ID: 1091461164

View in Genome Browser
Species Human (GRCh38)
Location 12:644229-644251
Sequence CAGGCCCACATTTAGGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091461164_1091461169 26 Left 1091461164 12:644229-644251 CCTCAAACCTAAATGTGGGCCTG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1091461169 12:644278-644300 AGTTTCTCATTCAGTACCTCTGG 0: 1
1: 2
2: 28
3: 283
4: 1216
1091461164_1091461171 28 Left 1091461164 12:644229-644251 CCTCAAACCTAAATGTGGGCCTG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1091461171 12:644280-644302 TTTCTCATTCAGTACCTCTGGGG 0: 1
1: 3
2: 17
3: 245
4: 1021
1091461164_1091461167 -5 Left 1091461164 12:644229-644251 CCTCAAACCTAAATGTGGGCCTG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1091461167 12:644247-644269 GCCTGAATCGCAGCGGATCTTGG 0: 1
1: 0
2: 0
3: 0
4: 38
1091461164_1091461170 27 Left 1091461164 12:644229-644251 CCTCAAACCTAAATGTGGGCCTG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1091461170 12:644279-644301 GTTTCTCATTCAGTACCTCTGGG 0: 1
1: 3
2: 25
3: 283
4: 1131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091461164 Original CRISPR CAGGCCCACATTTAGGTTTG AGG (reversed) Intronic
901215375 1:7551990-7552012 CAGGCCCACTTCTAGGATTCTGG - Intronic
901544270 1:9943623-9943645 CAAGCTCATATTCAGGTTTGGGG + Intronic
903366448 1:22808240-22808262 CAGCACCGCATTCAGGTTTGGGG - Intronic
903925827 1:26829811-26829833 CAGGCCCACAGCTAGGTTCAAGG - Intronic
903992582 1:27284145-27284167 CAGGCCCACATTTAATTCTGTGG - Intronic
907032444 1:51185776-51185798 CAGACCTACATTAAAGTTTGAGG + Intergenic
908390171 1:63677033-63677055 CTGGCCCACTTCTAGGTTTTTGG + Intergenic
909226591 1:73032367-73032389 CAGGGCCAGAGTTAGATTTGTGG - Intergenic
911698936 1:100927570-100927592 AGGGCCCACTTTGAGGTTTGTGG + Intronic
914829050 1:151157320-151157342 CAGACTCCCATTTTGGTTTGGGG + Intronic
916371031 1:164094370-164094392 CTGACCCACACTTAGGTTTGTGG - Intergenic
916834124 1:168524671-168524693 CAGGCCCACCTTTGGCATTGGGG + Intergenic
917125692 1:171685507-171685529 CAGGCCCAGAATTAGTTTTAAGG - Intergenic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
921424704 1:214988140-214988162 CCTGCCCACATTTAGGGGTGAGG - Intergenic
922192164 1:223328885-223328907 CAGGCCAAAATTAAAGTTTGTGG - Intronic
1063123708 10:3122706-3122728 CTGGGCAGCATTTAGGTTTGAGG + Intronic
1063241653 10:4175812-4175834 CAGGCCCACATGGAGGTCTGTGG - Intergenic
1063330633 10:5155566-5155588 CAGGCCCAAATTCAGGCATGGGG - Intergenic
1063730255 10:8688218-8688240 CTGGCCCAGATTTGGGGTTGAGG + Intergenic
1066504845 10:36030672-36030694 CAGGCCCATACTTAGTTTTGAGG + Intergenic
1067781795 10:49213063-49213085 CAGGCCAACAATAAGCTTTGTGG + Intergenic
1069888353 10:71637848-71637870 CAAGGCCACCTTTATGTTTGGGG - Intronic
1070781619 10:79140753-79140775 CAGGCCCGCATTAAGGGCTGGGG + Intronic
1070882573 10:79862374-79862396 CACACACACATTGAGGTTTGGGG - Intergenic
1070976596 10:80610328-80610350 CAGGCTCACATTCAGGTGGGAGG - Intronic
1078267408 11:9765564-9765586 CAGGCCCACACGTAGGCTGGAGG + Intergenic
1078602546 11:12746721-12746743 CAGGCCCACTGTTATTTTTGTGG + Intronic
1086038116 11:82441554-82441576 CAGGCTCAGATTTGGGTTTTAGG + Intergenic
1087140060 11:94756280-94756302 CCTGTCCTCATTTAGGTTTGTGG + Intronic
1090798670 11:130156907-130156929 CAAGCCCAGATTTTGGCTTGAGG - Intergenic
1091461164 12:644229-644251 CAGGCCCACATTTAGGTTTGAGG - Intronic
1095397060 12:41773211-41773233 TAGGGCCACATTGAGGTTGGAGG + Intergenic
1096528868 12:52231159-52231181 CAGGCTCACATCTGGGGTTGTGG - Intergenic
1096608305 12:52783481-52783503 CAGGCCCACGTTTAACTCTGGGG - Intergenic
1099066078 12:77981246-77981268 AAGGACCACATATAGTTTTGAGG + Intronic
1099122120 12:78703605-78703627 CAGGGTCACATTTATCTTTGTGG + Intergenic
1101888279 12:108688562-108688584 CTGACCCACATATTGGTTTGTGG + Intronic
1102198570 12:111041947-111041969 CAGGCCCACTTTTGGGGGTGTGG - Intronic
1107764778 13:43722455-43722477 CAGGCCCACATTTACTTCTTTGG - Intronic
1108578339 13:51807978-51808000 AAGGCCCACATTCAGCTCTGAGG + Intergenic
1114244793 14:20902721-20902743 CATACCCATATTTAGGATTGTGG + Intergenic
1114247797 14:20930871-20930893 CATACCCATATTTAGGATTGTGG + Intergenic
1115541007 14:34421326-34421348 CAGGGTCACCTTTAGCTTTGAGG - Intronic
1116552782 14:46263701-46263723 CAGGCCCACATGTTGGTCGGGGG + Intergenic
1118036845 14:61877317-61877339 CAGTCCGACAGTTAGGTCTGGGG + Intergenic
1125579516 15:40775544-40775566 CAGGCTCACCTTTAGTTTGGGGG + Exonic
1125842083 15:42812396-42812418 CTGTCCCTCATTTAGATTTGGGG + Intronic
1127627028 15:60789592-60789614 CAGGGACAGATCTAGGTTTGGGG + Intronic
1128255875 15:66196168-66196190 CAGGCCCATATTCAGGATTTGGG + Intronic
1128753561 15:70165878-70165900 CAGGCCCACAATTAGGAGAGAGG + Intergenic
1131928458 15:97412993-97413015 GAAGCCCACACTTAGGTTTCTGG + Intergenic
1133700825 16:8306985-8307007 CTAGCCAACATTTAGGTTTTAGG - Intergenic
1135417048 16:22276515-22276537 CAGGCCCAAATTTGCGTTTAAGG + Intronic
1140041880 16:71413560-71413582 CAGGCCCACCTCTGGGTTGGAGG - Intergenic
1140319335 16:73933234-73933256 TATACACACATTTAGGTTTGGGG - Intergenic
1141166103 16:81661933-81661955 CATGCCCACATTAAGGATGGGGG - Intronic
1141959377 16:87394058-87394080 CAGGGCCACTTTTAGGTTCCAGG - Intronic
1143815222 17:9507218-9507240 CAGGCCCTGATTGAGGTGTGGGG - Intronic
1144257006 17:13478492-13478514 CTTGCCCACATTTTGGTTTCAGG + Intergenic
1145765358 17:27455539-27455561 CAGGGCCACATTCAGATCTGAGG + Intergenic
1152566863 17:81104175-81104197 CAGGCCCCTATTGAGGGTTGTGG - Intronic
1154335983 18:13465052-13465074 GAGGCCCCCATTTAGCTCTGCGG - Intronic
1156463188 18:37333101-37333123 CAGGCCCTGATTTAGTTGTGAGG + Intronic
1157984165 18:52418561-52418583 CAGGCCCAGGTTTTGGTTAGGGG + Intronic
1159794875 18:72830083-72830105 CAGGCCCACATCTACCTATGTGG + Intronic
1162247361 19:9412987-9413009 CATACACACATTAAGGTTTGTGG + Exonic
1164725214 19:30461515-30461537 GAGCCCCACACTTAGGCTTGAGG + Intronic
1168712530 19:58510090-58510112 CAGGCCTACATTGGGGTTTGAGG + Intronic
931995917 2:67838988-67839010 CAGGCCTAGCTTTAGGTTTCTGG - Intergenic
932932832 2:76062513-76062535 CAGTCCCAGATTTATGTATGTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
940455255 2:153889936-153889958 CTGGCCAAAATTTAGTTTTGTGG + Intronic
945036949 2:205712048-205712070 ATGGCCCAAATGTAGGTTTGGGG + Intronic
945902503 2:215554756-215554778 CATGCCCACATTTAGATCTTCGG + Intergenic
946361486 2:219221570-219221592 CAGGCACTCTTTTAGGTGTGGGG + Intronic
946612683 2:221476288-221476310 CTGGCCCACAGTTAGGTATGAGG - Intronic
946663110 2:222021607-222021629 CAGGCCCACATTTCCCTTTTTGG - Intergenic
947269258 2:228315404-228315426 CAGGAGCACATCTAGTTTTGTGG - Intergenic
947752900 2:232541973-232541995 CCTCCCCACACTTAGGTTTGAGG - Intronic
948089352 2:235279545-235279567 CAGGCCCCCATTGAGCTTTCAGG - Intergenic
948866272 2:240776333-240776355 GAGGGCCACATTTAGCTGTGGGG - Intronic
1169123110 20:3109230-3109252 CAGCCCAACATTTAGCTTTATGG - Exonic
1182879743 22:33723286-33723308 CAAGCCCAGATTTAGGTTCACGG + Intronic
952727477 3:36602361-36602383 AATGCCAACATTTAGATTTGGGG - Intergenic
953035879 3:39210666-39210688 CTCTCCCCCATTTAGGTTTGTGG + Intergenic
953132044 3:40149391-40149413 CAGGCCCACCTCTAGCATTGGGG + Intronic
953821795 3:46213235-46213257 CACTCCCACATCTAGGGTTGGGG + Intronic
954831115 3:53422124-53422146 TAGGCCAACAATGAGGTTTGAGG - Intergenic
961716244 3:128859442-128859464 CAGGACCACAGTAAGGTTCGGGG - Intergenic
962015746 3:131438633-131438655 CAGGCCCACAGCCTGGTTTGTGG - Intergenic
964935446 3:162079572-162079594 GAGGGCCACATTTGGCTTTGAGG + Intergenic
966040978 3:175487397-175487419 CAGATACACATTTAGGTTTCAGG - Intronic
967525137 3:190483737-190483759 CAAGCCAACATATAGGTTTTAGG - Intergenic
969979761 4:11142550-11142572 CAGGCACACATTTAACTCTGGGG - Intergenic
973771375 4:54210121-54210143 CAGAGCCACATTTAGGTGTCTGG + Intronic
979385024 4:120054563-120054585 CAGCCCTAAATTGAGGTTTGGGG + Intergenic
981252584 4:142622176-142622198 CGGGCCCACATTGAGCTTTTTGG - Intronic
993126666 5:83844165-83844187 CAGACCCACATGTAGATGTGGGG + Intergenic
1000589685 5:163143844-163143866 TAGGCCCACATCTAGGTTTTTGG - Intergenic
1001894540 5:175367014-175367036 CAGTCCCTCATTTAGATTTGGGG + Intergenic
1002289385 5:178189129-178189151 CAGGCACTCACATAGGTTTGAGG - Intergenic
1002867236 6:1132253-1132275 CAGGTGTACATTTAGGGTTGAGG - Intergenic
1007189180 6:39998792-39998814 CAGAACCACAGTTAGGTTTGGGG - Intergenic
1007926123 6:45651119-45651141 CAGGGCCAAATTTAGAGTTGGGG + Intronic
1017572803 6:155765239-155765261 CAGGCACACATTTAGGGCAGGGG + Intergenic
1018906260 6:168077943-168077965 AACGCCCACATCTATGTTTGTGG - Intronic
1023521949 7:41058231-41058253 AGGTCCCACATTTAGGTTTTAGG + Intergenic
1024391585 7:48819104-48819126 CAGCTCCACATTTTGGTGTGTGG - Intergenic
1025810959 7:64875211-64875233 CATGCCCACATCTAGGATCGCGG - Intronic
1032449717 7:132019580-132019602 CAAGTCCACATTTAGCTCTGTGG - Intergenic
1035592332 8:825336-825358 CAGGCACACAGTTAGGATTTGGG + Intergenic
1039890241 8:41680999-41681021 CAGCCACACATATTGGTTTGGGG + Intronic
1040339726 8:46434436-46434458 CAAGGCCACATTTCGGCTTGTGG + Intergenic
1040895621 8:52365678-52365700 CAGGCACAATTTTGGGTTTGGGG + Intronic
1041632964 8:60108817-60108839 CAGGCACACACTAAGTTTTGTGG - Intergenic
1045507434 8:102788758-102788780 CTGGCCCACATTTTGGGTTGAGG + Intergenic
1052654665 9:31341182-31341204 TAGTCCCATATTTAGGTTTGAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053021432 9:34697215-34697237 CATGCACACATTAAAGTTTGAGG - Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054935582 9:70684188-70684210 TAGCAACACATTTAGGTTTGAGG + Intronic
1058472116 9:105290659-105290681 CAGGCCCACAATTATTTTTTAGG + Intronic
1059252287 9:112896063-112896085 CAGGCCCACCAATAGGTATGAGG + Intergenic
1060029620 9:120203159-120203181 CACGCACACAGTTAGGTGTGAGG - Intergenic
1060083858 9:120679167-120679189 CATGCACACATTTATTTTTGCGG + Intronic
1062336963 9:136075584-136075606 TAGGCCCACATTCAGGGTTCGGG + Intronic
1187015945 X:15329107-15329129 AAGGCCCACATCTAGATTTTAGG + Intronic
1189102491 X:38205987-38206009 CAGGCCCATATTTGGGATGGTGG - Intronic
1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG + Exonic
1199388251 X:147248368-147248390 CTGGACCACATCCAGGTTTGAGG - Intergenic