ID: 1091446739

View in Genome Browser
Species Human (GRCh38)
Location 12:548058-548080
Sequence CTGCACAAGCAGAATGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 317}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091446736_1091446739 -1 Left 1091446736 12:548036-548058 CCACAGGTACTACTTCGAGGTGC 0: 1
1: 0
2: 0
3: 7
4: 37
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317
1091446726_1091446739 27 Left 1091446726 12:548008-548030 CCCTCTCTCCCGCCAGCCTGTCA 0: 1
1: 0
2: 3
3: 46
4: 760
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317
1091446730_1091446739 15 Left 1091446730 12:548020-548042 CCAGCCTGTCAGCCTCCCACAGG 0: 1
1: 0
2: 1
3: 76
4: 574
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317
1091446727_1091446739 26 Left 1091446727 12:548009-548031 CCTCTCTCCCGCCAGCCTGTCAG 0: 1
1: 0
2: 2
3: 23
4: 329
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317
1091446728_1091446739 19 Left 1091446728 12:548016-548038 CCCGCCAGCCTGTCAGCCTCCCA 0: 1
1: 0
2: 4
3: 102
4: 973
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317
1091446729_1091446739 18 Left 1091446729 12:548017-548039 CCGCCAGCCTGTCAGCCTCCCAC 0: 1
1: 0
2: 9
3: 128
4: 706
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317
1091446732_1091446739 11 Left 1091446732 12:548024-548046 CCTGTCAGCCTCCCACAGGTACT 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317
1091446735_1091446739 0 Left 1091446735 12:548035-548057 CCCACAGGTACTACTTCGAGGTG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317
1091446733_1091446739 3 Left 1091446733 12:548032-548054 CCTCCCACAGGTACTACTTCGAG 0: 1
1: 0
2: 0
3: 6
4: 41
Right 1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG 0: 1
1: 1
2: 4
3: 30
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091446739 Original CRISPR CTGCACAAGCAGAATGAGGA GGG Exonic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900893894 1:5469589-5469611 GTGCCCACGCAGATTGAGGATGG - Intergenic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
908541395 1:65126034-65126056 CTGCCCAAGTTGACTGAGGAGGG + Intergenic
911503329 1:98716282-98716304 CTGCCCAAGTAGGATGAAGAGGG - Intronic
911541862 1:99165992-99166014 GGGCACAGGCAGAATTAGGAGGG - Intergenic
912153983 1:106893245-106893267 ATTCACAAGCAGAATTAAGAAGG + Intergenic
912778492 1:112522573-112522595 CTGCACAGGCAGCAGGAGGTTGG + Exonic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913969284 1:143402258-143402280 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914063661 1:144227857-144227879 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914115489 1:144738497-144738519 CTGGACAAGCAGATTGTGAAGGG - Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916270111 1:162931744-162931766 CTATACAGGCAGAATGAGCAGGG - Intergenic
916439644 1:164810550-164810572 CTGCACAAGCTGAAAGAAAAGGG - Intronic
916585926 1:166150073-166150095 CTGCATAGGGACAATGAGGATGG + Intronic
918132380 1:181641104-181641126 CTGCACAAGATGAATGAGAAAGG - Intronic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919944784 1:202311112-202311134 GAACACAAGCAGAATTAGGAGGG + Intronic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
922547524 1:226469500-226469522 CTGTACAAGCAGTATGATGCTGG - Intergenic
923718608 1:236448252-236448274 CAGCACAGCCAGAGTGAGGAAGG + Intronic
923789375 1:237098973-237098995 GTGCACAAGTACAATGAGGAGGG + Intronic
923980919 1:239322476-239322498 CTGCACAAGAAAAGTGAGGGAGG - Intergenic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1069177915 10:65316963-65316985 CTGCACAAAGAAAATGAGGAAGG + Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1071835927 10:89416647-89416669 CAGCCCAAGGAGGATGAGGAGGG - Intronic
1071945532 10:90639573-90639595 CTCCATTAGCAGAATGAAGAGGG + Intergenic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1073379885 10:103070066-103070088 CTGCACAAGGATAGTGAGAAGGG - Intronic
1073428297 10:103469731-103469753 CTGCCCAGGCAGCATGAGGGTGG + Intergenic
1073976224 10:109104561-109104583 ATGCCCAACCACAATGAGGAGGG + Intergenic
1074653547 10:115555735-115555757 ATGCACAAGCATAATGTGCATGG + Intronic
1074671373 10:115796008-115796030 GTGCCCAGGCAGAGTGAGGAGGG - Intronic
1078442208 11:11377457-11377479 CTTCCCCAGCAGAAAGAGGAAGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083690138 11:64402940-64402962 GTGCACAAGGAGAGTGAGGTTGG - Intergenic
1084001959 11:66300703-66300725 CTGCACAGCCAGGAAGAGGAGGG + Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087225351 11:95592600-95592622 CCGCACAAGAAGAATCTGGATGG - Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090552934 11:127842514-127842536 CTGGACAAGCAGAGTTAGGGTGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092522927 12:9292166-9292188 TTGCACCAGCTGTATGAGGAAGG + Intergenic
1092763898 12:11835462-11835484 CTGCATGGGCAGAATGAGGGAGG - Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1096755927 12:53799488-53799510 CTACACAAGCTGAAGTAGGAAGG + Intergenic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097492160 12:60283438-60283460 CTGCCAAAGCTGAATGAGCAAGG - Intergenic
1097880260 12:64680372-64680394 CTGCACAAGTGGAGTGGGGAAGG - Intronic
1099495347 12:83339829-83339851 CACCACAAGCAGATTGAAGAAGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1104429775 12:128706546-128706568 CTGCACAGGCAAAATTAGGAAGG + Exonic
1105340963 13:19525247-19525269 CTGCACAAAAAGAATGAAGCTGG + Intronic
1106113943 13:26801203-26801225 CTGCACCCGCAGTCTGAGGAGGG - Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1110692023 13:78442068-78442090 CTGCTCCAGCTGAATGAGGATGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114152861 14:20064322-20064344 CTGCACAAGCAGAATAACTCTGG - Intergenic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115919956 14:38361467-38361489 CTCCACAAGCTGAAAGAGGAAGG + Intergenic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1120707538 14:87760396-87760418 CTGCACAAGAAGCATGATGCTGG + Intergenic
1121122273 14:91383445-91383467 GTGCCCAAGCAGAAAGAGGGAGG - Intronic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1125609525 15:40961071-40961093 CTCCACAGGCAGCAAGAGGAAGG - Intergenic
1125818981 15:42611595-42611617 CTGGACAAGGACAATGAGGGTGG - Intronic
1126815879 15:52452659-52452681 CTGCCCATCCTGAATGAGGATGG - Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1135983730 16:27168501-27168523 CGGCCCATGCTGAATGAGGATGG + Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1140612774 16:76621260-76621282 CTGCACAAGACTCATGAGGATGG + Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142398980 16:89849302-89849324 CTGCCCAAGCTGGATCAGGACGG - Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143679357 17:8464918-8464940 CTCCTCAAGCAGGTTGAGGATGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1145303522 17:21656773-21656795 CTAGACAAGGACAATGAGGAGGG + Intergenic
1145346521 17:22045076-22045098 CTAGACAAGGACAATGAGGAGGG - Intergenic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1146543774 17:33720266-33720288 CTCCAGAAGCAGAATTAAGAAGG + Intronic
1146982414 17:37176805-37176827 CTGCACAACAGGAATGAGGTTGG - Intronic
1147166924 17:38598458-38598480 CTGCACAAGCAGAAACAGCTAGG + Intronic
1147252443 17:39161135-39161157 CTATACCAGCAGCATGAGGAGGG - Intronic
1152605744 17:81288883-81288905 CTGCACCAGCACGGTGAGGACGG + Intronic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1154338667 18:13485518-13485540 AGCCACAAGCAGCATGAGGATGG - Intronic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1155071403 18:22320135-22320157 CTGCACCTGCAGAGTGAGGCAGG + Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1156627875 18:38931575-38931597 CTGCACCTCCAGAAAGAGGAGGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160855332 19:1214740-1214762 CTGCACAGGCAGCAGGAGGTGGG + Intronic
1161180650 19:2879185-2879207 GTCCACAAGCAAAATGAAGAAGG - Exonic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1164533465 19:29065571-29065593 GTGCACAGGCAGGCTGAGGAGGG + Intergenic
1164534538 19:29075472-29075494 CTGCTCTAGCAGAGGGAGGAGGG + Intergenic
1165354102 19:35293215-35293237 CTGCACACACACACTGAGGATGG - Intronic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1166068122 19:40371990-40372012 CTGACCAAGCAGAATGAGCTGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
925922111 2:8645122-8645144 CTCCTCAAGCCGAGTGAGGAGGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928090924 2:28374704-28374726 CTGCCCAACCAGACTGAAGATGG + Intergenic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928626327 2:33143161-33143183 TTGCCCAAGCAGAATGGGTAGGG - Intronic
928875535 2:36034196-36034218 CAGCCCAAGCTGAATAAGGAAGG - Intergenic
929445852 2:42000647-42000669 CTGCTAAAGCAGAACCAGGAAGG + Intergenic
929448896 2:42023355-42023377 CTTTACAAGCAGCATGAGAATGG + Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
932647103 2:73513689-73513711 GAGCCCAAGCAGAATGAGGTAGG - Intronic
933785602 2:85838761-85838783 CTGCACAAGCAGTTGCAGGAAGG + Intergenic
934173977 2:89563159-89563181 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934284292 2:91637508-91637530 CTGGACAAGCAGATTGTGAAGGG + Intergenic
935695414 2:105766909-105766931 CTGCACAGGCAGCAGGAAGACGG - Intronic
936091024 2:109501576-109501598 GTGCACAAGAAGCGTGAGGACGG + Exonic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
937530876 2:122825576-122825598 CTACAAAATTAGAATGAGGATGG - Intergenic
937539487 2:122931077-122931099 TTGCCCAAACAAAATGAGGATGG - Intergenic
938792887 2:134692453-134692475 CAGCCCAAGCAGACTAAGGAGGG - Intronic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942738635 2:179146963-179146985 CTGCACAAGAAGTATGATTAGGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943046156 2:182864782-182864804 CTGCGCAAGTTGAAAGAGGAAGG + Intronic
944195593 2:197050029-197050051 CTGTACAAGAAGCATGAGGCTGG + Intronic
945109007 2:206344875-206344897 CTGTACAAGAAGAATGACGCTGG - Intergenic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
947127399 2:226884191-226884213 CTGCACAAGCAGAAGAGGAAAGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948599257 2:239099155-239099177 CTCCACCAGCAGAAGGATGAAGG - Intronic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
949058698 2:241944024-241944046 CTGCACATGGCGAGTGAGGAGGG + Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1170601371 20:17843858-17843880 GTTCACAAGCAAAATGAGGGAGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171521044 20:25774458-25774480 CTAGACAAGGACAATGAGGAGGG + Exonic
1171555880 20:26082021-26082043 CTAGACAAGGACAATGAGGAGGG - Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172451772 20:35030452-35030474 CAGCACAAAAAGAATGAAGATGG - Intronic
1172951888 20:38727569-38727591 CTGTACGAGGAGAATGAAGACGG + Exonic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175034290 20:55985122-55985144 GTGCCCAAGCAGGGTGAGGAAGG + Intergenic
1175629757 20:60525692-60525714 CTGCCCAAGCAGGAAGAGAAAGG - Intergenic
1175674455 20:60934730-60934752 CTGCAAACGGAAAATGAGGATGG - Intergenic
1175745234 20:61451835-61451857 CTGCACAACATAAATGAGGAGGG + Intronic
1176070568 20:63224178-63224200 CTCCACACGCAGAGTGAGCAGGG - Intergenic
1176654893 21:9579576-9579598 CTAGACAAGGACAATGAGGAGGG + Intergenic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1177397666 21:20558327-20558349 CTGCATAACCAGAATGGAGATGG - Intergenic
1179051962 21:37896020-37896042 CTGCACAGGAAGAATGATGCTGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179797299 21:43792664-43792686 CTACACAGGAAGAATTAGGAAGG + Exonic
1182021646 22:27086650-27086672 CTGCACAAGGAGATCGGGGACGG + Intergenic
1182143473 22:27982447-27982469 CGGCACAATAAGAAGGAGGAGGG - Exonic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951792957 3:26506885-26506907 CTCCACAAGCAGAGAGAGCAGGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955421270 3:58740373-58740395 CTGCTCAAGGAGCAAGAGGATGG - Intronic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
958636192 3:96750319-96750341 CTGCAAAGGCAGAGTGAGGGAGG - Intergenic
958788309 3:98623054-98623076 CTGTACAAGAAGCATGATGAGGG + Intergenic
959095122 3:101947346-101947368 CAGCACAATCTGAATGAGGCTGG + Intergenic
959696795 3:109256770-109256792 CTGCCCACCCAGAATGAGGGTGG + Intergenic
960822375 3:121748901-121748923 CTGCACAACCGGAATGTGAAAGG - Intronic
960829231 3:121828254-121828276 CTCCACAAGCTTAATGAAGATGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961645340 3:128389797-128389819 CTGCTCCAGCAGAATGGGCAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963292556 3:143507051-143507073 ATGCACAAGATGAATAAGGAAGG - Intronic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
966550677 3:181200880-181200902 CTTTACAAGCAGCATGATGATGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969827823 4:9771975-9771997 CTGGACAAGCAGATTGTGAAGGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
974671755 4:65039172-65039194 TTGCACCAGCTGCATGAGGATGG + Intergenic
975202471 4:71607759-71607781 AAGCCCAAGCAGCATGAGGAGGG - Intergenic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
978908539 4:114038277-114038299 GAGCACAAGCAAAATGAAGAAGG + Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
979603283 4:122609290-122609312 CTACTCAAGAAGAATGAGGAGGG + Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
983951104 4:173642593-173642615 CTGCAAAAGCAGCATGTGGTAGG - Intergenic
985730056 5:1542602-1542624 CTACTCAAGGAGAATGAGGCAGG + Intergenic
986097650 5:4575440-4575462 CTGCACAGGCATAATGAAAATGG + Intergenic
987046642 5:14115238-14115260 TTACAAAAGCAGAATCAGGAAGG - Intergenic
987425056 5:17763575-17763597 CAGCACAAGCACAAAGAGGTGGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992319703 5:75601509-75601531 GTGCACAACCAGATTGAGGGTGG - Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
998754854 5:145366052-145366074 CTGCACAGGCAGATTGAGGTAGG - Intergenic
999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG + Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999640468 5:153667300-153667322 CAGCACAGGCAGGATGATGAGGG + Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1004273466 6:14214851-14214873 CTATCCAAGCAGAATGAAGAGGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1016050436 6:139524772-139524794 CAACACAAGGAAAATGAGGAAGG - Intergenic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1017708926 6:157148481-157148503 CTGCACCAGCAGCAACAGGAAGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017973768 6:159336236-159336258 GGGCCCAAGCAGGATGAGGAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024713115 7:52040242-52040264 CTCCACCAGGGGAATGAGGAGGG - Intergenic
1025281518 7:57629406-57629428 CTAGACAAGGACAATGAGGAGGG + Intergenic
1025303212 7:57836109-57836131 CTAGACAAGGACAATGAGGAGGG - Intergenic
1025615542 7:63113768-63113790 CTGCTCATTCAGCATGAGGATGG + Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026531658 7:71204101-71204123 ATCCACAAGCAGAATGAAGTCGG - Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG + Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035652809 8:1281595-1281617 CTCCCCAATGAGAATGAGGACGG - Intergenic
1037536853 8:19832696-19832718 CTCCACCAGCAGAGAGAGGAGGG - Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1038341161 8:26686203-26686225 CTACAAAAGCACCATGAGGAAGG - Intergenic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1043157826 8:76807408-76807430 CTGAACAAGCAGAATTAGATTGG + Intronic
1044708964 8:95036947-95036969 ATGCTCCAGCAGAATGGGGAAGG - Intronic
1046492863 8:114975792-114975814 CTGTACAAGAAGCATGAGGCTGG + Intergenic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049748537 8:144273062-144273084 CTCCACAAGCAGCGTGGGGAGGG + Intronic
1050566248 9:6886989-6887011 CTCCACCACCAGAATGAGGGGGG - Intronic
1050765919 9:9133805-9133827 GTGCACATGTAGAATGAGAAAGG + Intronic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052471442 9:28900657-28900679 CTGGACAAGCTGAATGATAAAGG + Intergenic
1052970304 9:34373256-34373278 CTCCACTAGGAAAATGAGGATGG - Intronic
1054840335 9:69731621-69731643 CTACTAAAGCAGAATGAGGGTGG - Intronic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055779549 9:79804915-79804937 CTTCACAAGCAGGAAGAGGCAGG - Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1057089177 9:92240895-92240917 ATGCACAAGCAGGACCAGGAAGG + Exonic
1058035904 9:100252531-100252553 CTGCACAAGTACAAGGATGAAGG + Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059711966 9:116876684-116876706 CTGCACCAGCAAAATGATTATGG + Intronic
1061224996 9:129276315-129276337 CTACTCAAGAAGGATGAGGAGGG - Intergenic
1061281828 9:129602016-129602038 CTGCCCAAGAAGGATGGGGAGGG - Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062355241 9:136158798-136158820 CTGCACAAGCAGAAAGAAATGGG - Intergenic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1203632618 Un_KI270750v1:83029-83051 CTAGACAAGGACAATGAGGAGGG + Intergenic
1186207597 X:7216644-7216666 CTGCTCACTCAGACTGAGGATGG + Intergenic
1186806342 X:13143772-13143794 CTGTACAGGGAGAATGATGAGGG + Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1188155776 X:26740792-26740814 CTTCATTAGCAGCATGAGGATGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189078278 X:37941252-37941274 CTGCACAAGCTGGATGTGGTGGG - Intronic
1189273593 X:39768949-39768971 CTGACCAAGCAGATTCAGGAGGG + Intergenic
1192504629 X:71673683-71673705 CTGCCCATCCAGAATGAGGGAGG - Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1198607268 X:138355728-138355750 CTGCACAAGAAGCATGATGCTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199049594 X:143221472-143221494 CTGCACAAGAAGCATGATGGTGG - Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201579428 Y:15495315-15495337 CTGCTCACTCAGACTGAGGATGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic