ID: 1091448936

View in Genome Browser
Species Human (GRCh38)
Location 12:560857-560879
Sequence ATGCACAAAAGGCCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 334}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091448930_1091448936 -9 Left 1091448930 12:560843-560865 CCTGCAGGCTGCACATGCACAAA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 334
1091448926_1091448936 8 Left 1091448926 12:560826-560848 CCCTGTGAGAGGGACACCCTGCA 0: 1
1: 0
2: 1
3: 11
4: 160
Right 1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 334
1091448921_1091448936 27 Left 1091448921 12:560807-560829 CCTGCCAGAAGTGCAGCCTCCCT 0: 1
1: 0
2: 2
3: 28
4: 224
Right 1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 334
1091448929_1091448936 -8 Left 1091448929 12:560842-560864 CCCTGCAGGCTGCACATGCACAA 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 334
1091448922_1091448936 23 Left 1091448922 12:560811-560833 CCAGAAGTGCAGCCTCCCTGTGA 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 334
1091448925_1091448936 11 Left 1091448925 12:560823-560845 CCTCCCTGTGAGAGGGACACCCT 0: 1
1: 0
2: 0
3: 9
4: 188
Right 1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 334
1091448920_1091448936 28 Left 1091448920 12:560806-560828 CCCTGCCAGAAGTGCAGCCTCCC 0: 1
1: 0
2: 3
3: 21
4: 230
Right 1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 334
1091448927_1091448936 7 Left 1091448927 12:560827-560849 CCTGTGAGAGGGACACCCTGCAG 0: 1
1: 0
2: 19
3: 20
4: 208
Right 1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091448936 Original CRISPR ATGCACAAAAGGCCTGGGGA GGG Intronic
900709683 1:4105706-4105728 CTGCCCAGAAGGCCTGGGGATGG + Intergenic
900726046 1:4216919-4216941 ATCTGCAAAAGGCCTGGGGTAGG + Intergenic
900982129 1:6051811-6051833 ATGTATAAAAGGGCTGGGCACGG + Intronic
902751036 1:18511267-18511289 ATGCACCAAAGGCAGGGGAATGG - Intergenic
903375537 1:22863443-22863465 ATTCACAAAGGGACAGGGGATGG + Intronic
903510903 1:23874283-23874305 AGACACAAAAGGCCTGGGACAGG - Exonic
904399250 1:30244950-30244972 CTGCACCAAAGCCCTGGAGAGGG + Intergenic
906691726 1:47797302-47797324 TTACACAACTGGCCTGGGGATGG + Intronic
906776611 1:48535353-48535375 GTGCTACAAAGGCCTGGGGATGG - Intronic
907705375 1:56828020-56828042 TTGAACAAGAGGACTGGGGATGG + Intergenic
907975616 1:59428544-59428566 ATGCTCAAAAGAACTGGGCAAGG - Intronic
908386167 1:63643786-63643808 AAGCACAGAGGGCATGGGGAGGG + Intronic
914843330 1:151265994-151266016 ATACACGAAGGGCCTGGTGAAGG - Exonic
914857039 1:151360158-151360180 ATGAACAAAAGGGATGGGCATGG - Intergenic
915304709 1:154970642-154970664 AGTCACAGAAGTCCTGGGGAGGG + Exonic
915895030 1:159805342-159805364 ATGCAAGAATGGCCTTGGGAAGG - Intronic
916347461 1:163809988-163810010 ATACATAAAAGGCCTTAGGATGG + Intergenic
917185520 1:172350242-172350264 ATGCCAAAAAGTCCTGAGGAAGG - Intronic
918823151 1:189285444-189285466 ATCCACATAAGGTTTGGGGAGGG + Intergenic
919659145 1:200226455-200226477 ATAAAGAAAAGGCCCGGGGAAGG + Intergenic
920065078 1:203263485-203263507 AAGCACAGAAGGCCAGGGGTTGG - Intronic
920588714 1:207195693-207195715 ATGCACAAGAGTTCAGGGGAGGG - Intergenic
920688159 1:208125763-208125785 CTGCACAAATGGCCCTGGGAGGG + Intronic
920833548 1:209487013-209487035 ATCTACAGAAGGGCTGGGGATGG - Intergenic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1064103848 10:12484952-12484974 TTACAGAAAAGGCCTGGGGTAGG - Intronic
1064274785 10:13895518-13895540 AAGCACAAAAGGTTTTGGGAGGG - Intronic
1064721554 10:18234765-18234787 ATGCTGAAAAGTCCTGGAGATGG + Intronic
1065153379 10:22845240-22845262 TTGCAGACAAGTCCTGGGGAGGG + Intergenic
1066453281 10:35550474-35550496 AGGGACAAAAGGAGTGGGGAGGG - Intronic
1067229720 10:44397707-44397729 ATGCAGATGAGGCCTGGGGCAGG + Intergenic
1068993202 10:63172804-63172826 AAGCACAAAAACCCTGGGGGAGG + Intronic
1069802426 10:71090427-71090449 TTGCACAAAAGCCCTGGGAAGGG + Intergenic
1069935688 10:71914355-71914377 ATGCACAAAGGGGCTGGGCATGG - Intergenic
1069953212 10:72033876-72033898 ATTCACAAAAATCCTGGGGTAGG + Intergenic
1070775270 10:79106138-79106160 AGGCACAGAGGGCCTGGGGGTGG - Intronic
1072161643 10:92772184-92772206 ATGGGAAAAGGGCCTGGGGAGGG + Intergenic
1072451699 10:95544095-95544117 ATGCGCAAAAGTCCTGAGGCTGG + Intronic
1072799618 10:98384051-98384073 CTGCACCAAAGGTCTGGGGAGGG + Intronic
1075453095 10:122567149-122567171 ATCCAGAAATGGCCTGGGAAAGG + Intronic
1077301260 11:1848223-1848245 CGGCACAAAAGGCCTTGGGTCGG - Intergenic
1077863056 11:6199937-6199959 ATGTACCAAAGGCCTTGGCATGG - Exonic
1078237320 11:9497519-9497541 ATGTACAAAAGGGCCGGGCACGG - Intronic
1078496223 11:11819969-11819991 ATGTGCAAAAGCCCTGGGGAAGG + Intergenic
1078652671 11:13210185-13210207 ATGCACTAATGGCCTTGGGTAGG - Intergenic
1081081254 11:38741970-38741992 ATGCAGAAAAGGCCTTCGGCAGG - Intergenic
1083642844 11:64154653-64154675 AGGTACAAAGGGCCTGGGGCAGG - Intronic
1083663012 11:64260522-64260544 ATGTACAAAGGTCCTGGGGCAGG + Intronic
1084035823 11:66509722-66509744 ATGGGCTCAAGGCCTGGGGAGGG + Intronic
1084540390 11:69782626-69782648 ATGGACTCGAGGCCTGGGGAAGG + Intergenic
1084571029 11:69959926-69959948 AGGCACAAAGGCCCTGTGGATGG - Intergenic
1085045105 11:73348052-73348074 ATGCACACATGGCCTGGGGCTGG + Intronic
1088275409 11:108080377-108080399 ATGGGCAAAAGGCCTGGGCATGG - Intronic
1088975573 11:114813347-114813369 GTCCACAGAAGGCCTGAGGAGGG + Intergenic
1089374480 11:117984939-117984961 ATGCAGAAAAGGCAAGGGGGAGG + Intergenic
1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG + Intronic
1091877404 12:3947280-3947302 ATGTACAAAGGGCCCGTGGAAGG - Intergenic
1091907829 12:4203137-4203159 ATGCACAAAGGCCCTGAGGCAGG - Intergenic
1092909565 12:13134716-13134738 ATGCAAAAAAGGCCTTTGGGTGG + Intronic
1093230291 12:16535357-16535379 TTGCAAAACAGGCCTGGGAAAGG + Intronic
1093865797 12:24226220-24226242 ATGAATAAAAGGGATGGGGATGG - Intergenic
1095727703 12:45471085-45471107 ATGCACAAAGGTCCTGAGGCTGG - Intergenic
1097205460 12:57317169-57317191 AAACACAAAAAGCCTGGGCAAGG - Intronic
1097352264 12:58561938-58561960 AAGCACAAAGGCCCTGGGGTGGG + Intronic
1097674705 12:62587061-62587083 ATGCACACCAGGAATGGGGAGGG + Intronic
1097805235 12:63957984-63958006 AGGCACAGCAGCCCTGGGGAAGG + Intronic
1098230043 12:68363920-68363942 ATGTACAAGAGCCCTGAGGAGGG - Intergenic
1099227348 12:79985431-79985453 ATGCACAAAAGTCTGGAGGATGG + Intergenic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1102575441 12:113853461-113853483 AGGCACGGCAGGCCTGGGGAAGG + Intronic
1103893788 12:124259840-124259862 AAGCACAATATGCCTGGGGCAGG - Intronic
1103903562 12:124315809-124315831 ATGCATAAAAGGGGAGGGGAAGG + Exonic
1104170225 12:126273445-126273467 ATGTGCAAAAGTCCTGGGGCGGG - Intergenic
1104927251 12:132320245-132320267 AGGCACAGAACGCCCGGGGAGGG + Intronic
1108028026 13:46199174-46199196 ATGAAAATCAGGCCTGGGGATGG + Intronic
1108235673 13:48402321-48402343 AAGAACAAATGGCCTGGGGAAGG + Intronic
1108701793 13:52950041-52950063 ATGCAAATCAGGCCTGAGGATGG + Intergenic
1109822715 13:67679561-67679583 AAGCAGAAAAGGACTGGGGAGGG - Intergenic
1110551066 13:76812071-76812093 GTGCACCAGATGCCTGGGGAGGG + Intergenic
1111686826 13:91512590-91512612 ATACACCAAAGGCCAGGGAAGGG - Intronic
1112854800 13:103754746-103754768 ATGCAAAATATGTCTGGGGAGGG - Intergenic
1113055328 13:106260833-106260855 CTGCAGAAGAGGCCTGGGGTGGG - Intergenic
1113074899 13:106458596-106458618 ATGCACAAAATGCCTGGGGTGGG + Intergenic
1113309640 13:109118466-109118488 ATGCCTAAAAGACCTGTGGAAGG - Intronic
1113936442 13:113997507-113997529 AGGCACAAAGGTCCTGGGGCAGG + Intronic
1114775215 14:25473847-25473869 ATGTACAAAAGGGCTGGGTGCGG + Intergenic
1114779056 14:25517709-25517731 AGGCAGAAAAGGCTTGGGGCTGG - Intergenic
1115476571 14:33820298-33820320 ATGTACAGAAGGCCTGAGGAAGG + Intergenic
1118316862 14:64730969-64730991 AAGCACCTAGGGCCTGGGGAGGG + Intronic
1118326852 14:64787009-64787031 GTCCACAAAAGACCTGGGGCGGG - Exonic
1119543826 14:75457620-75457642 GTGCAGGAAAGGCCTGGGGCTGG + Intronic
1119873829 14:78039229-78039251 ATGCAAAACAGGGCTGGGCATGG - Intergenic
1121661031 14:95635254-95635276 ATGTACAAAAGCCCTGAGGCAGG - Intergenic
1122011324 14:98751370-98751392 GTGCAGAAAAGGCCTGGAGAAGG + Intergenic
1122279225 14:100611261-100611283 AGACACAAAAGCCTTGGGGAAGG + Intergenic
1122986289 14:105213133-105213155 CTGCACAGTGGGCCTGGGGATGG - Intronic
1124393468 15:29280467-29280489 GTACAAAGAAGGCCTGGGGAAGG + Intronic
1126155553 15:45562628-45562650 AATCACAAAAGGGCTGGGTATGG + Intergenic
1126268133 15:46779057-46779079 ATTCACAAAGCGCATGGGGAAGG + Intergenic
1126786364 15:52180281-52180303 CTGCACGAGAGGCTTGGGGATGG - Intronic
1127375762 15:58382948-58382970 ATGCACAACAGGCCTGGTTGGGG + Intronic
1128409603 15:67381222-67381244 ATGCAGAAAGGGACTGGGAAAGG + Intronic
1129378814 15:75152817-75152839 ATTCACAAAAGGGCAGGGAAGGG + Intergenic
1130016197 15:80188377-80188399 ATTCAGAAAAATCCTGGGGAAGG - Intergenic
1130198979 15:81807803-81807825 ATGCACCACAGGCCTGTGAAAGG - Intergenic
1130573977 15:85074149-85074171 ATGCAGAATAGGCCAGGGGTAGG - Intronic
1130991235 15:88877274-88877296 ACACAGAAAAGGGCTGGGGATGG + Exonic
1131179033 15:90227877-90227899 AGGCAGAAAAGGCATGGGGTAGG - Intronic
1131456369 15:92585498-92585520 TTGCACAAAGGGCCTGAAGACGG - Intergenic
1131734374 15:95316512-95316534 TTGCACAAATGTCCTGGGGTAGG + Intergenic
1133637839 16:7686636-7686658 TTGCACAAAAGGTCTGGGAAGGG + Intronic
1133819635 16:9225195-9225217 AGGCACTGAGGGCCTGGGGAAGG + Intergenic
1134208112 16:12253941-12253963 ATCCACATAAGGCCAGGGGCAGG - Intronic
1135520466 16:23172943-23172965 ATGCACAGTGGGGCTGGGGAGGG - Intergenic
1136292031 16:29279872-29279894 ATGGACAAAAGGGCTGGGCGCGG - Intergenic
1136450073 16:30349364-30349386 ATAAACAAAAGGACTGGGCACGG + Intergenic
1136632883 16:31499395-31499417 GTCCGCAAAAAGCCTGGGGAGGG + Exonic
1137550409 16:49433752-49433774 AAGCACAAAGGCCCTGGGGCAGG + Intergenic
1138265981 16:55660049-55660071 ATGCTCTAAAGGCCTGAGGAAGG + Intronic
1138757725 16:59509075-59509097 ATTCACATAAGGGCTGGGCATGG + Intergenic
1139242571 16:65408981-65409003 ATGCACAAAATGCCTGAGCTGGG + Intergenic
1141641246 16:85342885-85342907 ATGCACAAATGGCTTGGAGAGGG - Intergenic
1141933529 16:87220822-87220844 AAGCACAAATGGGCTGGGCATGG + Intronic
1142097922 16:88253827-88253849 ATGGACAAAAGGGCTGGGCGCGG - Intergenic
1143216977 17:5232508-5232530 GTCCACAGAAGTCCTGGGGAGGG + Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1145274581 17:21422055-21422077 ACGCACAAAGGTCCTGGGGTGGG - Intergenic
1146176562 17:30669122-30669144 ATGCAAAACCGGGCTGGGGATGG - Intergenic
1146350024 17:32085237-32085259 ATGCAAAACCGGGCTGGGGATGG - Intergenic
1146953043 17:36919978-36920000 ATGCGAAACAGGCCTGGAGAGGG - Intergenic
1147353514 17:39870331-39870353 GTTCAGAAAAGGCCTGGGCACGG - Intronic
1148069531 17:44899869-44899891 ATGTATTAAATGCCTGGGGAGGG + Intronic
1150480308 17:65503993-65504015 ATGCAGGGAAAGCCTGGGGATGG + Intergenic
1152191560 17:78891377-78891399 ATGGACCAGAGACCTGGGGAAGG - Exonic
1154404130 18:14072813-14072835 CAGAACAAAAAGCCTGGGGAAGG - Intronic
1155353803 18:24931423-24931445 ATCCCCAAAAGACATGGGGATGG + Intergenic
1155923828 18:31632918-31632940 ATGCACACATGGTCTGGAGAGGG - Intronic
1157618301 18:49001019-49001041 AAGCACAAGAGGCCCTGGGATGG + Intergenic
1157726770 18:49970384-49970406 ATTCAGAAAAGCCTTGGGGAAGG + Intronic
1157999382 18:52598583-52598605 ATGCACAAGAGGCCTGCAGCTGG - Intronic
1158622973 18:59048484-59048506 AATCACAAAGGTCCTGGGGAAGG + Intergenic
1158961579 18:62591905-62591927 CTGCACAGAATGCCTGGGGCGGG + Intergenic
1161793572 19:6374442-6374464 CTGCAAAAGAGGCGTGGGGATGG - Intronic
1161864947 19:6826825-6826847 ATCCACCAAAGGACTAGGGAGGG + Intronic
1161971990 19:7587305-7587327 AAGGACAAAGGCCCTGGGGAAGG - Intergenic
1162271712 19:9621355-9621377 GTGCAGAAAGGGCCTGGGGTTGG + Exonic
1162782073 19:13011696-13011718 ATGCACAGAGGCACTGGGGAGGG - Intronic
1162856501 19:13472574-13472596 ATGTGCAAAGGCCCTGGGGAAGG - Intronic
1162982261 19:14247765-14247787 ATGCAAAATCGGGCTGGGGATGG + Intergenic
1163640850 19:18461224-18461246 GTGGACTCAAGGCCTGGGGAAGG - Intronic
1165068911 19:33244007-33244029 CAGCACAAAAGCCCTGGGGCAGG - Intergenic
1166851745 19:45764646-45764668 ATGCACAGAGTGGCTGGGGAGGG - Intergenic
1166886375 19:45963471-45963493 ATGCACAAAAGCCCTAAGGTGGG - Intronic
1168262131 19:55201496-55201518 GTGCTCAAAAGGCCTGTTGAGGG - Intronic
1168397937 19:56064893-56064915 AAGCAGAAAAGAGCTGGGGATGG - Intergenic
925104603 2:1280482-1280504 TTGCACAAATGGCCTGGGAAGGG + Intronic
925289584 2:2738493-2738515 ATGCACCAAAGGCCGTGCGATGG - Intergenic
926040334 2:9667608-9667630 AGGCAGAAAAGGAATGGGGACGG + Intergenic
928271388 2:29858434-29858456 ATGGACAAAAGGTCTGAGGCCGG + Intronic
929453847 2:42053123-42053145 CTGAAGCAAAGGCCTGGGGATGG + Intronic
930999137 2:57760138-57760160 GTGGACAAAAGGCCCGAGGAGGG - Intergenic
931091304 2:58889571-58889593 GTGCAAAAAAGTCCTTGGGAAGG - Intergenic
934888025 2:98041475-98041497 ATGCACTAAGGGGCTGGGCACGG + Intergenic
936235109 2:110735705-110735727 ATGCACAATAGGACAGGGGCGGG - Intronic
939078346 2:137629661-137629683 AGGCACAGAAGGACTAGGGAAGG + Intronic
941497542 2:166224744-166224766 ATGCACAAAATGACTAGGGAAGG - Intronic
941875107 2:170424030-170424052 ATGACCAAAAAGCGTGGGGAAGG + Intronic
942073336 2:172335079-172335101 ATGCAAATGGGGCCTGGGGAGGG - Intergenic
942597173 2:177602136-177602158 ATACACAAAAGGCCCGGAGGAGG - Intergenic
942883958 2:180899524-180899546 TTCCACAAAAAGCCTGGGTAAGG + Intergenic
942977362 2:182034426-182034448 ATGTACAAAAGCCCTGAGGTGGG + Intronic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
943667661 2:190627112-190627134 ACACACCAAAAGCCTGGGGAGGG + Intergenic
944353587 2:198758680-198758702 ATGCAGCCAAGGGCTGGGGATGG + Intergenic
945221810 2:207491138-207491160 AGGGACAGAAGGACTGGGGAGGG - Intergenic
948125364 2:235561062-235561084 ATGCACAGAAGGCTTGTGGCAGG + Intronic
948823995 2:240565689-240565711 AGGTACACAAGGCGTGGGGAGGG - Intronic
1169563295 20:6825416-6825438 ATGTGCAAAAGGCCTGAGGTAGG + Intergenic
1170089961 20:12579909-12579931 CTGCACAAAATGCCTGTTGAGGG - Intergenic
1170188366 20:13618024-13618046 CTGCACAAGAGGCCTGGGCTGGG + Intronic
1170443041 20:16398070-16398092 ATGCACAAAATGCCTGCGAGAGG + Intronic
1170733250 20:18991860-18991882 AAGCACAAAGGTCCTGAGGAAGG - Intergenic
1170903502 20:20489019-20489041 ATGCATGAAAGGCCAGGGGAAGG + Intronic
1172037886 20:32022834-32022856 ATCCCAAAAAGGCCAGGGGAGGG + Intronic
1172067689 20:32233378-32233400 ACGCACAAAGGTCCTGAGGAGGG + Intronic
1172384415 20:34523523-34523545 AAGCACAAAAGCCCTGGGGTGGG - Intronic
1172782242 20:37443722-37443744 GTGCACAGAAGTGCTGGGGAGGG + Intergenic
1173594357 20:44248969-44248991 ATGCACAAAAGTACTGATGATGG + Intronic
1174693341 20:52531712-52531734 ATGTGCAAAGGTCCTGGGGAAGG + Intergenic
1175125130 20:56745601-56745623 GGGCACAAAGGGTCTGGGGAAGG + Intergenic
1175170219 20:57074920-57074942 ATGCAGAAGAGACCTGGGGACGG + Intergenic
1175891313 20:62317280-62317302 ATGCAGACAGGGCCTTGGGAGGG - Intronic
1176185768 20:63778013-63778035 CTGCAAAAAGGGGCTGGGGAGGG + Intronic
1177800199 21:25821148-25821170 TTGCACAAAAGGCAGGGAGATGG + Intergenic
1178370062 21:32020179-32020201 ATGGAAAAAAGGTCTGGAGATGG - Intronic
1179172170 21:38981184-38981206 AGGCACACAAGGCAGGGGGAAGG + Intergenic
1180832001 22:18911243-18911265 GGGCACAGCAGGCCTGGGGAGGG - Intronic
1180850406 22:19016471-19016493 ATGGAAAAATGGCCTGTGGATGG - Intergenic
1181022755 22:20112344-20112366 GTCCACAAAGGCCCTGGGGATGG + Exonic
1181317611 22:21980879-21980901 ATGCACTAAATGCCTGCTGAGGG + Intronic
1181476894 22:23174048-23174070 ATGCCTCAAAGCCCTGGGGATGG - Intergenic
1181600043 22:23945741-23945763 ATGTAGAAAAGGCCAAGGGAAGG + Intergenic
1181608459 22:23995582-23995604 ATGTAGAAAAGGCCAAGGGAAGG - Intergenic
1181694266 22:24585131-24585153 AAGTACAAGAGGCCTGGGGCTGG + Intronic
1183078535 22:35441808-35441830 AAGCACAAAAGGCCTAGAGGTGG + Intergenic
1184466372 22:44670716-44670738 TGGCTTAAAAGGCCTGGGGACGG + Intronic
1184611981 22:45610048-45610070 ATGGACACAAGGCCTAGGAAGGG + Intergenic
1185105931 22:48869842-48869864 CTGCAGAATAGGCCTGGAGATGG - Intergenic
1185219612 22:49622815-49622837 ATGCACAGAAGCCTTGGGCAAGG + Intronic
1203282079 22_KI270734v1_random:136514-136536 GGGCACAGCAGGCCTGGGGAGGG - Intergenic
949332402 3:2936908-2936930 ATTCACAAATGGCCTGTGGCTGG + Intronic
949830375 3:8208128-8208150 ATGCACATAGGCCCTGGGGCAGG - Intergenic
952056362 3:29451644-29451666 TTGCACAAAACCACTGGGGAAGG + Intronic
952716369 3:36484579-36484601 ATAAATAAAAGGCCTGGGCATGG - Intronic
953062141 3:39435845-39435867 ATCCACACAGGGCCTGGTGAGGG + Intergenic
953987578 3:47457139-47457161 ATGCACAAAACACCTGGGAATGG + Intronic
954429480 3:50462585-50462607 ATGCACAAAAGGGCGAGGGATGG + Intronic
954707704 3:52489841-52489863 CAGCACAAATGGCCAGGGGAGGG - Intronic
954785897 3:53092249-53092271 CTGCCCTAGAGGCCTGGGGAGGG + Intronic
954984732 3:54779645-54779667 ATGTTCAAAAGCCCAGGGGAGGG - Intronic
955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG + Exonic
957839577 3:85650924-85650946 ATGCACAAAATGCATGCTGATGG + Intronic
958793344 3:98678892-98678914 ATGCACAAAAGGCCAGGCTCGGG - Intergenic
961156800 3:124686527-124686549 ATGAACAAAAGCCCTGAGGTGGG + Intronic
961514567 3:127424668-127424690 ATGCACAAAGGTCCCGGGGTGGG - Intergenic
961517195 3:127445270-127445292 ATGTACAAAAGGCCTGAGGATGG + Intergenic
961738157 3:129015208-129015230 ATGCCCAAAGGGCCTGAGAAGGG - Intronic
961780728 3:129318805-129318827 CTGCACAAAAGGCCAAGCGATGG - Intergenic
962431300 3:135323052-135323074 ATGCTCAGATGGCATGGGGAGGG - Intergenic
962752316 3:138442553-138442575 ATGGACAAGAGTCCTGGGGGTGG - Intronic
963035225 3:141019861-141019883 ATGTACAAGGGGCCTGGGGAGGG + Intergenic
964722215 3:159778849-159778871 GTGCACACACGGCCTGTGGAGGG + Intronic
964791613 3:160458393-160458415 GTGTACAAAAGGCCTGGACAAGG + Intronic
967885492 3:194330856-194330878 TTGCAGAACAGGCCTGGGCATGG + Intergenic
970318578 4:14853435-14853457 ATGGAAAAAAGGTGTGGGGAAGG - Intergenic
974007149 4:56570056-56570078 ATGAGAAAAAGGCCTTGGGATGG - Intronic
974516179 4:62914831-62914853 AAGCACAAAAGCCCTGAGGCAGG - Intergenic
975066603 4:70073806-70073828 ATGCAAAATAGACCTGGTGAGGG - Intergenic
975170026 4:71223020-71223042 TTGCAAAATGGGCCTGGGGAGGG + Intronic
975708063 4:77130267-77130289 ATGGGCAAAAGGGCTGGGCATGG - Intergenic
977677131 4:99760130-99760152 ATTCACAAAAAGACTGGGAATGG - Intergenic
982103363 4:151990320-151990342 ATGCCAAAAAGGAATGGGGAGGG - Intergenic
983270147 4:165551569-165551591 ATAAACAAAAGGCCTGGTAATGG + Intergenic
986317809 5:6602344-6602366 AATCACAAAAGGCCTGAAGAAGG + Intronic
986393317 5:7304593-7304615 AAGCACATAGGGGCTGGGGACGG + Intergenic
986649083 5:9946300-9946322 GGGCACAAAAGCCCTGGGAAGGG - Intergenic
987299162 5:16581382-16581404 AGCCACACAGGGCCTGGGGAAGG - Intronic
987302227 5:16606976-16606998 ACACACAAAAGCCCTGGGGTGGG - Intronic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
990504130 5:56427807-56427829 ATGTGCAAAAGTCCTGGGGTGGG - Intergenic
992777604 5:80102247-80102269 ATGCACAACAGGCCTAGAGAGGG - Intergenic
992842155 5:80705998-80706020 AGGCACAAACGGACTGAGGAGGG - Intronic
994130431 5:96221065-96221087 ATCCACAACAGGCCAAGGGAGGG - Intergenic
995061377 5:107814656-107814678 ATGTAATAAAGGGCTGGGGAAGG - Intergenic
995163355 5:109008587-109008609 ATACATGAAAGGCCTAGGGAAGG - Intronic
997435676 5:133873152-133873174 ATTCTCAAGAGGCCAGGGGAAGG + Intergenic
998806204 5:145919772-145919794 ATGCTTAAAACCCCTGGGGAGGG + Intergenic
998968304 5:147564312-147564334 AAGCACAAAAGACCTGTGAAAGG - Intergenic
999495963 5:152097224-152097246 CCCCACAAAAGGCCTGGGCAGGG + Intergenic
999770891 5:154774688-154774710 GGGCAGAAAAGGCCTGGGGCAGG - Intronic
1001146527 5:169189258-169189280 ATGCTCAAAAGGATTGGTGATGG - Intronic
1001194315 5:169657725-169657747 ATTCAAACAAGACCTGGGGAAGG + Intronic
1001565877 5:172699133-172699155 ATGCAACAAAGGCCTGGATAAGG + Intergenic
1002565946 5:180113082-180113104 ATGGACAGAGGGACTGGGGATGG + Intronic
1003148828 6:3531485-3531507 ATGCTCTAAAGCCCAGGGGAAGG + Intergenic
1003258747 6:4496875-4496897 ACGAATAAAAGGCCTGGGGTGGG + Intergenic
1003721286 6:8705560-8705582 CTGCCCAGTAGGCCTGGGGAGGG - Intergenic
1003981792 6:11396807-11396829 AAGCACAAATGCCCTGGGGTGGG + Intergenic
1004491827 6:16125049-16125071 ATGCTCAAAAGACCTGGTTAGGG - Intergenic
1005016552 6:21380088-21380110 ATCTGCAAAAGCCCTGGGGAGGG - Intergenic
1005254033 6:23980910-23980932 ATGAACAAAAAGCATAGGGAAGG + Intergenic
1005464959 6:26103965-26103987 AGGCGGAAAAGGCTTGGGGAAGG + Exonic
1005496122 6:26389397-26389419 ATATGCAAAAGGCCTGAGGAAGG + Intronic
1005500777 6:26427263-26427285 ATATGCAAAGGGCCTGGGGAAGG + Intergenic
1005505344 6:26464583-26464605 ATATGCAAAGGGCCTGGGGAAGG + Intronic
1005690742 6:28302844-28302866 ATGCACAAAATAGCTGGGCATGG - Intergenic
1005939869 6:30552959-30552981 ATGTGCAAGAGGCCAGGGGAAGG - Intronic
1006408589 6:33859055-33859077 ATGCAAGAAAGGCCTTTGGAAGG - Intergenic
1006779330 6:36621508-36621530 ACCCACAAAAGCCCTGGAGAAGG + Intergenic
1007293913 6:40806698-40806720 CTGCACAGAGGGCCTGGGGTGGG + Intergenic
1007334988 6:41149551-41149573 ATGCACAGAACCCCTAGGGATGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008534435 6:52496684-52496706 ATGCACAAAAAGACTCGGAAGGG + Intergenic
1008564211 6:52751459-52751481 GGGCACCAAAGGCCTGGAGAAGG + Intronic
1010805365 6:80229403-80229425 ATGTGCAAAAGGCCTGAGGCAGG + Intronic
1011289762 6:85764996-85765018 CTGGACCAAAGGCCTTGGGAAGG - Intergenic
1013098472 6:106967566-106967588 ATGCAAACAAGGGCTGGGCATGG + Intergenic
1013828912 6:114249618-114249640 ATGCACAACACCCCTGGGGAGGG - Intronic
1014443677 6:121502002-121502024 TTGCATAAAAGACCTAGGGAAGG + Intergenic
1015209587 6:130682190-130682212 ATGAAGAAAGGGCCAGGGGAGGG - Intergenic
1017025613 6:150178107-150178129 CTGCACAAAAGGCCTCGCGGAGG - Intronic
1017497252 6:154993755-154993777 ATGCAGACAAGACCAGGGGAGGG + Intronic
1017846950 6:158266903-158266925 ATGAACAAAAGTTCTGGAGATGG - Intronic
1017867585 6:158457328-158457350 ATGCAGAAGAGGCCTGGGCAGGG - Intronic
1018066688 6:160129402-160129424 ATGCACCAAAAGCCAGGGGAGGG - Intronic
1018420164 6:163634259-163634281 CTGCTCAAAAGGCCTGGGAGTGG - Intergenic
1018847320 6:167564703-167564725 ATGCACAGAAACCCTGGGGAGGG + Intergenic
1022445218 7:30464845-30464867 ATGCACAAAATGCCTAGGCCAGG + Intronic
1022945518 7:35279930-35279952 ATGCACTAGAGACATGGGGAAGG + Intergenic
1023059855 7:36316577-36316599 ATACACAGCAGGCCTGGGGCTGG - Intergenic
1023266554 7:38412061-38412083 AGGTACCAAGGGCCTGGGGAGGG + Intronic
1023345563 7:39267897-39267919 ATAGACAAAGGGCTTGGGGAGGG - Intronic
1023558793 7:41450778-41450800 GAGCTCAAAAGGCTTGGGGAAGG + Intergenic
1023967264 7:44969506-44969528 AGGCACAAAAGGTATGTGGAGGG + Intronic
1027806636 7:82833840-82833862 TTTCACAGAAGGCCTGGGAAGGG + Intronic
1028172710 7:87617969-87617991 ATGTACAAATGGCCTGTGGCTGG - Intronic
1028887719 7:95952793-95952815 ATGCATAAAAGGACAGAGGAAGG - Intronic
1029007444 7:97225549-97225571 ATCCATAAAGGGCCTGGGCATGG + Intergenic
1031859920 7:126966871-126966893 ATGGACAAAAGTCATGGGGCAGG + Intronic
1032521351 7:132547846-132547868 TTGCAAAAGAGCCCTGGGGATGG + Intronic
1033045872 7:137961827-137961849 ATGGAGGAAAGGCCTGGGGTAGG - Intronic
1033327281 7:140390262-140390284 ATGGTCAAAAGGGCTGGGGGTGG - Intronic
1034764358 7:153704115-153704137 AGGCACAGCAGGCCTTGGGAAGG - Intergenic
1034908806 7:154974686-154974708 ATGAACAAAAGGACTGTTGATGG - Intronic
1035205153 7:157290128-157290150 GGGCACCAAAGCCCTGGGGAAGG - Intergenic
1035559601 8:594533-594555 GTGGACAAATGGACTGGGGAAGG - Intergenic
1035791451 8:2309259-2309281 ATGCACAAGATGGGTGGGGAAGG + Intergenic
1035801354 8:2412446-2412468 ATGCACAAGATGGGTGGGGAAGG - Intergenic
1035898468 8:3431504-3431526 CTGGAAAAAAGGCATGGGGATGG - Intronic
1036004275 8:4644248-4644270 ATGTTCAAAGGGCCTGGGGTGGG - Intronic
1037583608 8:20261540-20261562 ATGCAGAAGGGGGCTGGGGATGG - Intronic
1037877179 8:22554008-22554030 ATGCCCACACGGCCTGGGGGAGG + Intronic
1038533898 8:28340069-28340091 ATGGACAAATGGCTTGTGGAAGG - Intronic
1039037757 8:33378221-33378243 ATGAGGAAAAGGTCTGGGGAGGG - Intronic
1041456352 8:58065209-58065231 ATGCATTAAAGGGCTGGTGATGG + Intronic
1043585113 8:81759798-81759820 ATGTGCAAAAGGCCTGTGGCAGG - Intergenic
1043927381 8:86052606-86052628 ATCCACAAAAGAACTGAGGAAGG - Intronic
1044010991 8:86994322-86994344 GTGCACAAAAGGCCCTGGTAGGG + Intronic
1044598503 8:93981064-93981086 ATGGAGACAAGACCTGGGGAGGG + Intergenic
1044985562 8:97753633-97753655 GAGCACAGGAGGCCTGGGGATGG + Intergenic
1046244691 8:111543669-111543691 ATTCACAAAAGACCTGAGAAGGG + Intergenic
1047472528 8:125191160-125191182 ATGCACATAATGGCTGGGCATGG - Intronic
1047789156 8:128185085-128185107 ACCCACAAAAGCCCTGGAGAAGG + Intergenic
1048070775 8:131018433-131018455 ATGAACAGAACCCCTGGGGAGGG - Intronic
1049785782 8:144450046-144450068 CTGCACAGAAGGGCTGGGGCAGG + Exonic
1049829437 8:144690946-144690968 ATGGACAAAAGGGCTGGGCAAGG - Intergenic
1050692135 9:8240281-8240303 AAGAACAAAAGGGCTGGGCATGG + Intergenic
1051690991 9:19712093-19712115 CAGCACAAAAAGTCTGGGGAAGG + Intronic
1052341504 9:27368662-27368684 CAGCACAAAGGGGCTGGGGAGGG - Intronic
1055751288 9:79508399-79508421 TTGTACAGAAGGCCTGGTGAGGG - Intergenic
1056907840 9:90669416-90669438 AGGCACCAAATGCCTGGGGTGGG - Intergenic
1057080465 9:92171116-92171138 GTGCACAAAGGGCCTGGCCAGGG - Intergenic
1057389046 9:94627833-94627855 AGGCACAGTTGGCCTGGGGAGGG - Intronic
1057846168 9:98526365-98526387 ATGCACAAAGGTCCTGAGGTGGG - Intronic
1058131992 9:101264105-101264127 TTGCACACAAGGGCTGGGGTGGG - Intronic
1058358680 9:104115282-104115304 ATGTACAAGAAGCCTGGGTATGG + Intronic
1058394018 9:104528885-104528907 AAGCACAAAAGGAATGGGGCAGG + Intergenic
1059366706 9:113791972-113791994 ATGCAAAAAAGGCCTGGGCTTGG + Intergenic
1059707200 9:116836352-116836374 ATGCTGAATAGGCCAGGGGATGG + Intronic
1060665979 9:125432415-125432437 TTGCAGAAAAGGGCTGGGGGAGG - Intergenic
1060991772 9:127853662-127853684 CTGCCCAAAGGCCCTGGGGAAGG + Intronic
1061315134 9:129790707-129790729 ATGGAAAGAAGGCCTGGGAAAGG - Intergenic
1061780315 9:132992116-132992138 AGGCACAGACGGCCTTGGGAAGG - Intergenic
1062216570 9:135392659-135392681 AAGCACAAAGGGCCTCGGCAGGG - Intergenic
1062643857 9:137536371-137536393 CTGGACAGCAGGCCTGGGGAGGG + Intronic
1188980424 X:36722020-36722042 ATGCACAAAAGGCCTAAATATGG - Intergenic
1189083331 X:37996348-37996370 ATGCACAAAAGGCCTAAATATGG - Intronic
1189645115 X:43119924-43119946 ATGGACAAAAAGCAAGGGGATGG - Intergenic
1190367255 X:49707704-49707726 AAGCACTAAAGGTCTGGAGATGG + Intergenic
1192168613 X:68841106-68841128 AGGCTCACAAAGCCTGGGGAGGG - Exonic
1196006138 X:110839231-110839253 ATCCCCAAAAGGCATGGGGGTGG - Intergenic
1199066324 X:143422804-143422826 ATGGGCAAAAGGGCTGGGCATGG - Intergenic
1200317543 X:155149361-155149383 ATGTGCAAAGGCCCTGGGGAAGG - Intergenic
1201562300 Y:15331216-15331238 ATGCACAAAGGGTGTTGGGATGG - Intergenic
1201771899 Y:17623712-17623734 ATGCAAAAAATGGCTGGGCATGG - Intergenic
1201829656 Y:18282274-18282296 ATGCAAAAAATGGCTGGGCATGG + Intergenic