ID: 1091450446

View in Genome Browser
Species Human (GRCh38)
Location 12:569411-569433
Sequence CAGGGGGCACAGTTGAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2261
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 2193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091450446_1091450451 -6 Left 1091450446 12:569411-569433 CCCAGGTTCAACTGTGCCCCCTG 0: 1
1: 0
2: 1
3: 66
4: 2193
Right 1091450451 12:569428-569450 CCCCTGGCCTCCCTGCCCCATGG 0: 1
1: 0
2: 14
3: 101
4: 836

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091450446 Original CRISPR CAGGGGGCACAGTTGAACCT GGG (reversed) Intronic
Too many off-targets to display for this crispr