ID: 1091450712

View in Genome Browser
Species Human (GRCh38)
Location 12:570539-570561
Sequence GGCCCTTTAAGGCCAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 237}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091450709_1091450712 -8 Left 1091450709 12:570524-570546 CCGCTCAGAGGAGCTGGCCCTTT 0: 1
1: 0
2: 1
3: 26
4: 197
Right 1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG 0: 1
1: 0
2: 5
3: 20
4: 237
1091450708_1091450712 -7 Left 1091450708 12:570523-570545 CCCGCTCAGAGGAGCTGGCCCTT 0: 1
1: 1
2: 0
3: 37
4: 234
Right 1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG 0: 1
1: 0
2: 5
3: 20
4: 237
1091450704_1091450712 0 Left 1091450704 12:570516-570538 CCCCGCTCCCGCTCAGAGGAGCT 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG 0: 1
1: 0
2: 5
3: 20
4: 237
1091450706_1091450712 -2 Left 1091450706 12:570518-570540 CCGCTCCCGCTCAGAGGAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 262
Right 1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG 0: 1
1: 0
2: 5
3: 20
4: 237
1091450703_1091450712 1 Left 1091450703 12:570515-570537 CCCCCGCTCCCGCTCAGAGGAGC 0: 1
1: 0
2: 2
3: 11
4: 140
Right 1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG 0: 1
1: 0
2: 5
3: 20
4: 237
1091450705_1091450712 -1 Left 1091450705 12:570517-570539 CCCGCTCCCGCTCAGAGGAGCTG 0: 1
1: 0
2: 1
3: 19
4: 213
Right 1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG 0: 1
1: 0
2: 5
3: 20
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091450712 Original CRISPR GGCCCTTTAAGGCCAGGCCC AGG Intronic
900177255 1:1296346-1296368 GGCCCCTGAGGGCCAGGCCGGGG - Intronic
900494308 1:2969538-2969560 GGACCCGTCAGGCCAGGCCCAGG - Intergenic
900524420 1:3121563-3121585 CGCACTTCCAGGCCAGGCCCAGG - Intronic
901105490 1:6752480-6752502 CCCCCTTTAAGGTCAGACCCAGG - Intergenic
901839631 1:11945637-11945659 GGGCCTTGAATGCCAGGCCAAGG + Intronic
902743203 1:18454866-18454888 AGCCTTTGAAGTCCAGGCCCTGG + Intergenic
902923035 1:19678756-19678778 GGCCCTTGCAGGAGAGGCCCTGG + Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903954135 1:27013096-27013118 GTCCCTTTAAGTCCAGGCCCGGG - Intergenic
904378376 1:30095650-30095672 GGCCCTGAAAGGCCTGGCCGGGG - Intergenic
904456740 1:30652274-30652296 TGCCCTTGAAGTCCAGCCCCTGG + Intergenic
906199352 1:43949097-43949119 GGCACTTGAGGGCAAGGCCCAGG - Intronic
907809079 1:57850640-57850662 GGCACTTGCAGGCCAGGCCTTGG - Intronic
907861814 1:58361196-58361218 GGCCCTAGGAGGCCAGACCCAGG - Intronic
910457248 1:87411094-87411116 GGGACTTTGAGGCCAGCCCCAGG - Intergenic
912457439 1:109807325-109807347 GGCTCTTACAGGCCTGGCCCTGG - Intergenic
913112474 1:115668855-115668877 GGCCTTTTAAGGTCTGGGCCTGG + Intronic
915540315 1:156561915-156561937 GGCCCTTCAAGACCCTGCCCTGG - Exonic
915664928 1:157435637-157435659 GGCCCTTTAAGAACGGGGCCAGG - Intergenic
915914237 1:159931573-159931595 GGGGCTGCAAGGCCAGGCCCAGG - Exonic
917458685 1:175208855-175208877 TGCCCTGGAAGGCCATGCCCCGG + Intergenic
918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG + Exonic
919739660 1:200974115-200974137 GGCCCTTTATGGCCAGGACTCGG + Exonic
919781157 1:201222106-201222128 GGCCTTCGAAGGCCATGCCCGGG - Intronic
920528326 1:206684868-206684890 TCCCCTTTAAGGACCGGCCCCGG + Intergenic
920594037 1:207250708-207250730 GGAACTGAAAGGCCAGGCCCTGG + Intergenic
920669711 1:207993903-207993925 CGCCTTTTGAGGCCAGCCCCAGG - Intergenic
923834090 1:237590799-237590821 GGCCCAAAAAGGCCAGCCCCAGG - Exonic
1063332290 10:5172939-5172961 GGCCCTTTAAGAACAGGGCTAGG + Intergenic
1065827324 10:29584216-29584238 GACCATTTAAGCCCACGCCCCGG - Intronic
1067052228 10:43028329-43028351 GGCCATGGAAGGCCAGGACCTGG + Intergenic
1069920963 10:71815367-71815389 GACCCTCCAAGGCCAGGCCTTGG + Exonic
1069956247 10:72053785-72053807 GGCCCTCTCAGCCCTGGCCCAGG + Intergenic
1070781999 10:79143104-79143126 GCCCCCTCCAGGCCAGGCCCCGG + Intronic
1071602012 10:86962911-86962933 GGCCCATTAAGGCTGGGGCCTGG + Intronic
1074104499 10:110378266-110378288 GGCCCTTTAAAACCAGGCTCAGG + Intergenic
1075599239 10:123755199-123755221 TGCCCTCTGAGGCCAGCCCCTGG + Intronic
1075631639 10:124004095-124004117 GCCCCTTTAAAGTCAGGTCCTGG - Intergenic
1076080836 10:127579012-127579034 GGGCCCTGAAGGCCAGGGCCGGG + Intergenic
1076692829 10:132232510-132232532 GGCCTTTTATGACCAGGCCTGGG + Intronic
1078428295 11:11268731-11268753 GCCCCCATAAGGCCCGGCCCAGG - Intergenic
1078659887 11:13278059-13278081 GGCCCTTTAAGGCCGGCAGCGGG - Intronic
1081704986 11:45177430-45177452 GACACTCTAAGGCCTGGCCCAGG - Intronic
1081793566 11:45805082-45805104 GGCCCTTTAAGGCCACGTGGGGG + Exonic
1081968515 11:47183657-47183679 GGCCTTTGGAGGGCAGGCCCGGG - Intronic
1083673884 11:64314929-64314951 GGCCCGTTCAGGGCAGCCCCGGG - Intronic
1083771091 11:64867969-64867991 GACCCTGTAAGGCCAGCGCCTGG - Intronic
1084473408 11:69375944-69375966 GGCCCTTTAAAGCCGGGGCCTGG - Intergenic
1084947962 11:72649062-72649084 AGGCCTTGAAGGCCAGGACCAGG - Intronic
1085710942 11:78828907-78828929 TGGCCCTTTAGGCCAGGCCCAGG - Intronic
1086705100 11:89943538-89943560 GGCCCCTTCAGGCCCGGCACAGG - Intergenic
1087181568 11:95147390-95147412 GGCTCTTTAAGGCCAATGCCTGG - Intergenic
1088727273 11:112650505-112650527 GGCCCTAGAAGACCAGGTCCTGG - Intergenic
1090793284 11:130111121-130111143 GGTCCTATAAGCCCTGGCCCCGG - Intronic
1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG + Intronic
1092509723 12:9142723-9142745 GGCCCTTTAAGAACAGGGCTAGG + Intergenic
1095642996 12:44506348-44506370 GCTCCTTTAAGGGCAGGCCTTGG - Intergenic
1097601344 12:61696263-61696285 GGCCCTTTAAGAGCAGGGCTAGG - Intergenic
1097672842 12:62560661-62560683 GGCCCTATAAGAACAGGCACAGG - Exonic
1099601299 12:84741739-84741761 GGCCCTGTATGGCAAGGCTCTGG - Intergenic
1101841222 12:108328762-108328784 GGCCCTTTAATGCCCAGCCTGGG + Intronic
1102213498 12:111144126-111144148 GGTCTTTAAAGGCCAGGCCTGGG + Intronic
1103285289 12:119796039-119796061 GGCTCATTAAGGACAGGACCAGG - Intronic
1103996593 12:124834162-124834184 GGCCCTGCAAGGCCAGAGCCAGG + Intronic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1108502912 13:51084501-51084523 TCCCCTTCAAGGCCAGGCCAAGG - Intergenic
1113182756 13:107650265-107650287 GCCCCCTTCAGGCCAGGTCCGGG - Intronic
1115645347 14:35365478-35365500 GGCCCCTCAGGGCCAGGACCAGG - Intergenic
1117369411 14:55062921-55062943 GGCCCTGTGGGGCCAGGGCCCGG - Exonic
1117993760 14:61459504-61459526 GGCTCTTCATGGCCTGGCCCTGG - Intronic
1118961831 14:70540179-70540201 GGCCCTTTAAGAACAGGGCTAGG - Intergenic
1121403672 14:93704773-93704795 AGCCCTCTAAGGCCAGGAGCAGG - Intronic
1122375343 14:101253375-101253397 GGCCCATTAGGGCCAGGCCTGGG - Intergenic
1122887055 14:104714792-104714814 TCCCCTTTGAGGCCCGGCCCCGG - Exonic
1126386267 15:48096532-48096554 GCCCCTTTCATGCAAGGCCCAGG + Intergenic
1126581519 15:50246604-50246626 AGTCCTTGAAAGCCAGGCCCAGG + Intronic
1128509564 15:68305058-68305080 GGGCCTTGCAGGCCAGGGCCAGG - Intronic
1129149997 15:73682642-73682664 AGACCTGTAAGGCCAGACCCAGG + Intergenic
1129603056 15:77011431-77011453 GGCCCTGTAAGGCCCGGCAGAGG + Intronic
1129684495 15:77677404-77677426 GGGCCTTGAATGCCAGGCCAGGG - Intronic
1129908143 15:79204255-79204277 GGGTCTTGAAGGCCAGGCACAGG - Intergenic
1131021829 15:89105712-89105734 CGCCCTTTCAGGGCAGTCCCTGG + Intronic
1131249191 15:90819614-90819636 GCCCCATGAAGGTCAGGCCCTGG + Intergenic
1131827630 15:96333389-96333411 GGCCCTTACAGGCCCTGCCCAGG + Intronic
1132551775 16:556568-556590 GGCCCAGGAAGGCCAGCCCCGGG + Intergenic
1132809020 16:1788802-1788824 GGCCCTGCAGGGGCAGGCCCAGG + Exonic
1132955244 16:2588534-2588556 GGCCCTCTAAGAACAGCCCCAGG - Intronic
1132988976 16:2783400-2783422 GCCCCTTTAGGTCCAGGCACAGG - Intergenic
1133336079 16:5007490-5007512 GGCCCTCCCCGGCCAGGCCCTGG - Intronic
1134085842 16:11356991-11357013 TGCCCATTATGGCCAAGCCCAGG + Intergenic
1134093747 16:11405362-11405384 GCCCCTTAAGGGCCAGGACCAGG - Intronic
1134319417 16:13149285-13149307 TGCCCTTCAATGCCAGGCTCAGG - Intronic
1136588878 16:31205061-31205083 GGACCTTGAAGGCCAAGCCAAGG - Intergenic
1138352429 16:56353128-56353150 AGCCCTGAAAGGCCAGCCCCAGG + Intronic
1138509772 16:57501693-57501715 GGGTCTTGAAGGCCAGTCCCAGG + Intergenic
1139400516 16:66677647-66677669 GGCCCTTAAAGGCCAAGCTGAGG + Intronic
1139752916 16:69120058-69120080 GGCCTCTTGGGGCCAGGCCCAGG - Exonic
1141151583 16:81568128-81568150 TGCCCTAGAAGGCAAGGCCCTGG - Intronic
1141808203 16:86356137-86356159 GGCCCCTTAAGGCCTGGGCTTGG + Intergenic
1141843414 16:86589931-86589953 AGCCCTTGAAGGTCAGGACCTGG - Intergenic
1141949607 16:87332160-87332182 AGCCCTCTGAGGCCAGGCCCTGG - Intronic
1142357275 16:89607505-89607527 GGCCTGTTTAGGCCAGGCTCAGG - Intergenic
1143117214 17:4587873-4587895 GGCAGCTTGAGGCCAGGCCCAGG + Intronic
1143367102 17:6415556-6415578 GGCCCCTGAGGCCCAGGCCCAGG + Intronic
1144078329 17:11738708-11738730 GACCCTTTACTGACAGGCCCTGG - Intronic
1145035509 17:19537759-19537781 AGCCCTCTATGGCCTGGCCCTGG + Intronic
1145993157 17:29091239-29091261 GGCACTATCAGTCCAGGCCCTGG + Intronic
1148046800 17:44749474-44749496 GGACTTCAAAGGCCAGGCCCGGG - Intronic
1148735052 17:49860583-49860605 TGCCCTTCAAGGGCAGGGCCAGG - Intergenic
1149923256 17:60678178-60678200 GGCCCTTAAAGGGCAGGGCTTGG + Intronic
1150124912 17:62629285-62629307 CACACTTTAAAGCCAGGCCCTGG + Intronic
1151380832 17:73724689-73724711 GGCTCCTGAAGGCCTGGCCCAGG - Intergenic
1151386935 17:73760684-73760706 CACCCTTTAGGGCCTGGCCCAGG - Intergenic
1151684068 17:75636601-75636623 GGCTATTTAAAGCCAGGCCAAGG - Exonic
1151833088 17:76567258-76567280 GGCCTTTGAAGGACAGGTCCTGG - Intronic
1152597861 17:81246605-81246627 GGCCCCTGAAGGCAAGGCCAGGG - Exonic
1152610418 17:81312604-81312626 GCCCCTCTGATGCCAGGCCCTGG + Exonic
1203164401 17_GL000205v2_random:80522-80544 GCCCCTGTAAGGCAGGGCCCAGG + Intergenic
1154356291 18:13625018-13625040 GGCCCTGGGAGTCCAGGCCCTGG + Intronic
1155119452 18:22803432-22803454 GGCCCTTTAAGTCTATGCTCAGG - Intronic
1158864152 18:61620815-61620837 GGCCCTTTAAGAACAGGGCTAGG - Intergenic
1159649906 18:70965743-70965765 GGCTCTTGAGGCCCAGGCCCAGG - Intergenic
1160393014 18:78549044-78549066 GAGCCTGTAAGGCCTGGCCCAGG - Intergenic
1160402331 18:78620139-78620161 GGCCATGGAAGTCCAGGCCCTGG + Intergenic
1161055603 19:2189353-2189375 GACCCTCTAAGGCCGGCCCCAGG + Intronic
1161141429 19:2650549-2650571 AGCCCTTTAACCCCAGCCCCTGG + Intronic
1161169916 19:2807524-2807546 GGCCGTCGAAGGGCAGGCCCCGG - Exonic
1162938581 19:13994364-13994386 GGCTCTTGTAGGCCAGGCACAGG + Intronic
1165062209 19:33210455-33210477 GGCCCATCAAGGTGAGGCCCTGG - Exonic
1166377021 19:42333456-42333478 GCCCCTTCAAGGCGGGGCCCAGG + Intronic
1166764647 19:45245515-45245537 TGCCCTTTTAGGCCAGGCTGCGG + Intronic
1168153433 19:54460850-54460872 GGCCCGTGTAGGCCAGGCCCAGG - Exonic
925093046 2:1170450-1170472 GGGCCTTGAAGGCCAGGCCCAGG + Intronic
926048899 2:9730547-9730569 GGCCCTCCAAGGCCATGCCCTGG + Intergenic
926111130 2:10184553-10184575 GGCCCTTTGAGGCCTGGGGCAGG + Intronic
926141670 2:10371737-10371759 GGACCTTTCCGGGCAGGCCCAGG - Intronic
926604620 2:14885030-14885052 GGGCCTTGAAGACCAGGCCCAGG + Intergenic
927393292 2:22620599-22620621 GGGCTTCTGAGGCCAGGCCCAGG + Intergenic
928530492 2:32186254-32186276 GGCACTTTGAGGCCAGGAGCTGG - Intronic
930772213 2:55139928-55139950 GGCCCTTCAAGGCCTGCCCCAGG + Intergenic
931197838 2:60069707-60069729 GGGCCTTTAAGGACAAACCCAGG + Intergenic
938160195 2:128978849-128978871 GGCCCTTGAATGCCAGGCTGAGG + Intergenic
940168233 2:150798835-150798857 AGGCCTTGAAGGCCAGGCTCGGG + Intergenic
946978548 2:225180739-225180761 GGCCCCTTAAGGCCTGAGCCTGG - Intergenic
948730969 2:239963522-239963544 GGCCCTTTGAGGCCAGCCCCAGG - Intronic
1170980980 20:21212855-21212877 TGCCCTTGAAGGCCAGGCCAAGG - Intronic
1172121658 20:32602370-32602392 GGCCCTCCAGGGCCAGGCTCAGG - Intronic
1172238277 20:33393426-33393448 GGCTCCTTAAAGCCAGGCCATGG + Intronic
1172244062 20:33433675-33433697 GGCCCTTGAAGGCCAGGCCTGGG - Intronic
1172444562 20:34986263-34986285 GCCCCCATCAGGCCAGGCCCTGG + Intronic
1172885707 20:38229530-38229552 GGCCCTTAAAAGTCAGGGCCCGG + Intronic
1173288872 20:41696911-41696933 GGCCCTTGAAGACCTAGCCCAGG - Intergenic
1173790892 20:45827175-45827197 ACCCCTTTCAGGCCAGGCCTGGG - Intronic
1175612729 20:60365047-60365069 GGCCGGACAAGGCCAGGCCCTGG + Intergenic
1176075779 20:63247652-63247674 GGCCCCCCATGGCCAGGCCCTGG - Exonic
1176093360 20:63328699-63328721 GGCCCTGGAAGGCCAGGCCGAGG - Intronic
1176337211 21:5610284-5610306 GCCCCTGTAAGGCAGGGCCCAGG - Intergenic
1176470873 21:7105510-7105532 GCCCCTGTAAGGCAGGGCCCAGG - Intergenic
1176494434 21:7487288-7487310 GCCCCTGTAAGGCAGGGCCCAGG - Intergenic
1176506208 21:7651095-7651117 GCCCCTGTAAGGCAGGGCCCAGG + Intergenic
1177792308 21:25734712-25734734 GGACCTTCACGGCCTGGCCCGGG - Exonic
1182356949 22:29726455-29726477 GACCCCTTAAGGCAAGGCCTGGG + Intronic
1182452529 22:30429802-30429824 GCCCCTTTAAGTCCCAGCCCAGG - Intergenic
1185149119 22:49154191-49154213 GACCCAGTAAGGCCAGGGCCTGG + Intergenic
1185309510 22:50146278-50146300 GGCTCTGTAAGGTCAGACCCTGG + Intronic
950431465 3:12953405-12953427 GGCCCGATAAGGCCCGGCCCAGG + Intronic
950740572 3:15047982-15048004 GGCCCTTGAGAGCCAGGGCCTGG + Exonic
950797630 3:15523079-15523101 GGCCTTTTAAGGCCTAGGCCAGG - Intergenic
951058726 3:18179122-18179144 GGCCCATTAAGTCCAGGCAATGG + Intronic
952404319 3:32992101-32992123 GGGCCTTTAAGTCCAAACCCTGG + Intergenic
952752998 3:36840607-36840629 GGCCCCTTGAGGCCTGGCCTTGG - Intronic
953013667 3:39052263-39052285 GGCCCTTGGGGCCCAGGCCCGGG + Intronic
953647859 3:44772207-44772229 GGCCCTTTAAGAGCAGGGCTAGG + Intronic
954444042 3:50537114-50537136 AGGCCTTGAATGCCAGGCCCAGG - Intergenic
957501919 3:81068107-81068129 GGCCCTTTAAGAACAGGGCTGGG - Intergenic
961408796 3:126703809-126703831 GGCGCTGTAATGCCAGGGCCAGG + Intergenic
964019858 3:151996567-151996589 GGCCCTTTGTGGCCTGGCCTTGG - Intergenic
965510002 3:169557484-169557506 GGCCCTTTAAGGCAAATCTCTGG - Intronic
966688055 3:182717231-182717253 GACCTTTTAAAGCCAAGCCCAGG + Intergenic
966891348 3:184409649-184409671 GGCCCTCTGAGGCCCAGCCCTGG - Intronic
968056916 3:195698775-195698797 GGGCCTTTGTGGCCAGGCCAAGG - Intergenic
969038174 4:4272984-4273006 GGCCCGTGAAGGCCAGGGACTGG + Intronic
970004376 4:11396549-11396571 GGCCCTGTAAGGACAGCCCAGGG + Exonic
970595884 4:17599816-17599838 AGCGCTTTAAGGCCAGGCTCAGG + Intronic
977563849 4:98561787-98561809 AGCCTGGTAAGGCCAGGCCCTGG + Intronic
984985737 4:185328212-185328234 GGCCCTTTAAGAACAGGGCTAGG + Intronic
985022994 4:185711789-185711811 GGCCTTTTAAAGACAGACCCGGG - Intronic
986376471 5:7137015-7137037 AGCCCTGGAAGCCCAGGCCCTGG + Intergenic
998038930 5:138938426-138938448 GGCTCTCTAGGGCCAGGCCAGGG + Intergenic
998147435 5:139738254-139738276 GGCCCTTGAATGCCAGTGCCAGG + Intergenic
1001571576 5:172733638-172733660 GGTGCTTTCCGGCCAGGCCCAGG - Intergenic
1001924525 5:175626751-175626773 GTGCCTTGAATGCCAGGCCCAGG + Intergenic
1002105254 5:176876808-176876830 GGCCCTTCAATGCCAGGCCAGGG + Intronic
1002637324 5:180614827-180614849 GGCTCATCAAGACCAGGCCCTGG + Intronic
1002715133 5:181222543-181222565 CGCCCTTGTAGGACAGGCCCGGG + Intronic
1006300323 6:33190642-33190664 GGCCCTTTGAGTCCAGGAGCCGG + Intronic
1006409443 6:33863747-33863769 GGGCCATTAGAGCCAGGCCCTGG - Intergenic
1007741242 6:44010841-44010863 GGCCCCCTAAGGCCAGCACCGGG + Intergenic
1009619998 6:66063566-66063588 GCCCCTTTCATGCCAGGGCCAGG + Intergenic
1010991745 6:82486846-82486868 GGCCCATTAAGGGCAGGACTAGG - Intergenic
1011913378 6:92470259-92470281 TGCATTTTAAGGACAGGCCCAGG + Intergenic
1017559636 6:155613689-155613711 GGCCCTTTAAGAACAGGGCTAGG + Intergenic
1017714617 6:157200300-157200322 GACCCTTTCAGGCCGGCCCCTGG + Intronic
1017849098 6:158287862-158287884 GGCCCTTGAATGCCAGGCTGAGG + Intronic
1018314472 6:162543192-162543214 TGTCCTTTAATGCCAGGACCAGG + Intronic
1018742550 6:166741690-166741712 GGCCCTTGAAGGCGGGGCCCTGG - Intronic
1022178394 7:27894511-27894533 GCCTCTTTAAGGCGAGGACCTGG + Intronic
1022645575 7:32226173-32226195 GGGGCTTTAAAACCAGGCCCTGG - Intronic
1023812286 7:43920896-43920918 GGCCCTTTAAGAGCAGGGCTAGG - Intronic
1026988813 7:74571388-74571410 GGGCCCTTCAGGCCTGGCCCTGG + Intronic
1028472917 7:91224157-91224179 GGCCCTCTAAGCACAGGGCCTGG - Intergenic
1030951938 7:115801922-115801944 AGCCCTTTGAGGTCAGGCCTTGG + Intergenic
1031490967 7:122387825-122387847 GGCCCCTTAAGGCAAGGCCCTGG - Intronic
1032077907 7:128844747-128844769 GGCCCTCTACGGTCAGCCCCAGG - Exonic
1032524299 7:132568045-132568067 GGCCCTTTAGGGTCAGGCTGGGG - Intronic
1032608490 7:133385157-133385179 GGTCTTTTAAGGCCTGGCCTTGG + Intronic
1035249768 7:157589280-157589302 AGCTCTTCAATGCCAGGCCCTGG - Intronic
1039049028 8:33476168-33476190 GGCCACTTAAGGCCTGGACCCGG - Intronic
1039990621 8:42484802-42484824 GGGTCTGGAAGGCCAGGCCCAGG - Intronic
1040375056 8:46817002-46817024 TGCCCTTTGTGGGCAGGCCCAGG - Intergenic
1040531782 8:48271920-48271942 GGCCCATTCAGGCCTGGGCCTGG + Intergenic
1049260476 8:141636312-141636334 GACCCTGGAATGCCAGGCCCCGG + Intergenic
1049439054 8:142600974-142600996 GGACCTTGAAGGCCAAGCCAAGG + Intergenic
1049488701 8:142879685-142879707 TGCCCTTTGAAGCCATGCCCCGG - Exonic
1049678449 8:143904081-143904103 AGCCCTTCCATGCCAGGCCCAGG + Intergenic
1050923293 9:11233329-11233351 GGCCCTTTAAGAACAGGGCTAGG + Intergenic
1052930023 9:34048640-34048662 GTCCCTCTACGTCCAGGCCCGGG - Intronic
1052987878 9:34501501-34501523 GGCCCTTTGAGGGCTGACCCTGG - Intronic
1053285044 9:36844814-36844836 GCCCCTTGAAGGCCAGGCTGGGG - Intronic
1053729190 9:41035231-41035253 TGCCCATAAATGCCAGGCCCTGG - Intergenic
1054699323 9:68396836-68396858 TGCCCATAAATGCCAGGCCCTGG + Intronic
1055400251 9:75916089-75916111 GGCACTTTAAAGCCAGGCTCAGG + Intronic
1056867501 9:90242348-90242370 GACCCATATAGGCCAGGCCCTGG + Intergenic
1057208268 9:93185685-93185707 GGCTTCTTAAGGCCAGGCGCAGG - Intronic
1058967543 9:110050926-110050948 TGCCCTTTAAGGAAAGGGCCAGG - Intronic
1059342985 9:113609985-113610007 GGCCCTGTAAGGCCAGGAGAAGG + Intergenic
1059435012 9:114270787-114270809 TGCCCTTTTAGGGCAGGGCCTGG + Intronic
1060111747 9:120911468-120911490 GGCCCAGAAAGACCAGGCCCTGG - Exonic
1060229793 9:121818211-121818233 GGCCCTTTGTGGCCAGGCCTGGG - Intergenic
1060452557 9:123756840-123756862 GGCCTTTTATTCCCAGGCCCAGG + Intronic
1060486990 9:124054172-124054194 GGCCCTTTCAGGCCCCTCCCAGG + Intergenic
1060727621 9:126016652-126016674 GGCCCTGCTAGGCCTGGCCCTGG + Intergenic
1060934923 9:127509207-127509229 GGTCCTCGAAGTCCAGGCCCTGG + Intronic
1061798327 9:133101237-133101259 GGGCCTATGTGGCCAGGCCCTGG + Intronic
1061972206 9:134050855-134050877 GGCCCTTGACTGCCAGGCCATGG - Intronic
1062089939 9:134670576-134670598 GACCCTTTTAGGCAAGCCCCCGG + Intronic
1062436217 9:136547686-136547708 GGCCCATGTAGCCCAGGCCCGGG + Intergenic
1203424448 Un_GL000195v1:24622-24644 GCCCCTGTAAGGCAGGGCCCAGG + Intergenic
1189632711 X:42972530-42972552 GGCCCTTTAAGAGCAGGGCTAGG + Intergenic
1191055321 X:56233942-56233964 GGCCCTTTAAGACGTGGCCAAGG + Intronic
1191189613 X:57652318-57652340 AGCCCTTTAAGGGCAAGACCAGG - Intergenic
1192158087 X:68761567-68761589 ACCCCTCTCAGGCCAGGCCCTGG - Intergenic
1192213638 X:69143093-69143115 GGCCCATTAAGGCCGGAGCCCGG + Intergenic
1193338131 X:80314234-80314256 GGCCCTTTAAGAACAGGGCTAGG - Intergenic
1193833900 X:86319942-86319964 GACCCTTTAAGAACAGGGCCAGG + Intronic
1196791541 X:119468916-119468938 CGCCCTTGACGCCCAGGCCCGGG - Intronic
1198067395 X:133112331-133112353 AGCCCTTTTAGGGCAGGCCTGGG - Intergenic
1199082962 X:143596390-143596412 GGCCCTTTTAGTACAGGCCAAGG - Intergenic
1200213976 X:154359366-154359388 GGCCCTCTACAGCCAGGCCCAGG + Exonic
1200822777 Y:7605185-7605207 GGCCCTTTAAGAGCAGGGCTAGG + Intergenic
1201396811 Y:13557209-13557231 GGCCCTTTAAGAACAGGGCTAGG - Intergenic
1201630143 Y:16062865-16062887 GGCCCTTTAAGAACAGGCCTAGG + Intergenic
1202237278 Y:22725904-22725926 GGCCCTTTAAGAGCAGGGCTAGG - Intergenic