ID: 1091450446 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:569411-569433 |
| Sequence | CAGGGGGCACAGTTGAACCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2261 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 66, 4: 2193} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1091450446_1091450451 | -6 | Left | 1091450446 | 12:569411-569433 | CCCAGGTTCAACTGTGCCCCCTG | 0: 1 1: 0 2: 1 3: 66 4: 2193 |
||
| Right | 1091450451 | 12:569428-569450 | CCCCTGGCCTCCCTGCCCCATGG | 0: 1 1: 0 2: 14 3: 101 4: 836 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1091450446 | Original CRISPR | CAGGGGGCACAGTTGAACCT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||