ID: 1091452328

View in Genome Browser
Species Human (GRCh38)
Location 12:580712-580734
Sequence TGTATACTATAGCCATTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091452328_1091452331 19 Left 1091452328 12:580712-580734 CCTGCCAATGGCTATAGTATACA 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1091452331 12:580754-580776 TGACTCCCCTCCATATGCCACGG 0: 1
1: 0
2: 1
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091452328 Original CRISPR TGTATACTATAGCCATTGGC AGG (reversed) Intronic
903689587 1:25163214-25163236 TGTAAACTATAGACTTTGGGTGG + Intergenic
910943740 1:92565635-92565657 TGTATACTAACATCATTGGCAGG + Intronic
914963890 1:152235507-152235529 TGTATTCTGTAGCTATTGGATGG + Intergenic
917638847 1:176962598-176962620 AGTATATTATAGGCATTTGCAGG + Intronic
921241868 1:213193164-213193186 TATTTTCTATAGCCATTGGAAGG + Intronic
923116121 1:230939421-230939443 TGTATAGCATAGCTATAGGCTGG + Exonic
923633905 1:235675378-235675400 TGTATCCTCTCGCCATTGGCTGG - Intronic
1063232571 10:4079936-4079958 TGTCAGCTATAGCCATTGTCTGG - Intergenic
1065505253 10:26424027-26424049 TGTGTCCTGTCGCCATTGGCTGG - Intergenic
1068551064 10:58408535-58408557 TGTCTACCCTAGCCATTGCCTGG - Intergenic
1069118909 10:64543929-64543951 TCTATACTATAGCAAATGGCAGG - Intergenic
1069168519 10:65195144-65195166 AGTATCCCATAGACATTGGCTGG + Intergenic
1069628755 10:69884296-69884318 TTTATACCACAGACATTGGCAGG + Intronic
1071523670 10:86346125-86346147 TGCATACTATGGCCACTAGCTGG - Intronic
1074460196 10:113629719-113629741 TGTTTACCATATCCATGGGCAGG + Exonic
1078811392 11:14769748-14769770 TGTATACTGTAGCCTTTGGAGGG + Intronic
1082972198 11:59035784-59035806 TGAATCCTATATCCACTGGCTGG + Intronic
1083376130 11:62223229-62223251 TGTGTCCTATCTCCATTGGCTGG - Intergenic
1085838277 11:79979927-79979949 AGTATGCTATATCCATTGGATGG - Intergenic
1088445596 11:109923862-109923884 TGTATTCTATAGCTGTTGGATGG - Intergenic
1091452328 12:580712-580734 TGTATACTATAGCCATTGGCAGG - Intronic
1092300601 12:7245998-7246020 AGTATACTATTGACATTGCCTGG - Intergenic
1097896643 12:64830405-64830427 TGCACAGTATAGCCATTGACTGG + Exonic
1099808500 12:87550012-87550034 TGTATTCTACAGCCATTGGATGG - Intergenic
1101204209 12:102469061-102469083 TGTATCCTATCTCCAGTGGCTGG - Intronic
1102974856 12:117199295-117199317 TCTATAATATAGCAACTGGCTGG + Intergenic
1104751413 12:131242176-131242198 TGTGTCCTATCTCCATTGGCTGG + Intergenic
1108471912 13:50775787-50775809 AGTTTACAATAGCTATTGGCAGG + Intronic
1110820252 13:79907222-79907244 TGTTTACAATAGCCATGGGATGG - Intergenic
1111593861 13:90386674-90386696 TGTAAATTCTAGCCACTGGCAGG - Intergenic
1113037911 13:106071280-106071302 TTTAAAATATAGCCATTTGCTGG + Intergenic
1117016868 14:51527047-51527069 TGTGTACTTTACCCATGGGCAGG - Intronic
1117388587 14:55241215-55241237 TGGATGCTAAAGCCAGTGGCGGG - Intergenic
1120048986 14:79843037-79843059 TGTATATTGTAGCAAATGGCAGG + Intronic
1120260086 14:82172930-82172952 TGTATTCTGCAGCCATTGGATGG + Intergenic
1127775687 15:62262590-62262612 TGTGTCCTATCTCCATTGGCTGG + Intergenic
1129915979 15:79272153-79272175 TGTATACTATGTTCACTGGCAGG + Intergenic
1129948318 15:79561259-79561281 TGTACACTTTCCCCATTGGCCGG - Intergenic
1134017483 16:10899181-10899203 TGTATTTTGTAGCCATTGGAGGG - Intronic
1135781869 16:25310395-25310417 TGTATCCTGTAGCCATTGTATGG + Intergenic
1139327347 16:66162811-66162833 TGTCTAATATAGCTCTTGGCTGG - Intergenic
1141820928 16:86445079-86445101 TCTAACCTAAAGCCATTGGCAGG - Intergenic
1142588358 17:988419-988441 TGTATACTATTTCCATTAGATGG + Intergenic
1143929351 17:10405309-10405331 TGCAAACTATAGCCATAGACTGG + Intronic
1146152163 17:30483594-30483616 TGGAGACTATAGTCATTGCCTGG + Intronic
1156021489 18:32604866-32604888 TGTATTCTGCAGCCATTGGATGG + Intergenic
1156414114 18:36869584-36869606 TGTATGCTATAGCTATTCTCAGG + Intronic
1158385289 18:56982599-56982621 TGTTTACTACAGCCTTTGTCTGG + Intronic
1163265882 19:16221438-16221460 TGTGTCCTATCTCCATTGGCTGG + Intronic
1166246154 19:41528152-41528174 TGTGTGCTATCTCCATTGGCTGG + Intergenic
926503455 2:13682322-13682344 TGTGTCCTACATCCATTGGCTGG - Intergenic
929957504 2:46469923-46469945 TTTATAGTAAAGCCATTTGCAGG + Intronic
932113255 2:69021117-69021139 TGTTTACTATAGCGTCTGGCAGG - Intronic
932907359 2:75768337-75768359 TCTATACTCTGGCCATTGTCTGG - Intergenic
933780592 2:85797959-85797981 TTTAAAATAGAGCCATTGGCTGG - Intergenic
936771888 2:115923697-115923719 TGTACACTATACCCATTGTGTGG + Intergenic
937726380 2:125172491-125172513 TGTATACTTTAGCCAGTACCAGG + Intergenic
939203789 2:139073781-139073803 TGTATACTTTGGCCTTTTGCTGG + Intergenic
939306991 2:140425075-140425097 TGTTTAGAATTGCCATTGGCAGG + Intronic
939851101 2:147305943-147305965 TGTATACTATAGCTGTTTTCTGG + Intergenic
942204796 2:173609510-173609532 TATAAAATATAGCCATTGCCTGG - Intergenic
944929762 2:204505117-204505139 TGTATTCTATATCCAGTGTCTGG - Intergenic
1168810067 20:699452-699474 TGTAAGCTACAGCCTTTGGCAGG - Intergenic
1169768605 20:9176756-9176778 TGTTTACTTTAGTCATTTGCTGG + Intronic
1174259199 20:49281281-49281303 TGTGTCCTATCCCCATTGGCTGG + Intergenic
1177001113 21:15614409-15614431 TGTAAACTATAAACTTTGGCAGG + Intergenic
1177300279 21:19235160-19235182 TGCATACTATAGTCTTTGGAAGG - Intergenic
1178203247 21:30432272-30432294 TGTATACTATAGACCTTTACAGG + Intergenic
1180014048 21:45071506-45071528 CGTATCCTGTAGGCATTGGCAGG + Intergenic
952270516 3:31826519-31826541 TTTATTCTATTGCCTTTGGCTGG + Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
957112627 3:75984552-75984574 TTTATACTATAGTCATTAACTGG + Intronic
959868287 3:111297109-111297131 TGTATTCTGTAGCCATTGGATGG + Intronic
963784143 3:149515824-149515846 TGTATCATGTAGTCATTGGCAGG - Intergenic
968982680 4:3858994-3859016 TGTACACTAGAGCCCTAGGCAGG + Intergenic
972101644 4:35427441-35427463 TTTATACTAAAACCATTGGGAGG - Intergenic
973158077 4:46982675-46982697 TGTATCCCATAGTCATTGGGAGG + Intronic
974110709 4:57522362-57522384 TGTATCCTACTGCCATTGGGAGG - Intergenic
977530367 4:98193758-98193780 TGTGTCCTATCTCCATTGGCTGG + Intergenic
981603282 4:146515954-146515976 TGTATTCTGTAGCCATCGGTTGG - Intronic
982517925 4:156375445-156375467 TGTATCCTATAGGTTTTGGCAGG - Intergenic
982549731 4:156782900-156782922 TGAATAATATAGCCATTGTGAGG + Intronic
987496332 5:18649968-18649990 TGTATTCTGCAGCCATTGGATGG + Intergenic
991481375 5:67084267-67084289 TGTATACTGTTGTCACTGGCAGG + Intronic
993373537 5:87120731-87120753 TGTATGCTATAGTCATCGTCTGG - Intergenic
996994095 5:129673932-129673954 TTAATAATATGGCCATTGGCCGG + Intronic
997001387 5:129766203-129766225 TGCATAAGATAGCCTTTGGCTGG - Exonic
999785454 5:154885954-154885976 TGTATCCTTTTCCCATTGGCTGG - Intergenic
1001292870 5:170476944-170476966 TGTAAACTATAGACTTTGGGTGG + Intronic
1005037075 6:21566201-21566223 TGTATTCTATAGCCTTTGAATGG + Intergenic
1005769671 6:29054731-29054753 TGTATACTATATTCACTGTCTGG + Intergenic
1009378342 6:62999299-62999321 TGTACACTTTCCCCATTGGCTGG + Intergenic
1009673619 6:66788291-66788313 TGCATGCTAATGCCATTGGCAGG - Intergenic
1011669475 6:89669270-89669292 TGTATACTAAAGATAGTGGCAGG - Intronic
1016815490 6:148299223-148299245 TTTAAACTATAGCCAGTTGCTGG + Intronic
1017903248 6:158736490-158736512 TGTATAATAAAACCATTGGCTGG + Intronic
1020704489 7:11527102-11527124 TGCATACCATAGCCATTTCCTGG + Intronic
1020730368 7:11871551-11871573 TGCATACTATACCCTTTGGAAGG + Intergenic
1023237291 7:38103022-38103044 TGTAAACTATATCCAGTGGCTGG - Intergenic
1029309355 7:99647352-99647374 TGAATACTAAAGCCATTAGGTGG - Intergenic
1031026115 7:116681726-116681748 TGGACAGTGTAGCCATTGGCTGG - Intronic
1031632414 7:124060494-124060516 TATCTACAATAGCCAATGGCAGG - Intergenic
1034656453 7:152733557-152733579 TGTGTCCTATCTCCATTGGCTGG + Intergenic
1036453374 8:8888834-8888856 TGTAAACTATGACCTTTGGCTGG + Intronic
1039807112 8:41009715-41009737 TGGATGCTATAGCCCTTGACTGG - Intergenic
1039961490 8:42251304-42251326 TGTATCCTGCATCCATTGGCTGG + Intergenic
1040621163 8:49094836-49094858 TGTATCCTGCATCCATTGGCTGG - Intergenic
1044947332 8:97401802-97401824 TGTATACTGCAGCCATTTGGGGG - Intergenic
1045114622 8:98969587-98969609 TATATCCTATAGCTATTGGGAGG + Intergenic
1045879189 8:107017828-107017850 TGTATTCTGTAGCTATTGGTTGG - Intergenic
1047782947 8:128124527-128124549 TGTACACTATTGCCATAGCCTGG - Intergenic
1055271878 9:74569374-74569396 TGTATAGTGTAGCCATAGGCAGG + Intronic
1192790420 X:74377023-74377045 TGTATTCTGCAGCCATTGGATGG + Intergenic
1193209859 X:78794305-78794327 TGTATACTGCAGCCGTTGGATGG + Intergenic
1194686793 X:96928772-96928794 TGTGTACTATAGTCAATGGATGG + Intronic
1199502644 X:148525299-148525321 TATATAATATTGACATTGGCTGG - Intronic
1199867720 X:151868893-151868915 TGTGTACTCTATCCATTGTCAGG + Intergenic