ID: 1091445555

View in Genome Browser
Species Human (GRCh38)
Location 12:542647-542669
Sequence GAGCCAGCACTCTGAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091445555_1091445559 -3 Left 1091445555 12:542647-542669 CCACCCACTCAGAGTGCTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1091445559 12:542667-542689 CTCCTGCCTTCCCCCTTTCTGGG 0: 1
1: 1
2: 6
3: 67
4: 501
1091445555_1091445558 -4 Left 1091445555 12:542647-542669 CCACCCACTCAGAGTGCTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1091445558 12:542666-542688 GCTCCTGCCTTCCCCCTTTCTGG 0: 1
1: 0
2: 2
3: 33
4: 363
1091445555_1091445560 -2 Left 1091445555 12:542647-542669 CCACCCACTCAGAGTGCTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1091445560 12:542668-542690 TCCTGCCTTCCCCCTTTCTGGGG 0: 1
1: 1
2: 4
3: 41
4: 409
1091445555_1091445569 18 Left 1091445555 12:542647-542669 CCACCCACTCAGAGTGCTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1091445569 12:542688-542710 GGGAAGGGAGCCCTCTGCTCAGG 0: 1
1: 0
2: 4
3: 36
4: 277
1091445555_1091445562 2 Left 1091445555 12:542647-542669 CCACCCACTCAGAGTGCTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1091445562 12:542672-542694 GCCTTCCCCCTTTCTGGGGAAGG 0: 1
1: 0
2: 2
3: 26
4: 227
1091445555_1091445570 19 Left 1091445555 12:542647-542669 CCACCCACTCAGAGTGCTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1091445570 12:542689-542711 GGAAGGGAGCCCTCTGCTCAGGG 0: 1
1: 0
2: 0
3: 28
4: 259
1091445555_1091445564 3 Left 1091445555 12:542647-542669 CCACCCACTCAGAGTGCTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1091445564 12:542673-542695 CCTTCCCCCTTTCTGGGGAAGGG 0: 1
1: 0
2: 0
3: 28
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091445555 Original CRISPR GAGCCAGCACTCTGAGTGGG TGG (reversed) Intronic
900661951 1:3789206-3789228 GAGCCAGGGCTCTGACAGGGAGG - Intronic
901400951 1:9014884-9014906 GAGACGGCCCTCTGAGCGGGTGG - Intronic
901436621 1:9250677-9250699 AAGCCAGCACCCTGAGTGCTGGG + Intronic
905823188 1:41009919-41009941 GAACCAGTACTCAGAGTTGGTGG + Intronic
905828298 1:41044162-41044184 GGGCCAGGACTCTAAGTGGTAGG + Intronic
913175362 1:116268167-116268189 AAGCCAGCACAATGAGTGGTGGG - Intergenic
914834928 1:151198963-151198985 GAGCCAGGCCGCTGAGGGGGAGG + Exonic
915666751 1:157451985-157452007 CAGCAAGCACTGTTAGTGGGTGG - Intergenic
918117390 1:181508836-181508858 GAGGCTCCCCTCTGAGTGGGAGG + Intronic
919804787 1:201375153-201375175 GAGCCAGGGCTCTGGTTGGGTGG + Intronic
921375248 1:214466572-214466594 GAGCCAGCAATCTTGCTGGGAGG + Intronic
1062916622 10:1245095-1245117 GGGCCAGGACACTGGGTGGGAGG + Intronic
1063525328 10:6779243-6779265 GTTCCTGGACTCTGAGTGGGTGG + Intergenic
1064252214 10:13715171-13715193 GAGCAAGAACCCTGGGTGGGAGG + Intronic
1064795204 10:19004309-19004331 AAGCCAGTTCTTTGAGTGGGGGG - Intergenic
1069686059 10:70319522-70319544 GAGAGAGGACTCTCAGTGGGAGG - Intronic
1069801902 10:71086870-71086892 GAGCCAGCGCTCAGGGTGGGAGG - Intergenic
1070172705 10:73944681-73944703 GGCCCCGCACTCTGAGTGGCCGG + Intergenic
1072533448 10:96341306-96341328 GGGCCAGGCCTCTCAGTGGGAGG - Intergenic
1072615535 10:97046876-97046898 GGGCCAGGACTCTGTGTGTGGGG - Intronic
1074410844 10:113227256-113227278 GGGCCAGCCCTCCAAGTGGGTGG + Intergenic
1074413067 10:113244230-113244252 AAGCCAGCCCACTCAGTGGGAGG + Intergenic
1077415640 11:2423100-2423122 GAGCCAGCCCCCTGAGGGGAGGG - Intergenic
1078326138 11:10382723-10382745 GAGCCAAGACTCAGAGTGGGAGG - Intronic
1078698760 11:13660743-13660765 GAGCCAGCACTTTGCATGGCTGG - Intergenic
1079560633 11:21814577-21814599 GAGCCAGCACTGAGAGGGGCTGG + Intergenic
1083364488 11:62133322-62133344 AAGCCAGCAGTCAGCGTGGGTGG + Intronic
1083793296 11:64999785-64999807 GAGCCAGCAGCCCCAGTGGGTGG + Intergenic
1088626383 11:111733311-111733333 GAGCCAGCACAGTGTCTGGGAGG + Intronic
1089387396 11:118077295-118077317 GAGCCAGCATGGTGAGTGTGGGG + Exonic
1091278236 11:134366838-134366860 GAGCCAGTACCCAGGGTGGGGGG + Intronic
1091445555 12:542647-542669 GAGCCAGCACTCTGAGTGGGTGG - Intronic
1091473544 12:751991-752013 GAGCCTGAGCTCTGAGTCGGAGG - Intergenic
1091752633 12:3032357-3032379 GAGCTCGCACTCTGGATGGGAGG + Intronic
1092732455 12:11547371-11547393 GACCCAGCACTCGGAGCGGCAGG + Intergenic
1096800529 12:54107388-54107410 GAGCCAGCCCTTTGAGTGCAGGG - Intergenic
1097287326 12:57888291-57888313 CAGGCAGCACTCTTGGTGGGAGG + Intergenic
1098358269 12:69631091-69631113 TACCCAGCACTGTCAGTGGGGGG + Intergenic
1101333895 12:103779471-103779493 CAGCCAACACTCTGAGAGGGAGG + Intronic
1103423978 12:120815139-120815161 GAGCCAGCAATCTGACTTTGAGG - Intronic
1103722707 12:122983103-122983125 GAGCCAGCTCTCTGGGTTTGGGG - Intergenic
1103739576 12:123082127-123082149 AGGCCCTCACTCTGAGTGGGTGG - Intronic
1113300187 13:109011067-109011089 GAGCCAGCACTCCCAGTAAGGGG + Intronic
1114365975 14:22027369-22027391 GGGCCAGCAGTATGACTGGGAGG + Intergenic
1116798885 14:49421478-49421500 GAACCAGCTCTCAGGGTGGGGGG + Intergenic
1117414260 14:55479225-55479247 GACCCAGCACTCCCAGTGAGAGG - Intergenic
1117455842 14:55896251-55896273 CAGCCAGCCCTCGGAGGGGGAGG + Intergenic
1122353755 14:101111758-101111780 GAGCCTCCTCTCTGAGTGCGAGG + Intergenic
1122702254 14:103597865-103597887 GAGCAAGTGCTCTGAGTGGGAGG - Intronic
1124511544 15:30331601-30331623 GAGCCAGCCCTCTGGGCGTGTGG + Intergenic
1124731370 15:32199156-32199178 GAGCCAGCCCTCTGGGCGTGTGG - Intergenic
1127234325 15:57031909-57031931 GAACCAAAACTCTGAGGGGGAGG + Intronic
1127854468 15:62943145-62943167 GTGCTAGCAGGCTGAGTGGGAGG + Intergenic
1128755566 15:70181312-70181334 AAGCCGACACTCTGAGTGTGGGG - Intergenic
1129105334 15:73303293-73303315 AATCCATCACTCTGAGGGGGAGG + Exonic
1129412780 15:75359143-75359165 GAGCCATCAGTCTTTGTGGGAGG + Exonic
1129717009 15:77858361-77858383 GGGCCAGCACTCTCTGTTGGTGG - Intergenic
1132676104 16:1121869-1121891 GAGAAAGCACTCTGTGTGTGAGG + Intergenic
1135182735 16:20289793-20289815 GAGCCAGCACAGTGTGTGGGAGG - Intergenic
1142010211 16:87710019-87710041 GAGCCAGCACTGTGGGTGATTGG - Intronic
1142070083 16:88087084-88087106 GAGTCAGCTCTCTGAGTGCTTGG + Intronic
1142182552 16:88678353-88678375 GAGCCAGGAGTCTGGGAGGGCGG - Exonic
1142966885 17:3587200-3587222 TATCCAGCACTCTGAGTTGGAGG + Intronic
1142978515 17:3658766-3658788 GGGCCAGCGTTCTGACTGGGAGG + Intronic
1143097858 17:4488064-4488086 CTGTCAGCACTCTGCGTGGGAGG + Exonic
1143460525 17:7100837-7100859 GACCCCGCACTCGGAGTGGCCGG - Intergenic
1144590248 17:16517629-16517651 GCCCCAGCACAGTGAGTGGGAGG - Intergenic
1148442846 17:47720743-47720765 GAGCCAGTTTTCTGAGAGGGAGG + Intergenic
1148888000 17:50787357-50787379 GAGCCCAGAGTCTGAGTGGGAGG + Intergenic
1148904710 17:50904894-50904916 CAGCAAGCTCTCAGAGTGGGGGG + Intergenic
1148922131 17:51046917-51046939 AAGCCAGGACTCTTAGTGGAGGG - Intronic
1149202238 17:54200581-54200603 GAGAAAGCACTCTGTATGGGGGG + Intergenic
1150221054 17:63496153-63496175 GAGGCAGCTCTGTGGGTGGGAGG + Intronic
1151798842 17:76365376-76365398 CAGCCAGCCCCCTCAGTGGGTGG - Intronic
1152419187 17:80182921-80182943 GCCCCAGCACTCTGAGGGTGAGG + Intronic
1152567208 17:81105668-81105690 CAGCCATCACTCTGAGGAGGGGG + Intronic
1152727891 17:81956638-81956660 GACCCTGCGCTGTGAGTGGGCGG - Exonic
1152829962 17:82491095-82491117 GAGGCAGCACGCTGGTTGGGGGG + Intergenic
1153074579 18:1148124-1148146 GAGCCAGCAAACTGGGTGGCAGG + Intergenic
1153448007 18:5195930-5195952 CAGCTAGCATTCTGAGGGGGAGG + Intronic
1158670827 18:59472190-59472212 GACCCAGCACTCTGAGGAAGAGG - Intronic
1158929647 18:62311030-62311052 GAGCAAGCACTTTGAGGGAGGGG - Intergenic
1164495244 19:28754508-28754530 GAGGCTGCACTGTTAGTGGGTGG - Intergenic
1164581954 19:29440098-29440120 GGGCCCGCACTCTGAGCGGCCGG + Intergenic
1165725793 19:38111696-38111718 GAGCCAGCACACTGCATGGCAGG + Intronic
1165846565 19:38821575-38821597 GACCCCGCACTCGGAGTGGTGGG + Intronic
1166052527 19:40268749-40268771 GAGGCACCACCCTCAGTGGGAGG - Intronic
1167349060 19:48963671-48963693 GAGCCACCACCCAGAGTGAGGGG + Intergenic
1167506433 19:49873356-49873378 GGGCGGGCACTCTGAGTGGGTGG - Intronic
1167517152 19:49930014-49930036 GAGGCAACCCTCTAAGTGGGTGG + Intronic
925380337 2:3420544-3420566 GAGCCTGCAGTGTGAGTGTGAGG + Intronic
926623344 2:15068509-15068531 AAGCCTGCATTGTGAGTGGGTGG - Intergenic
927177794 2:20422543-20422565 GGGCCAGGACTCTGAGTGGGGGG - Intergenic
927995653 2:27483927-27483949 GTGACAGCACTCTGCGTGGAAGG + Exonic
928238245 2:29564051-29564073 GAGCCAGCAATCTGAGAAGATGG - Intronic
928462306 2:31485992-31486014 GAGACAGCGCTCTCAGTGGGAGG - Intergenic
929141388 2:38669630-38669652 ATCCCAGCACTCTGGGTGGGTGG + Intronic
931291463 2:60877700-60877722 GAGGCAGCCTTCTGAGTGGCTGG + Intergenic
932048679 2:68377283-68377305 GACCCAGCAATCTCACTGGGGGG - Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
933811834 2:86037408-86037430 GAGCCAGCCCTCTGTGCAGGTGG - Intronic
934028328 2:88018897-88018919 GTGCCAGCACTTGGAGTGGCTGG - Intergenic
935367153 2:102306843-102306865 GAACAAGCATTCTGAGTGAGGGG + Intergenic
935710681 2:105895454-105895476 GAGCCACTAGTCAGAGTGGGAGG + Intergenic
937061250 2:118981981-118982003 GAGCTAGCCCTCTTAGTAGGAGG - Intronic
937913653 2:127088385-127088407 GAGCCAGCACTCTAGGAGGGAGG + Intronic
940442684 2:153736892-153736914 GAAACTGCACTCGGAGTGGGTGG - Intergenic
941879233 2:170464514-170464536 GAGCCAGCACTCTGGATAGAAGG + Intronic
943611999 2:190045089-190045111 GGGACAGCACTCTTAGAGGGAGG - Intronic
946160013 2:217830289-217830311 ATGCCGACACTCTGAGTGGGAGG + Intronic
947996240 2:234530118-234530140 GAGGCTGCACTCTGTGTGTGTGG + Intergenic
948162133 2:235833543-235833565 TAGCAAGCACTCTGAGGAGGGGG - Intronic
948410844 2:237759332-237759354 GTGGCAGCACTCTGGGTGGGGGG + Intronic
948587095 2:239026339-239026361 GAGTGTGCACTCTGAGTGGTGGG - Intergenic
948753043 2:240143501-240143523 GAATCAGAACTCTGAGTGGGAGG - Intronic
948849763 2:240699863-240699885 GAGCCAGCTCTCTGCCTGTGTGG - Intergenic
1169297860 20:4415342-4415364 GAGCCAGCACACTGAGCAGATGG - Intergenic
1170519154 20:17165883-17165905 GAGCCAGCAAACTGACAGGGTGG + Intergenic
1170565799 20:17603584-17603606 GTGCAAGCAGTCTGAGTGGGAGG + Intronic
1171795923 20:29566964-29566986 GAGCCAGCCCTTTGAGTGCAGGG + Intergenic
1171852311 20:30317193-30317215 GAGCCAGCCCTTTGAGTGCAGGG - Intergenic
1173322222 20:41998403-41998425 GAGGCAGCGCTCTGAGCTGGAGG - Intergenic
1173572371 20:44085745-44085767 ATCCCAGCACTCTGAGTGGCAGG - Intergenic
1174874427 20:54211637-54211659 GAGGCAGCACACAGAGTGGTGGG - Intronic
1175491436 20:59383406-59383428 GAGCCAGCACTCAGGGTGCCTGG + Intergenic
1175579596 20:60088295-60088317 GGGCAAGCCCTCTGTGTGGGTGG + Intergenic
1176722441 21:10403218-10403240 GAGCCTGCACACTGCGTGGAAGG + Intergenic
1177722459 21:24926310-24926332 GAGCCATCTGTCTGACTGGGAGG - Intergenic
1178711612 21:34922153-34922175 GAGACAGGACTGTAAGTGGGGGG + Intronic
1179729517 21:43359986-43360008 GAGCCGGCACCCAGAGTGGCGGG + Intergenic
1179929661 21:44558795-44558817 GTGCCAGGCCTCTGAGTGGTCGG + Intronic
1180015822 21:45082942-45082964 GAGCCAGGGCTCTGAGTGGCAGG - Intronic
1180303624 22:11055980-11056002 GAGCCTGCACACTGCGTGGAAGG + Intergenic
1180842767 22:18966970-18966992 TTCCCTGCACTCTGAGTGGGCGG - Intergenic
1180964144 22:19776954-19776976 GGGCCAGCACACGGGGTGGGAGG + Intronic
1181003732 22:19999718-19999740 GGGCCGGGACCCTGAGTGGGAGG + Intronic
1181058681 22:20271764-20271786 TTCCCTGCACTCTGAGTGGGCGG + Intronic
1182321973 22:29483520-29483542 GAGGCAGCGCTCTGAGCTGGAGG + Exonic
1182785620 22:32905334-32905356 GAGCCTGCAATCTAGGTGGGAGG + Intronic
1182925581 22:34121024-34121046 GAGCCAACATTCTGAGGGAGGGG - Intergenic
1182959564 22:34459364-34459386 GACCCAGTACTGTGAGTGGCTGG - Intergenic
1183211591 22:36454885-36454907 GAGCCAGGAGTCGGGGTGGGAGG - Intergenic
1184877458 22:47284553-47284575 GAGCAGGGACTCTGTGTGGGGGG - Intergenic
1185018873 22:48361918-48361940 CAGCAAGCACTCTGCTTGGGTGG - Intergenic
1185346231 22:50312015-50312037 GAGCCTGCAGTCTGGGCGGGGGG + Exonic
949131144 3:502692-502714 GAGCCAGCCTCCTGAGTGAGTGG - Intergenic
949921007 3:9000433-9000455 GAGCCAGGACTCTGAGACTGGGG - Intronic
950454195 3:13082932-13082954 GAGCCAGCAGTGAGTGTGGGAGG - Intergenic
950842353 3:15979675-15979697 GAGCAAGCATTCTAAGAGGGAGG + Intergenic
952150018 3:30579007-30579029 GAGCAAGCACTTTGAGGGAGGGG - Intergenic
952360450 3:32625719-32625741 GCCCCCGCACTCTGAGTGGCTGG + Intergenic
952855109 3:37763880-37763902 AAGCCAGCTCTCTGGGTGAGAGG + Intronic
954322534 3:49841899-49841921 GAGCCAGCGCCCTGAGGTGGAGG - Exonic
961451999 3:127006441-127006463 GAAGCAGCAGTCAGAGTGGGCGG + Intronic
964679538 3:159322486-159322508 CATTCAGCACTCTGGGTGGGTGG - Intronic
965714299 3:171586335-171586357 GACCCAGACCTCTGAGGGGGTGG - Intergenic
967136741 3:186519113-186519135 GAGCCAGGAATCAGAGTGTGGGG - Intergenic
967401813 3:189071205-189071227 CAGCCATCACTATGTGTGGGTGG + Intronic
967753868 3:193146418-193146440 GAACCAGCCCTCTGTGTAGGAGG + Intergenic
968589062 4:1448736-1448758 GAGCCATCACTCGGAGTGTTAGG - Intergenic
970272107 4:14358745-14358767 CGGCCAGCACTCCGAGTGCGGGG - Intergenic
981132971 4:141178881-141178903 GAGCCAGCATTCTAGGTGGTAGG - Intronic
982692762 4:158567021-158567043 TGGCCAGCACTCGGAGTGGCCGG + Intronic
983510832 4:168608026-168608048 GAGCCAGCTCTTTAAGTGGTGGG - Intronic
987020909 5:13870256-13870278 TAGCCAGCACTCTCAGTAGTCGG - Intronic
987165190 5:15190670-15190692 GAGCCTGGACTCAGAGTGGACGG + Intergenic
987649291 5:20719544-20719566 GAGCCAACACTCAGAATAGGTGG - Intergenic
990042184 5:51388808-51388830 GAGCCTGCACTCTGCTTGTGGGG + Intronic
990891195 5:60652047-60652069 GAGCAAGCACTTTGAGGGAGGGG + Intronic
992499492 5:77327871-77327893 GAGCCCTCACACTGTGTGGGGGG - Intronic
994809021 5:104489143-104489165 GAGTCAGCTCTCTGTGTTGGCGG - Intergenic
996585987 5:125088782-125088804 GGGCCAGCACTCGGAGGGGCGGG + Intergenic
997400080 5:133595536-133595558 AAGGCAGCCCTCAGAGTGGGAGG - Intronic
999196369 5:149784290-149784312 GAGCGTGGCCTCTGAGTGGGAGG - Intronic
999310438 5:150548345-150548367 GAGCCAGCGCTCGATGTGGGTGG - Exonic
999910554 5:156193697-156193719 GTTCCATCTCTCTGAGTGGGTGG - Intronic
999997829 5:157109095-157109117 GAGCTAGCACTCAGTGGGGGCGG - Exonic
1000303540 5:159975874-159975896 GACCCAGCAGTCTGGGTGGCTGG - Intergenic
1000792519 5:165625094-165625116 TAGCCAGCACTGAGATTGGGAGG + Intergenic
1001109399 5:168883415-168883437 GAGGCAGCAGCCTGGGTGGGGGG - Intronic
1001455990 5:171859939-171859961 GAGCCATCACGCCCAGTGGGAGG - Intergenic
1001684285 5:173581819-173581841 GAGGGCGCACTCTGAGTAGGCGG - Intergenic
1002599866 5:180347968-180347990 CAGCCCTCACTCTGAGTGAGGGG + Intronic
1003166037 6:3679432-3679454 CAGCCTGAACCCTGAGTGGGAGG - Intergenic
1003508604 6:6760730-6760752 GAGTCTGCAGTCTGAGTTGGTGG - Intergenic
1004908504 6:20259647-20259669 GGGCCGGCACTCGGAGTGGCCGG + Intergenic
1005836592 6:29714068-29714090 GAGGAAGCACTCTGAGGGGTGGG + Intergenic
1005845264 6:29772032-29772054 GAGGAAGCACTCTGAGGGGTGGG + Intergenic
1005857429 6:29873133-29873155 GAGGAAGCACTCTGAGAGGTGGG + Intergenic
1005874768 6:30002489-30002511 GAGGAAGCACTCTGAGGGGTGGG + Intergenic
1006190068 6:32202165-32202187 AAGCCAGCACCGAGAGTGGGAGG + Exonic
1006273282 6:32980832-32980854 GAGCCAGCTCTCCTAGAGGGGGG - Exonic
1007107838 6:39295652-39295674 GGACCAGCACTGTGTGTGGGTGG + Intergenic
1007191445 6:40022319-40022341 GACCGAGCACTCAGGGTGGGTGG - Intergenic
1007351958 6:41280622-41280644 GGGAAAGCACTCTGAGTGAGGGG - Intronic
1010508988 6:76694195-76694217 GAACCAGCAGTCTGAGTCAGGGG - Intergenic
1013127745 6:107201413-107201435 AAGCCAGCACTCTGATTGAGAGG + Intronic
1015913117 6:138187850-138187872 GAGCCAGCAGTATGTGTAGGTGG + Intronic
1018867969 6:167760062-167760084 GAGTCAGCACTCTGGCAGGGTGG + Intergenic
1019843475 7:3473733-3473755 GAGCCAGGGCTCTGTGTAGGAGG - Intronic
1019971361 7:4543466-4543488 GAGCCAGCAGGCTGAGCAGGAGG - Intergenic
1023793012 7:43768851-43768873 GCGCCAGCACTCTAAGTAGGAGG - Intronic
1024856907 7:53793652-53793674 CAGCTACCATTCTGAGTGGGTGG - Intergenic
1029395961 7:100308861-100308883 AAGCCAGCAGTCTGAGAGGCTGG + Intronic
1029396184 7:100310247-100310269 AAGCCAGCAGTCTGAGAGGCTGG + Intronic
1029396410 7:100311637-100311659 AAGCCAGCAGTCTGAGAGGCTGG + Intronic
1029396859 7:100314419-100314441 AAGCCAGCAGTCTGAGAGGCTGG + Intronic
1030082995 7:105793447-105793469 GAGCAAGGACTCTGTGTTGGAGG - Intronic
1032161574 7:129514868-129514890 GAGCCAGGACTGTGAGTGCTGGG + Intergenic
1032482496 7:132257981-132258003 AAGCCAGCTCTCTGAGATGGAGG + Intronic
1035350644 7:158243645-158243667 GAGCCTGCTCTCTGTGTGGATGG - Intronic
1036996910 8:13668399-13668421 GAGCCAGCATGCTAAGTTGGAGG - Intergenic
1037909609 8:22736141-22736163 CAGCCAGCTCTCTGAGTGTCAGG - Intronic
1039221784 8:35339765-35339787 GAGCCAGCACACTGAGAAGATGG + Intronic
1040594904 8:48827939-48827961 GAGGCAGCACTCAGTGTGGTCGG + Intergenic
1040976221 8:53197298-53197320 GAGCCAGAAAGCTGGGTGGGTGG + Intergenic
1042442106 8:68840632-68840654 GTGAGAGCACTCTCAGTGGGGGG - Intergenic
1043926983 8:86048562-86048584 GATCCAGGACTCTGAGAGTGGGG + Exonic
1044404876 8:91816443-91816465 GACCCCGCACTCGGAGTGGCCGG + Intergenic
1044547352 8:93474538-93474560 GAGCCAGAGCTCAGAGTGGCAGG + Intergenic
1044853565 8:96452412-96452434 GACCCAGCACTCGGAGCGGCCGG + Intergenic
1047324606 8:123824458-123824480 ATGCCAAGACTCTGAGTGGGTGG - Intergenic
1049543963 8:143220994-143221016 CATCCAGCACTCCGAGTGGGAGG + Intergenic
1049554249 8:143274310-143274332 GGGCCAGCACTTTGAGAGGCCGG + Intronic
1049820028 8:144627879-144627901 GAGCCAGCAGTCGGAGTGCCTGG - Intergenic
1049946806 9:605017-605039 GAGCCACCACTCTCAGCAGGAGG - Intronic
1053790096 9:41680471-41680493 GAGCCAGCCCTTTGAGTGCAGGG - Intergenic
1054178436 9:61892160-61892182 GAGCCAGCCCTTTGAGTGCAGGG - Intergenic
1054474833 9:65565394-65565416 GAGCCAGCCCTTTGAGTGCAGGG + Intergenic
1054659093 9:67688664-67688686 GAGCCAGCCCTTTGAGTGCAGGG + Intergenic
1055066032 9:72119393-72119415 TAGTCAGGAGTCTGAGTGGGAGG + Intronic
1056363032 9:85878014-85878036 ATCCCAGCACTTTGAGTGGGTGG - Intergenic
1056697082 9:88867907-88867929 GAGCCAGCAGACTAAGTGGGGGG + Intergenic
1056914002 9:90729552-90729574 GGGCCCGCACTCGGAGTGGCCGG + Intergenic
1057323088 9:94032158-94032180 GAGCCAACAGGATGAGTGGGTGG - Intronic
1059751297 9:117249960-117249982 GAACTAGCACTCAGAGTGGGCGG - Intronic
1061431378 9:130533413-130533435 GAGCCAGCACTGGGGCTGGGTGG + Intergenic
1061652172 9:132059561-132059583 GAGGCAGCAATCTGAGGGGCGGG + Intronic
1187146274 X:16640203-16640225 GAACCAGCACTCAGGGTGAGAGG - Intronic
1188185662 X:27111236-27111258 GAGCCAGCACTAAAAGTTGGTGG - Intergenic
1188820572 X:34770025-34770047 CTGCCTGCACTCTGTGTGGGAGG - Intergenic
1190099239 X:47508361-47508383 GAGCCACAACTCTGAGGGAGGGG - Intergenic
1193012497 X:76692574-76692596 GAGGCAGATCTCTGAGTGGCTGG - Intergenic
1193052019 X:77111682-77111704 GAGACAGAACTCCCAGTGGGAGG + Intergenic
1195410421 X:104564329-104564351 GAGCCAGCAGTCAGAGTGAGGGG - Intergenic
1201948748 Y:19540491-19540513 GGGCCAGCACTGGGTGTGGGCGG - Intergenic
1202025427 Y:20517851-20517873 GAGCCATCATCCTGAATGGGAGG - Intergenic