCAGTCTGGCCTGTGAGTGG + Intronic
918337036 1:183526441-183526463 TAATCTTTCGGGCCTGGCACAGG - Intronic
920398328 1:205662053-205662075 TCTTCTCTCTGGTCATGGACCGG - Exonic
920697886 1:208195529-208195551 CATTGTTTATGGCCTGGGACAGG + Intronic
920784655 1:209029357-209029379 TCTTTTTTCTTTCCTGAGACAGG - Intergenic
920807433 1:209248333-209248355 TCTTCTTTCAGGGCTGTGCCAGG + Intergenic
923160864 1:231313485-231313507 TCCTCTTTCTCCTCTGGGACTGG + Intergenic
923228459 1:231961283-231961305 TCTTCCTTCAGGTGTGGGACAGG + Intronic
1067062901 10:43087077-43087099 TCTGTTTTCTGGCATGGGATGGG + Intronic
1067184606 10:44016094-44016116 CCTGCTTTGTGGCCTGGGAGTGG + Intergenic
1068673836 10:59749967-59749989 CCTGCTTTCTGACCTGGGGCGGG - Intergenic
1070286568 10:75087850-75087872 TCTGCTTTCTGCCCTGGGGTGGG - Intergenic
1072695576 10:97600543-97600565 AATTCATTCTGGTCTGGGACAGG - Intronic
1072871510 10:99125353-99125375 TTTTCTTTATGGCATGGGAGAGG + Intronic
1073427972 10:103467650-103467672 ACTTCTTTCTCCCATGGGACAGG - Intergenic
1073469574 10:103714394-103714416 TCTGTTTTCAGGCCTGGCACAGG - Intronic
1074698329 10:116071116-116071138 TTTTCTTCCTGGCCTGGGCCAGG - Intronic
1075288234 10:121205391-121205413 TCTTCATGCTTGCATGGGACAGG - Intergenic
1076001272 10:126914969-126914991 TTTTCTTTCTGGCCTGGTCTGGG + Intronic
1076244326 10:128934223-128934245 TCCTCCTTCAGGCCTGGGCCGGG + Intergenic
1076363977 10:129910277-129910299 TCTTCTTTCAGGCCCCGTACTGG - Intronic
1076833690 10:133009465-133009487 TCTACTTCCTGCCCTGGGTCTGG - Intergenic
1078152101 11:8768042-8768064 CCTTCTTTCTGAGCTGGGAGAGG + Intronic
1078426487 11:11254770-11254792 TGAGATTTCTGGCCTGGGACTGG + Intergenic
1078849226 11:15149043-15149065 GGTTCCTTGTGGCCTGGGACTGG + Intronic
1080749830 11:35141452-35141474 TCTTCTTTCAGGCCAGGCCCAGG - Intronic
1080868813 11:36218510-36218532 TTTTCTTCCTGGCCTGGGCCTGG + Intronic
1081907625 11:46679612-46679634 TCTTCTGTTGGGCCTGGGGCTGG - Intronic
1083185489 11:61015563-61015585 TTTTCTTTCTTTTCTGGGACAGG - Intronic
1083461988 11:62819991-62820013 TCCACTTACTGGCCTGGGAGCGG - Intronic
1084440390 11:69169455-69169477 TCCTCTTTCTGCCCTGGGGACGG - Intergenic
1084440649 11:69170914-69170936 TCCTCTTTCTGCCCTGGGGGCGG + Intergenic
1086136861 11:83450449-83450471 TGTTCTGTGTGTCCTGGGACAGG - Intergenic
1086485856 11:87300851-87300873 CCCTTATTCTGGCCTGGGACAGG + Intronic
1087590169 11:100177200-100177222 TCTTTTTCCTGGCTTGGGAGGGG - Intronic
1089297867 11:117480773-117480795 TCTTGTTCTTGGCCTGGGAGAGG + Intronic
1089422543 11:118342571-118342593 GTTTCTCTCTGGCCTGGTACTGG - Exonic
1090666510 11:128918267-128918289 TCTTGTTTCCAGCCTGGGAGGGG - Exonic
1091315811 11:134613303-134613325 TGTTCTTAGGGGCCTGGGACAGG + Intergenic
1091443018 12:526392-526414 TCTTCTTTCTGGCCTGGGACAGG - Intronic
1091913789 12:4252747-4252769 GCTTCTCTCTGGCCTGTGATTGG + Intergenic
1092446057 12:8558645-8558667 TCTTGTGTCTGACCTGGAACAGG + Intergenic
1094585390 12:31772931-31772953 TCTTTTTTCCTGCCTGGAACCGG - Intergenic
1095303916 12:40618870-40618892 TGTTCCTTCTGGCCTCTGACTGG - Intergenic
1095843340 12:46718843-46718865 TCATCTTTCTGGTCTGGGCCAGG - Intergenic
1096493306 12:52024684-52024706 TCTTCTTTCTTTCTTGTGACAGG - Intronic
1096994764 12:55831589-55831611 CCCTCTTTCTGCCCTGGGCCTGG + Intergenic
1097026883 12:56063305-56063327 TCTTCTTTTTCACCTGGAACAGG - Intergenic
1097288870 12:57897449-57897471 TCTTCTGTTTAGCCTGGAACAGG - Intergenic
1098156781 12:67607674-67607696 TCTTCTATGTGGCCTGTTACTGG - Intergenic
1100983275 12:100180684-100180706 TCTTCTTTCCATCCTGGGAATGG - Intergenic
1101873643 12:108584315-108584337 TCATCTGTCTGGAGTGGGACGGG - Intergenic
1102009517 12:109609615-109609637 TCTTCTTCCTAGCCTGGCATGGG + Intergenic
1104392611 12:128403810-128403832 TCTTCTTTCTGGGCTGGAGAAGG + Intronic
1104631569 12:130407464-130407486 TGTTCTTTCTGTCATGGCACAGG + Intronic
1106370752 13:29130374-29130396 TCTTCCTTCTGCCCAGGCACCGG + Intronic
1106563541 13:30866644-30866666 TCTTCTTTCAGACCTTGGATAGG - Intergenic
1107085693 13:36425761-36425783 TTTTGTATCTGGCCAGGGACAGG - Intergenic
1109210251 13:59527066-59527088 GCTTCTTTCAGGGCTGGGGCAGG - Intergenic
1112698248 13:101974859-101974881 TCTTATTTCTGATCTGGGCCTGG - Intronic
1115071040 14:29321811-29321833 GCTTTTTTCTGCCTTGGGACTGG + Intergenic
1115370413 14:32607544-32607566 TCTCATGTCTGGCCTGGCACTGG - Intronic
1117556676 14:56893373-56893395 TCTCCTTTCTGGTCTGTGGCAGG + Intergenic
1118161968 14:63299605-63299627 TTTCCTTTGTGGCCTGGGAAAGG - Intergenic
1118772058 14:68948776-68948798 TTTTCTTTGTGGCCTGGTAGTGG - Intronic
1119566190 14:75631218-75631240 TCTGCTGTCTGGCCTGGAGCAGG + Intronic
1119774496 14:77239950-77239972 TCTCCTTTCTGGTCTTGGATGGG + Intronic
1119969047 14:78948819-78948841 TCCTCTTTCAGTCCTGAGACAGG + Intronic
1122023583 14:98858935-98858957 TCATCTTTCTGCCCTTGGAATGG + Intergenic
1123204815 14:106701957-106701979 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1123209817 14:106748398-106748420 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1126109119 15:45165584-45165606 TCTTTATTCTGCCCTAGGACCGG + Intergenic
1126187956 15:45848789-45848811 TCTTCCCTCTGGCCTTGGCCTGG + Intergenic
1126778694 15:52120113-52120135 TCTTTTTTCTGGCCCAGGAGGGG + Exonic
1128629824 15:69253285-69253307 TCTTCTTTCTGGCATTTGAAAGG + Intronic
1129747072 15:78030138-78030160 TCTTCTTTCCGTCCTGGGAGAGG - Exonic
1129893660 15:79088756-79088778 TCTCTAGTCTGGCCTGGGACTGG + Intronic
1130127430 15:81105421-81105443 TCTTCTTTCTTTTCTGAGACGGG + Intronic
1130367110 15:83250609-83250631 TCTACTTTGTGGCCTGGGCAGGG - Intergenic
1130449328 15:84034990-84035012 ACTTCCTCCTGGCCAGGGACAGG - Intronic
1130670801 15:85910768-85910790 TCCTCTGTCTGGGCTGGGATAGG + Intergenic
1130927719 15:88397795-88397817 TCTTCTCTCTGCCCTGGGGGTGG - Intergenic
1130972966 15:88749011-88749033 TCATCTCTGTGACCTGGGACAGG - Intergenic
1132490399 16:226096-226118 TCTGCTGTTTGGCCTGGGATGGG - Intronic
1133206223 16:4235376-4235398 TCTTCTTTGTGGACTGGGGATGG - Intronic
1135012765 16:18897251-18897273 TGTTCTGTTTTGCCTGGGACAGG - Intronic
1136863800 16:33723678-33723700 TCTACTTTGTGTCTTGGGACTGG + Intergenic
1138311575 16:56028124-56028146 CCCTCTTTTTGGCCTGGGAATGG + Intergenic
1139474493 16:67196054-67196076 TCTGTTTTCTGACCTAGGACTGG - Intronic
1140204624 16:72923436-72923458 TTTTTTTTCTGGTCTGAGACAGG - Intronic
1141218707 16:82049003-82049025 GCTACTTTCTGGGCTGGAACAGG + Intronic
1141617727 16:85219850-85219872 CTTTGTTTCTGGCCTGGGCCAGG + Intergenic
1142126303 16:88412207-88412229 TGTTACTTCGGGCCTGGGACTGG - Intergenic
1142220176 16:88850406-88850428 TGTTATTTGTGGCCTGGAACAGG - Intronic
1142272176 16:89095760-89095782 TCTTCTGCCTGGCCTGTGCCGGG + Intronic
1203125286 16_KI270728v1_random:1571825-1571847 TCTACTTTGTGTCTTGGGACTGG + Intergenic
1143156864 17:4843012-4843034 TCTGCTCTCTTGACTGGGACTGG - Intronic
1143913460 17:10271507-10271529 TCTTCTCACTGGCCTGAGTCAGG - Intergenic
1144221236 17:13101697-13101719 TCTTCTTTCTGGCACAGGAGAGG + Intergenic
1145243103 17:21251113-21251135 TCTTCTTTCTCCCCTGGGCTTGG + Intronic
1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG + Intronic
1146447428 17:32943507-32943529 TCTTCCCTCTGGCCTGGAATAGG + Exonic
1148243087 17:46012778-46012800 TCTTCCCTCTGGCCTGGGTGAGG - Intronic
1149752139 17:59155742-59155764 TTTTCTTTATGGCGTGGGAGAGG + Exonic
1152318969 17:79597397-79597419 TCCTCTTTCTGCCCTGGGTGGGG - Intergenic
1153111812 18:1599381-1599403 TCTCCTTTCTGTCCTGGAACAGG + Intergenic
1153283374 18:3434939-3434961 TCTTCATTCTGGCATGGACCTGG + Intronic
1158214405 18:55084564-55084586 TCTTCATTATGTCCTAGGACTGG + Intergenic
1159427550 18:68309608-68309630 TCTTCTTTCTGGCTTGTAAATGG - Intergenic
1160149793 18:76390461-76390483 GCTGCTTCCTGGCTTGGGACTGG - Intronic
1160188290 18:76693321-76693343 TCTTCTGTCTCTCCTCGGACGGG - Intergenic
1160454027 18:78984717-78984739 TATACTTTCTGGCATGTGACTGG - Intronic
1162555784 19:11384504-11384526 TTTTCTTTGTGGCCCTGGACAGG + Intronic
1162935393 19:13979229-13979251 TCTTCTTTCTTGCGTGGCCCTGG - Intronic
1165162593 19:33826557-33826579 TCTTCTTTTTTGCCGGGGGCAGG - Intergenic
1165646670 19:37444926-37444948 TCTTCTTTCTGGGAAGGGATGGG + Exonic
1165965117 19:39570883-39570905 GCTTCTGTCTGTCCTGGGAAAGG - Intergenic
1166863237 19:45821594-45821616 TCTGCTTTCAGGGCTGGAACAGG + Intronic
1167089865 19:47336511-47336533 TTTTCTTTCTTTCTTGGGACAGG + Intronic
925924052 2:8658088-8658110 TCTTCTTGCTGCCCTCAGACAGG - Intergenic
926606028 2:14899220-14899242 TCTTCTGTCTGGGCTGGGCCTGG - Intergenic
928132078 2:28659764-28659786 TCTCCTTTCTACCCGGGGACAGG - Intergenic
928163661 2:28952890-28952912 TCTTTTTTCTGGAGTGTGACAGG + Intergenic
928319887 2:30274592-30274614 GCTTCATTTTGACCTGGGACAGG - Intronic
931433245 2:62226471-62226493 TCTTGTTTCTTGCCTAGAACAGG + Intergenic
932320830 2:70820829-70820851 TCTTCTCTGGGGGCTGGGACTGG + Intergenic
932850476 2:75179668-75179690 TATTGCTTCTGGACTGGGACAGG + Intronic
933340924 2:81025404-81025426 TTTTCTTGCTGGCCTGGCAGGGG - Intergenic
933702404 2:85264797-85264819 CCTTCTTTCTGGGTTGGGAGAGG - Intronic
934630726 2:95918165-95918187 TCTACTTTGTGTCTTGGGACTGG + Intronic
934630869 2:95920043-95920065 TCTACTTTGTGTCTTGGGACTGG + Intronic
938090019 2:128425365-128425387 TCCTCTTGCTGGCCTGGAGCAGG + Intergenic
939365916 2:141231253-141231275 TTTTGTTTCTGGCATGGGCCAGG + Intronic
939619966 2:144406858-144406880 TCTTTTGCCTGGCCTAGGACAGG - Intronic
941464320 2:165808119-165808141 TATTCTGGCTGGGCTGGGACAGG + Intergenic
942420890 2:175806308-175806330 TCTTCTTCCTGTCCCAGGACTGG - Intergenic
944402573 2:199345102-199345124 TCTTCTCTCTTTCCTGGGGCTGG + Intronic
944476337 2:200110484-200110506 CCTTGTCTCTGGGCTGGGACTGG + Intergenic
944899341 2:204198470-204198492 TTTTCTGGCTGGCCTGGGATGGG - Intergenic
945192764 2:207207150-207207172 TCTACTTTCTGGGCTGGGCATGG - Intergenic
945435573 2:209813558-209813580 TCTTCTTTCTGCCATGGAACAGG + Exonic
945885693 2:215373400-215373422 TCTCCCTTCAGGCCTGGAACCGG - Exonic
946437094 2:219664436-219664458 CCTTCTTCTGGGCCTGGGACTGG + Intergenic
947950109 2:234139603-234139625 CCTTCTTCCTGGCCTGAGGCTGG + Intergenic
948201086 2:236130240-236130262 TTTTCATTTTGGCCTGGCACAGG + Exonic
1168965965 20:1898093-1898115 TCTTCTCTCTGGCCTGGAGGAGG + Intronic
1169068365 20:2707130-2707152 TCTTCCCTCTGCCCTGGGATTGG - Intronic
1170177563 20:13489287-13489309 AGCTCTTTCTGGCCAGGGACCGG - Intronic
1170901426 20:20466880-20466902 TCATCTTGCTGGCTTGGGCCTGG + Intronic
1170921895 20:20686996-20687018 TCTTAGTTCTGGCTTGGGAATGG - Intronic
1171203118 20:23257403-23257425 GCTTCTCTCTGGCCTGGCACTGG - Intergenic
1173657498 20:44710486-44710508 TGTTCTTCCAGGCCTGGGCCAGG - Intergenic
1173727417 20:45307367-45307389 TCTTCTACCAGGCCTGGGAGGGG - Intronic
1173792996 20:45840415-45840437 TCTTCTTGCTGCCTTGGGCCTGG + Intronic
1174033369 20:47649266-47649288 TCTTCTCTCTGGCTGGTGACTGG + Intronic
1174048973 20:47754221-47754243 TCTGTTCTCTGTCCTGGGACTGG + Intronic
1176866342 21:14056912-14056934 TCCTCGTTCTGGCCTTGGCCCGG - Intergenic
1177217665 21:18150760-18150782 TCACCTTTCTGTCTTGGGACTGG + Intronic
1177610295 21:23437670-23437692 TGTTATTTCAAGCCTGGGACTGG + Intergenic
1179313383 21:40216989-40217011 TCCCTTTTCTGGCCTGGGAATGG - Intronic
1179422200 21:41245618-41245640 TCTTCCCTCTGCCCTGGGGCAGG + Intronic
1180162627 21:46005161-46005183 CCCTGGTTCTGGCCTGGGACTGG - Intergenic
1180743663 22:18072058-18072080 TCTTTTTGCAGGCCTGGGCCAGG + Intergenic
1182527736 22:30931998-30932020 TCTTCACTGTTGCCTGGGACAGG + Intronic
1183253264 22:36744800-36744822 TCTTCCTTTTACCCTGGGACAGG + Intergenic
1183376383 22:37467792-37467814 GCTTCTTTCTGGGCTGGCCCAGG - Intergenic
1183980959 22:41539838-41539860 TCATCTGGCTGGCCTGGGGCTGG - Intronic
1185052635 22:48561892-48561914 AGTCCTTTCTGTCCTGGGACTGG + Intronic
949806873 3:7964950-7964972 GCTGCTCTCTGGGCTGGGACTGG + Intergenic
950287372 3:11755404-11755426 TCTTCTTTCTCTCCTGCAACAGG - Intergenic
951764741 3:26185205-26185227 CCTTGTTTCTGACCTTGGACTGG - Intergenic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
957499240 3:81032526-81032548 ATTTCTTTCTGGCCAGAGACTGG - Intergenic
960753569 3:120983140-120983162 GCTTCTTTCTGGCCTGAGGGTGG + Intronic
963638385 3:147827874-147827896 TCTTCTTTCTTGCCTTTGCCTGG - Intergenic
964887126 3:161497126-161497148 TCTCCTTTCTGCCCGGGTACAGG - Exonic
965095168 3:164216761-164216783 TTTTGTGTCTGACCTGGGACAGG + Intergenic
965590793 3:170358193-170358215 TCTTCGTTCTGGCCCGGGGCTGG + Intronic
966882751 3:184359382-184359404 TCTTCTCACAGGCCTGGGGCTGG + Intronic
967280899 3:187822637-187822659 TCTTCCTTCTGGCCTAGGCCAGG + Intergenic
969276276 4:6137881-6137903 TCTCCTTCCTGGCATGGGCCTGG + Intronic
972181931 4:36477478-36477500 TCTTCTCATTGGCCTGTGACTGG - Intergenic
980016805 4:127659201-127659223 TCTTCTTACAGGCCATGGACAGG - Intronic
980124166 4:128757656-128757678 TCTTCTTTCTTGCCTTCTACAGG - Intergenic
980133679 4:128840549-128840571 TCTTCTTTCAGGCTGTGGACCGG + Intronic
980525956 4:133991680-133991702 TTTTGTGTCTGACCTGGGACAGG + Intergenic
980629203 4:135411300-135411322 TTTTGTATCTGACCTGGGACAGG - Intergenic
980646715 4:135652227-135652249 TCTCCTCTCAGGCCTAGGACAGG - Intergenic
981015385 4:139968898-139968920 TCTGCTTGCTACCCTGGGACTGG - Intronic
981564847 4:146089207-146089229 CCTTCTTTCTGGCTTGGAAGTGG + Intergenic
981747612 4:148066717-148066739 TCTTCTGTGTGACCTGGGACAGG + Intronic
985525669 5:400243-400265 TATTTTTTCTGCCCTGGAACTGG + Intronic
986025122 5:3843369-3843391 TCTTATTTCATGCCAGGGACAGG - Intergenic
986185145 5:5428719-5428741 TTTGCTTGCTGGCCTGGGAGTGG + Intronic
986640277 5:9864986-9865008 TCTTCTTTCTTCCTTGGGTCAGG + Intergenic
986961821 5:13222137-13222159 TCTTCTGTCTGCTCTGGGGCGGG - Intergenic
987286827 5:16465662-16465684 TCTTATTTCTCGCCTGGCAATGG - Exonic
987498588 5:18675633-18675655 TCTTCTTTCTGGTCTGAAAATGG + Intergenic
987545414 5:19305968-19305990 TCCTCTTTGTGGTCTAGGACAGG - Intergenic
987556532 5:19458193-19458215 CCTTCTTTCTGGCTTGGAAATGG + Intergenic
987953109 5:24701889-24701911 TCTCCTTTCTGGCCCAGGGCAGG + Intergenic
988435959 5:31175877-31175899 TCATCTCTCTCTCCTGGGACAGG - Intergenic
988598560 5:32617913-32617935 TTTTCCTTCTGGCCAGGCACAGG + Intergenic
989028575 5:37093074-37093096 TTTTGTGTCTGACCTGGGACAGG - Intergenic
992107366 5:73461011-73461033 TCCTCCTTCTTACCTGGGACTGG + Intergenic
992260663 5:74966925-74966947 TCTGCTTTCTGGCCTGAAAGTGG + Intergenic
994019993 5:95011962-95011984 GTTTATTTCAGGCCTGGGACAGG - Intronic
998416081 5:141946819-141946841 TCTACCATCAGGCCTGGGACTGG - Intronic
999121511 5:149213105-149213127 TCATTTTTCTTGCCTCGGACAGG - Intronic
999444479 5:151628354-151628376 TCTCCTTCCTGCCCTGGGAGGGG - Intergenic
999665778 5:153911324-153911346 TCTTGTTTCTGACCTTGGACAGG - Intergenic
1001260879 5:170227517-170227539 TCTCCTCTCAGGCCTGGCACAGG - Intergenic
1001951304 5:175818396-175818418 GCTTCCTCCTAGCCTGGGACAGG - Intronic
1002063876 5:176642752-176642774 TCTTCGTGCAGGCCTGGGGCTGG - Exonic
1002601456 5:180356245-180356267 TCTCCTTTCTGGGCTGCCACCGG - Intergenic
1002872187 6:1177094-1177116 TCTGCTTCCTGGCGTGGGAGAGG + Intergenic
1006534319 6:34685821-34685843 TCATGTTTCTGCTCTGGGACTGG - Intronic
1007713355 6:43838681-43838703 TCTTCTGGCTGCCCTGGGCCTGG - Intergenic
1008288866 6:49687845-49687867 TCTGCTTTCTGGATTGGGGCAGG + Intergenic
1010474875 6:76274821-76274843 TCTCCTCTCTGGCCCAGGACTGG + Intergenic
1010947543 6:81995646-81995668 TCTTCTCTCTGATCTGGCACAGG + Intergenic
1011104085 6:83759340-83759362 TTTTGTTTCTGGCCTGGGTTAGG - Intergenic
1013415674 6:109922425-109922447 CCTTCTTCCTGGCGTGGAACAGG + Intergenic
1013638946 6:112054384-112054406 TCTGCTTGCTGGCCTGGCACAGG + Exonic
1014083861 6:117318805-117318827 TCTTCATTCGGGCCAGGGAGAGG - Intronic
1014535089 6:122605317-122605339 TCTTCTTTCTGCTCCAGGACAGG - Intronic
1016130158 6:140458164-140458186 TCATCTCTCTGCCCTGGGAAAGG + Intergenic
1016391138 6:143577239-143577261 TCTTTTTTGTTGCCTGGCACAGG - Intronic
1017693861 6:156994724-156994746 TCTTCTGTCTGGTCTTGGACAGG - Intronic
1017827371 6:158091912-158091934 TCTTCTTGCTTTCCAGGGACTGG + Intronic
1019292114 7:255958-255980 TCTTCCTCTTGGCCAGGGACAGG - Exonic
1019572638 7:1720061-1720083 TCTTATTTCTGGGCTGAGAAAGG - Intronic
1021939004 7:25660740-25660762 TGTTTTTTCTGGCTTGGGACAGG + Intergenic
1023266517 7:38411696-38411718 TCTGATTTCTGGGGTGGGACTGG + Intronic
1023492588 7:40760178-40760200 TCCTCTTGCTGACCTGGGGCTGG + Intronic
1025239205 7:57257189-57257211 GCTGTGTTCTGGCCTGGGACAGG + Intergenic
1026835943 7:73639177-73639199 GTTTCTTCCTGGCCTGGGATGGG - Intergenic
1027771210 7:82408673-82408695 TCTTCCTTCTAACCTTGGACTGG + Intronic
1028020449 7:85764900-85764922 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1032207418 7:129879961-129879983 TTTTCTTTTTGGCCTTGGAGGGG - Intronic
1032967929 7:137122964-137122986 ACTTCTTTCTAGCCTGGGGCAGG + Intergenic
1033607825 7:142940342-142940364 TCTTGATTCTGGTCTGGAACAGG - Exonic
1033685722 7:143639760-143639782 CCTTCTTTGAGGCCTGGGGCTGG - Intronic
1033690021 7:143727555-143727577 CCTTCTTTGAGGCCTGGGGCTGG + Intronic
1033698892 7:143817861-143817883 CCTTCTTTGAGGCCTGGGGCTGG + Intergenic
1034556570 7:151854120-151854142 TCTTCTCTCTGGCCCGTGATGGG - Intronic
1034625101 7:152486416-152486438 TCTTTTTTTTGGCGGGGGACAGG - Intergenic
1035070804 7:156143814-156143836 CCTTCCTGCTGGGCTGGGACAGG - Intergenic
1036383320 8:8254455-8254477 TCTTCTTCCTGGGCGGGGCCTGG + Intergenic
1037578693 8:20231690-20231712 TCTTCTTTCTGTTCAGGGCCAGG - Intergenic
1041402635 8:57461351-57461373 TTTTATGTCTGACCTGGGACAGG - Intergenic
1042607122 8:70556657-70556679 TCTTTATTCTGGCCTGGCGCAGG + Intergenic
1042809780 8:72811732-72811754 GTTTCTTTCTGGCTTTGGACAGG - Intronic
1044445306 8:92268434-92268456 TATTCTTTCTGTCCTGAAACTGG - Intergenic
1049995704 9:1031967-1031989 CCTTCTCTGTGGCCTGGCACGGG + Intergenic
1050212367 9:3275330-3275352 TCTTCTTTCTGGTCTCAGAGTGG - Intronic
1050925148 9:11255560-11255582 TTTTTTATCTGACCTGGGACAGG + Intergenic
1052833044 9:33231010-33231032 TCTACTTTCTGACCAGGGAAGGG - Intronic
1053204060 9:36171664-36171686 TCCTCTCTCAGACCTGGGACGGG - Intergenic
1055245638 9:74239207-74239229 GCTTCTTCCAGGTCTGGGACAGG + Intergenic
1056338852 9:85603727-85603749 GCTCCTCTCTGGCCTGGGGCAGG - Intronic
1056602478 9:88056974-88056996 TCTTCTTTCTTTTCTGAGACAGG + Intergenic
1056606456 9:88089746-88089768 TCTTGTTTCTGGATGGGGACTGG + Intergenic
1056666596 9:88585979-88586001 TCTTCTTTCTGCCCTTTCACAGG + Intergenic
1056890694 9:90488950-90488972 CCTTCCTTCTGACCTGGGCCTGG - Intergenic
1056951603 9:91044583-91044605 TCTCCTTTTTGGCCTGGCCCAGG - Intergenic
1057290269 9:93801913-93801935 TCTTCATCCTGCCCTGGAACTGG - Intergenic
1057959277 9:99438961-99438983 TCTTTTTTTAGGCCTGGGCCTGG + Intergenic
1058972438 9:110095870-110095892 TCCTCTTTTGGGGCTGGGACTGG + Intronic
1059167548 9:112093426-112093448 TCTGCTTTTCGGCCTGAGACTGG + Intronic
1059305225 9:113348693-113348715 TTTTCTTTCTGGGGTGGGAGTGG + Intergenic
1059548164 9:115200124-115200146 TGCTCTTTCTGGTCTGGGAAAGG - Intronic
1060816813 9:126639349-126639371 TCATCTGTCTGGCCTGGAGCAGG + Intronic
1060937535 9:127524395-127524417 TCTTCTTTCTGCCCTGGCTCTGG + Intronic
1061189621 9:129074631-129074653 GCTTGATGCTGGCCTGGGACTGG - Intergenic
1062076034 9:134590458-134590480 TGTTCTTGCAGGCCTGGGACTGG + Intergenic
1062312208 9:135944897-135944919 GCTTCTCTCTCTCCTGGGACAGG + Intronic
1062330918 9:136044607-136044629 GCTGCCTTGTGGCCTGGGACGGG - Intronic
1062429164 9:136519323-136519345 TAGTCTGCCTGGCCTGGGACAGG + Intronic
1185608625 X:1381111-1381133 TGTTTTTTCTGCCTTGGGACGGG + Intronic
1186206821 X:7209161-7209183 TCTTCTTTCTGTTTTGGGACTGG + Intergenic
1186930353 X:14382543-14382565 TCTTATTTCTAAGCTGGGACTGG + Intergenic
1187225464 X:17372196-17372218 TCTTCCTTCTGGGCTGGAGCAGG + Intergenic
1188085857 X:25899989-25900011 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1188832533 X:34917527-34917549 GCTACTTTCTGGGCTGGTACGGG + Intergenic
1188993046 X:36847519-36847541 GCTACTTTCTGGGCTGGTACTGG - Intergenic
1191065743 X:56345355-56345377 TCTTCTCTCTGGCTTGGGTTTGG - Intergenic
1191210322 X:57877596-57877618 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1192727125 X:73765307-73765329 TTTTCTTGCTGGCCTGGCAGGGG - Intergenic
1195570680 X:106395458-106395480 TCCTCTATGTGGCCTGGGACTGG + Intergenic
1198694241 X:139318917-139318939 TCTTCTTTCTGACCTGACACTGG - Intergenic
1200003031 X:153071974-153071996 TCTGCGTTCTGGCCAGGGTCAGG - Intergenic
1200004692 X:153078035-153078057 TCTGCGTTCTGGCCAGGGTCAGG + Intergenic
1200823937 Y:7619899-7619921 TTTTGTGTCTGACCTGGGACAGG + Intergenic
1201055031 Y:9979918-9979940 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1202191369 Y:22249537-22249559 TTTTGTGTCTGACCTGGGACAGG + Intergenic
1202192790 Y:22261436-22261458 TCCTCTTTGTGGTCTAGGACAGG - Intergenic
1202236118 Y:22711189-22711211 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1202307045 Y:23484979-23485001 TTTTGTGTCTGACCTGGGACAGG + Intergenic
1202563760 Y:26185607-26185629 TTTTGTGTCTGACCTGGGACAGG - Intergenic