ID: 1091462915

View in Genome Browser
Species Human (GRCh38)
Location 12:659374-659396
Sequence CTGCATTTTGGGAAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091462905_1091462915 21 Left 1091462905 12:659330-659352 CCAATAACTGGATCTGCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG 0: 1
1: 0
2: 3
3: 25
4: 295
1091462908_1091462915 5 Left 1091462908 12:659346-659368 CCTGGGGAATCTGGAAGCCCAAG 0: 1
1: 0
2: 4
3: 33
4: 205
Right 1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG 0: 1
1: 0
2: 3
3: 25
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091462915 Original CRISPR CTGCATTTTGGGAAGGAGCC AGG Intronic
900001640 1:17851-17873 CTGGATACTGGGGAGGAGCCGGG - Intergenic
900021361 1:188375-188397 CTGGATACTGGGGAGGAGCCGGG - Intergenic
900507169 1:3035439-3035461 CAGCAGTTTGGGCAGGGGCCAGG + Intergenic
900680417 1:3913280-3913302 CTGCTCTGTGGGAAGCAGCCTGG + Intergenic
900746189 1:4362245-4362267 CAGCATTTTGGGAATGAGAAAGG + Intergenic
901285926 1:8078874-8078896 TTCCATTGTGGGAAGGATCCTGG + Intergenic
902569335 1:17336873-17336895 CTGCATTTCGGGAGGGATACAGG - Intronic
902634825 1:17728447-17728469 CAGCATTTTGGGAGGGATGCAGG - Intergenic
903087487 1:20875663-20875685 CAGCACTCTGGGAAGGAGGCAGG + Intronic
903391988 1:22971218-22971240 CTGCATTTTGAGGAGGAGGGGGG - Intergenic
903443486 1:23405727-23405749 ATGCATTAGGGGAGGGAGCCAGG + Intronic
903601546 1:24545591-24545613 CTCCTTTGGGGGAAGGAGCCTGG - Intergenic
903708293 1:25303071-25303093 CAGCATTTAGGGAATGAGCTGGG - Intronic
903718823 1:25389342-25389364 CAGCATTTAGGGAATGAGCTGGG + Intronic
904211403 1:28888462-28888484 CTGCATGTTGGGGAGGAGGGTGG + Intronic
904260131 1:29283370-29283392 GTGCTCTGTGGGAAGGAGCCTGG - Intronic
905280393 1:36845533-36845555 CCCCAATTTGGGAAGGATCCAGG + Intronic
908510990 1:64850019-64850041 CTGCCTGCTGTGAAGGAGCCTGG - Intronic
909588219 1:77315181-77315203 CTGCTTTCTGGGAAGGTACCTGG - Intronic
910262115 1:85302940-85302962 CTACAGTTTGGGAAGTGGCCCGG + Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912800357 1:112715977-112715999 CTGCATTGTGGGAAAGACCTGGG - Intergenic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915488502 1:156238729-156238751 CTGCAGCTTGGGAAGGGCCCCGG + Intronic
915725123 1:158011770-158011792 CAGCAGTGGGGGAAGGAGCCTGG + Intronic
916353082 1:163874355-163874377 CTGCACTTTGGGCAGGAGGAGGG + Intergenic
916358745 1:163943447-163943469 CAGCACTTTGGGAGGGAGGCAGG + Intergenic
917070161 1:171141841-171141863 CTGAACTGTGGGATGGAGCCTGG - Intronic
918214157 1:182378619-182378641 CAGCATTTTGTAAAGGAGACAGG - Intergenic
920233699 1:204487843-204487865 CTGCATTTTGGGTGGGAGGGGGG + Intronic
920915923 1:210257930-210257952 CTGCAGCTTGAGAAGGAGCCAGG - Intergenic
921383802 1:214550866-214550888 CTGCGTTTTGGGAACGAGAGAGG - Intronic
924281218 1:242439229-242439251 TTGCATGTGGGGAAGGAGCCGGG + Intronic
1063549584 10:7017684-7017706 CTGCAGTTTGGGATGGAGCAAGG - Intergenic
1064970237 10:21058180-21058202 TTTCATTTTGGTCAGGAGCCAGG + Intronic
1066041920 10:31557033-31557055 CTGCATTTTGGCAATGAACAGGG + Intergenic
1066145535 10:32554125-32554147 CTTCATTTTGGGTGGGAGCTGGG - Intronic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1069334117 10:67328182-67328204 CTGCAGTATGGGAGGGAGCATGG + Intronic
1070644893 10:78195072-78195094 CTGCATTTGGGACAGGCGCCAGG + Intergenic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1071712850 10:88066639-88066661 CTGGAATTTTGGACGGAGCCTGG - Intergenic
1072076569 10:91980513-91980535 CTGTGTTTTGGAAAGCAGCCAGG + Exonic
1072892236 10:99334110-99334132 CTGCATTTTAGCAAGCTGCCAGG + Intronic
1073072189 10:100801690-100801712 CTCCATTTGGGGAGGGTGCCAGG + Intronic
1073399407 10:103244513-103244535 CTGCCTTTTGTTAAGGAGACAGG - Intergenic
1074186541 10:111103341-111103363 CTGCTTTTTGGGGTGGAGCTGGG + Intergenic
1074187026 10:111106363-111106385 CTACATTTTGGGATGCAGCTTGG - Intergenic
1074189923 10:111126866-111126888 CTGCATTTTGACAAGGTCCCAGG + Intergenic
1075488304 10:122845838-122845860 CTCCATTTTGGCAAGGCGCTGGG + Exonic
1076106573 10:127828000-127828022 CTGGAGTGTGGGAAGCAGCCCGG + Intergenic
1076445750 10:130512703-130512725 CTGCAATTAGGGATGGGGCCTGG - Intergenic
1076788141 10:132761456-132761478 CAGCATGGTGGGGAGGAGCCTGG + Intronic
1077197375 11:1288210-1288232 CTGCCCTGTGGGGAGGAGCCTGG + Intronic
1078101561 11:8333230-8333252 CTGCGTTTTGGGGAGGAGGCTGG + Intergenic
1078184014 11:9036286-9036308 CTGCATTTAGAGAAGAAGTCTGG - Intronic
1078222733 11:9364865-9364887 CTGCATTTTGGAACTGAGTCAGG - Intergenic
1079684325 11:23338267-23338289 TTGCATTTTGGGAAAGAGAAGGG + Intergenic
1080288599 11:30644947-30644969 CTCCATCTTGGGTAGGAGCTGGG + Intergenic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1083486397 11:62985203-62985225 CTTCCTTTTAGGAAGGAGACTGG + Intergenic
1083621614 11:64052044-64052066 GGGCATTTTGGGAAGGAGGAAGG + Intronic
1085419328 11:76342045-76342067 CTGCATTTTGGCAAGCCACCTGG + Intergenic
1086502450 11:87467226-87467248 CTGCATTTTAAGCAGGAACCTGG + Intergenic
1087566258 11:99862470-99862492 GTGCATTTTGGAAATGAGACAGG - Intronic
1087942568 11:104116731-104116753 ATGCATTGTGGGAGGGACCCAGG + Intronic
1089197738 11:116704607-116704629 CTGCATTTTGGGTATGTGTCTGG - Intergenic
1089572070 11:119417612-119417634 CTACTTTTAGGGAAGGAGCCAGG + Exonic
1091116496 11:133018482-133018504 GTGCATTTTGGAGAGGAGGCTGG - Intronic
1091374727 12:17968-17990 CTGGATACTGGGGAGGAGCCGGG - Intergenic
1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG + Intronic
1092634923 12:10433381-10433403 CTGCGTTTTGGAGAGGAGTCAGG + Intronic
1093815656 12:23543132-23543154 CTGCAGTTGTGGAAGGATCCTGG - Intronic
1094463276 12:30721799-30721821 TTGCTTTTTAGGAAGGAGACTGG + Intronic
1096017617 12:48292488-48292510 GTGCATTTTGGGAAGAAACAGGG - Intergenic
1096568098 12:52497932-52497954 GTGGATTTTGACAAGGAGCCTGG + Intergenic
1096592822 12:52673193-52673215 CTCCATTTTGGGATGGTTCCGGG - Intergenic
1101725253 12:107383335-107383357 CCGCATTTTGAGAGGCAGCCTGG + Intronic
1101927336 12:108983567-108983589 CTGCAGTTGGGGAATCAGCCTGG - Intronic
1104800681 12:131553630-131553652 CTGCATTTTGAGTAGGGGCTGGG - Intergenic
1104811252 12:131621542-131621564 CTGGAACTTGGGAAGCAGCCCGG - Intergenic
1104959410 12:132481088-132481110 CTGCACTTTGCTATGGAGCCTGG - Intergenic
1105309254 13:19191661-19191683 CTGGAATTTGAGAAGGAGCAGGG + Intergenic
1108856770 13:54802463-54802485 CTTCCTTGTGGGAAGGAGCTGGG + Intergenic
1112205387 13:97319117-97319139 CTTCACTCTGGTAAGGAGCCTGG + Intronic
1113278421 13:108761248-108761270 CTGTATTTTGGGAAGGGTCAAGG - Intronic
1113717027 13:112517642-112517664 CAGCACTTTGGGAGGGAGGCAGG + Intronic
1113920644 13:113906802-113906824 CTGCCTCTTGGGAATGGGCCAGG + Intergenic
1114412913 14:22517599-22517621 CTGTCTTTTGGGAAGGGGCTCGG - Intergenic
1114837289 14:26217995-26218017 ACACACTTTGGGAAGGAGCCAGG - Intergenic
1115006477 14:28491685-28491707 ATGAATTTTGGGAAGGGGGCAGG - Intergenic
1115090462 14:29568139-29568161 CTGCATTTTAGCAAAGAGACTGG - Intergenic
1115414890 14:33120712-33120734 CTGCATTTTGACAAGATGCCCGG + Intronic
1116593424 14:46809151-46809173 CTGCATTTTGAATAGGAGCTGGG - Intergenic
1116797393 14:49406638-49406660 CAGCACTTTGGGAAGCAGACGGG + Intergenic
1116858243 14:49972843-49972865 CTGCATCTTGGAAATCAGCCTGG - Intergenic
1117353519 14:54902680-54902702 CTGCCGTTCGGGAAGGACCCCGG + Exonic
1118502874 14:66379568-66379590 GTACATTTTGGGAAGGACACAGG + Intergenic
1119175374 14:72564624-72564646 CTGCATCATGGGGAGGAGCAGGG - Intronic
1119905201 14:78295661-78295683 CAGAATTTTGGGAAGGAGTGGGG - Intronic
1121176234 14:91892641-91892663 CTGCACTCTGGGAAGAAGTCAGG - Intronic
1122472013 14:101975088-101975110 CTACATTGTGGTGAGGAGCCTGG + Intronic
1124170791 15:27370948-27370970 CTTCAGTTTGAGAAGGAGCAGGG - Intronic
1124222646 15:27863473-27863495 CTGCATTTGGACAAGGTGCCGGG - Intronic
1124635256 15:31361021-31361043 CTGCAGCTGAGGAAGGAGCCAGG - Intronic
1124650805 15:31472444-31472466 CTGCCTTTTGGGAAGCTCCCTGG - Intergenic
1125182086 15:36888748-36888770 CAGCAATTTGATAAGGAGCCTGG - Intergenic
1125721077 15:41845469-41845491 CAGCCCTTTGGGAAGGAGGCAGG + Intronic
1125738804 15:41947037-41947059 CTGCATTTAGAGGAGGAGACTGG + Intronic
1126249842 15:46554607-46554629 CTGCTTTTTGGGAGGTAGCAAGG + Intergenic
1126349238 15:47727458-47727480 CTGCATTTTAGCAAGATGCCAGG - Intronic
1127922225 15:63503313-63503335 CTGCATTGCGGGGAGGTGCCCGG + Intergenic
1129779215 15:78258984-78259006 CTGGAGGTTGAGAAGGAGCCAGG - Intergenic
1131956608 15:97742710-97742732 CTACATGATGGGAAGGAACCAGG + Intergenic
1132451869 15:101973089-101973111 CTGGATACTGGGGAGGAGCCGGG + Intergenic
1132455026 16:17535-17557 CTGGATACTGGGGAGGAGCCGGG - Intronic
1132517493 16:372598-372620 CTCCATGTGGGTAAGGAGCCGGG - Exonic
1133825456 16:9274388-9274410 ATGCATCATGGGAAGGAGCAGGG - Intergenic
1134047645 16:11112869-11112891 CTCCATTCTGGGGAGGAACCAGG - Intronic
1134288369 16:12882241-12882263 CTCCATTTTGGGATGGGGTCTGG - Intergenic
1137517356 16:49158381-49158403 GTGCATTTTGGAATGAAGCCTGG - Intergenic
1140482974 16:75272474-75272496 CTGCAGTTTGGCAAGAACCCAGG + Intergenic
1140749595 16:78011101-78011123 CTTCCTCTTGGGAAGGAGACAGG + Intergenic
1140958635 16:79891432-79891454 GTGCATTTGGGGAAGGAGCTGGG - Intergenic
1141035750 16:80623941-80623963 GTGGATTTTAGGATGGAGCCAGG + Intronic
1141729546 16:85812502-85812524 CTGCATTTCTGGAAGGAGGCGGG - Intergenic
1142260171 16:89039127-89039149 CTCCACCTTGGGAAGGAGGCAGG - Intergenic
1143948513 17:10615147-10615169 CAGCACTTTGGGAAGGTGACGGG + Intergenic
1144390594 17:14790067-14790089 CTGCATTTTAACAAGCAGCCCGG - Intergenic
1145839647 17:27983745-27983767 CTGCATATTGAGAAGGGGGCTGG + Intergenic
1146189971 17:30756475-30756497 CAGCACTTTGGGAAGGAGGCAGG - Intergenic
1146334872 17:31960824-31960846 CAGCACTTTGGGAAGGAGGCAGG - Intronic
1146750542 17:35374211-35374233 CCGCATTTTGGCAAGGGGTCCGG - Intergenic
1147583448 17:41639254-41639276 CTGCAGGGTGGGAAGGAGCCTGG - Intergenic
1148888900 17:50793631-50793653 CTGCATCTGGGGAAGGCCCCAGG + Intergenic
1150746770 17:67823137-67823159 CAGCACTTTGGGAGGGAGGCGGG + Intergenic
1151612222 17:75183432-75183454 CTGCATTTTAGGCAAGAGTCCGG - Intergenic
1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG + Intergenic
1152557931 17:81063866-81063888 CTGCTCTCTGGGAATGAGCCAGG + Intronic
1152647060 17:81474170-81474192 CTGCAGTTGGGCAAGGAGACGGG + Intergenic
1152680676 17:81666397-81666419 CCGCATGTGGGGACGGAGCCGGG - Exonic
1152691728 17:81721103-81721125 AGGCCTTTTGGGGAGGAGCCAGG + Intergenic
1153027966 18:688399-688421 CTGCCTTTAGAGAAAGAGCCTGG + Intronic
1153073299 18:1131773-1131795 CTGCATTTTGGGTAGGACCCAGG - Intergenic
1158231358 18:55259238-55259260 CTGCTCTTTGGTAAGGAGACAGG - Intronic
1158390795 18:57043410-57043432 CTGCATTTTGGCAAGCTTCCTGG + Intergenic
1159084001 18:63766854-63766876 CTGCATTTTGGTAAAAAGCAAGG + Intronic
1163695768 19:18762567-18762589 CTGCACTCTGGAAAGCAGCCAGG - Intronic
1164076795 19:21826589-21826611 CAGCACTTTGGGAAGGAGGCAGG + Intronic
1164545157 19:29154538-29154560 CTGCATTTTAGGAAGATCCCTGG + Intergenic
1167289197 19:48615175-48615197 CTGGCTGTTGGGAAGGAGGCAGG + Intergenic
925296396 2:2780241-2780263 GTGAATTTTGGGAAGGTGCAGGG - Intergenic
925659518 2:6187462-6187484 CTGCAGTGTGGGGAGCAGCCTGG - Intergenic
925805303 2:7642387-7642409 ATGTATTGTGGGAAGGACCCAGG - Intergenic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
926571847 2:14537564-14537586 ATGCATTTTGGAAAGGAATCTGG - Intergenic
927654140 2:24931066-24931088 CTGCCTTTTCAGCAGGAGCCCGG + Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927884501 2:26710215-26710237 CTGCTCTTTGGGAAAGAGCTTGG + Intronic
928212609 2:29334712-29334734 CTCCATTCGGGGAAGGAGACTGG - Intronic
928777265 2:34780727-34780749 ATGTGTTTTGGGAAGGACCCAGG - Intergenic
929107548 2:38379060-38379082 CTGCACTTTGGTAAGGATTCAGG - Intergenic
929634662 2:43505799-43505821 TTGCATTTTGGGATTGATCCAGG - Intronic
930534299 2:52628437-52628459 CTGCTTTTTGGGAATCATCCTGG + Intergenic
931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG + Intronic
934651031 2:96091523-96091545 CTGCATTCTGGGGCGGAGCTGGG - Intergenic
935081988 2:99807332-99807354 CTGGAGTTTGGAAAGGATCCTGG + Intronic
936253871 2:110892219-110892241 CTGACCTTTGGGATGGAGCCAGG + Intronic
936568082 2:113595562-113595584 CTGGATGCTGGGGAGGAGCCGGG + Intergenic
937096153 2:119236515-119236537 CTGCATTGTGGGGAGTGGCCTGG + Intronic
944859764 2:203804205-203804227 CTGCATTCTGAGCAGGAGCCAGG + Intergenic
946192849 2:218016513-218016535 CTGCAGTGTGAGAAGGAGTCTGG + Intergenic
946411151 2:219515753-219515775 CTCCATCTAGGGAAGGACCCCGG + Intronic
946894632 2:224310731-224310753 GTGCATTTGGGGAAGGAGAAAGG - Intergenic
1171030798 20:21674719-21674741 CGACATCTTGGGAAGGAGGCAGG + Intergenic
1171482506 20:25464702-25464724 CTTCATTTTGTCAACGAGCCTGG + Intronic
1172504806 20:35453976-35453998 CTGCATTTTAGAAAGTACCCAGG - Intronic
1172611050 20:36252862-36252884 CTGAATTCTGGGGAGGGGCCTGG - Intronic
1173042061 20:39473745-39473767 CTGCTCATTTGGAAGGAGCCGGG - Intergenic
1173596578 20:44262436-44262458 CTGCAATTTGGGAAGAATGCAGG + Intronic
1175308171 20:57992289-57992311 CTGCATTTTGAGAAGATGCTTGG + Intergenic
1175490784 20:59379995-59380017 CTGCATTGTGGGGAGAACCCAGG + Intergenic
1176248633 20:64109540-64109562 ATGCATTTTGGGAGGGGCCCAGG + Intergenic
1178122496 21:29483219-29483241 CTGCTTTTCAGGCAGGAGCCTGG + Intronic
1179662584 21:42886627-42886649 CAGCCTTTTGGGGAGGAGCGGGG + Intronic
1180242060 21:46515782-46515804 CAGCACTTTGGGAGGGAGGCCGG - Intronic
1181910444 22:26234217-26234239 CTGCATCTTGGGAAGTTCCCAGG + Intronic
1182212188 22:28685898-28685920 CAGCATTTTGGGAGGGAGGCGGG + Intergenic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182823156 22:33236728-33236750 ATGCTTTGTGGGAAGGAGCATGG - Intronic
1183056980 22:35313015-35313037 CAGCCTTCTGGGAAGCAGCCTGG - Intronic
1183771998 22:39934663-39934685 CTTCATGTTGGGAAGCACCCGGG + Intronic
1185039251 22:48496035-48496057 CTGCATTTAGGGAGTAAGCCGGG - Intronic
1185185038 22:49393895-49393917 CTGTAGTTAGTGAAGGAGCCAGG + Intergenic
951403884 3:22270003-22270025 CTGCAATTTGGCAAGGTGCCTGG - Intronic
951985575 3:28616519-28616541 TAGCATTTTGGGAAGAAGACAGG + Intergenic
952193440 3:31047465-31047487 CTGCACACTGGGATGGAGCCTGG + Intergenic
952790852 3:37199602-37199624 CTGCAGTTTGGGAAAGAGCCTGG - Intergenic
953262509 3:41353419-41353441 CAGCATTTTGGGAAGGGGAGAGG + Intronic
953637374 3:44674519-44674541 ATGCATTCTGGGAAAGAGCCAGG - Intergenic
953649423 3:44787260-44787282 CTTAATTTTGGGGAAGAGCCAGG - Intronic
954202128 3:49029666-49029688 CTTTATTTTGGGGAGGAGCCCGG - Intergenic
955444128 3:58990938-58990960 TTGCATTCTGGTATGGAGCCAGG - Intronic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
958882331 3:99686954-99686976 CAGCACTTTGGGAGGGAGGCAGG - Intronic
960350924 3:116591753-116591775 CTGCATTTTGGGGAGATGGCTGG - Intronic
962151046 3:132893670-132893692 CTGCATCTTGGGATGGACCATGG - Intergenic
962268543 3:133961047-133961069 GTGCATGATGGGAAGGGGCCTGG + Intronic
964199925 3:154107812-154107834 CTGCATTTTATAAAGCAGCCAGG - Intergenic
966838839 3:184071449-184071471 ATGCATTGTGGGAGGGACCCAGG - Intergenic
966998749 3:185311438-185311460 ATGCATTGTGGGAGGGACCCAGG - Intronic
968651247 4:1761119-1761141 CTGCATGGTGGGAGGGGGCCCGG - Intergenic
968917120 4:3501395-3501417 CTGCACCTGGGGACGGAGCCTGG + Intronic
968982957 4:3860615-3860637 CAGCATTGCAGGAAGGAGCCTGG - Intergenic
969535447 4:7753946-7753968 ATGCATTGTGGGAGGGACCCAGG + Intergenic
971286258 4:25292797-25292819 CAGCACTTTGGGAGGGAGGCGGG + Intergenic
973958375 4:56086194-56086216 CTGAATCTTGGGAGGGAGCCAGG + Intergenic
974102001 4:57427440-57427462 CTTCATGTAAGGAAGGAGCCAGG - Intergenic
974297384 4:60019226-60019248 TTGCATTTTGAGAAGGAGAAAGG - Intergenic
976725344 4:88210808-88210830 CAGCATTTTGGGAAGAAGCTAGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
983450015 4:167897240-167897262 CTGTATACTGGGGAGGAGCCTGG - Intergenic
984499609 4:180542665-180542687 GTTTATTTTGGCAAGGAGCCTGG - Intergenic
985034037 4:185820535-185820557 CTGCAGTTGGGGAAGGAGTAGGG + Intronic
985546648 5:513315-513337 ATGCTTTTTGGGAAGGAGAAAGG + Intronic
985661424 5:1158968-1158990 CTGCCTTTGGGGCAGGAGTCCGG - Intergenic
986139618 5:5017574-5017596 CTGCATCGTGGGAAGGAGGGTGG + Intergenic
986379576 5:7170540-7170562 CTACATATTGGGGTGGAGCCAGG + Intergenic
988669205 5:33362796-33362818 CTGCAGTCTGAGAAGGAGGCAGG + Intergenic
989753338 5:44922103-44922125 CTACATTTTAGCAAGGAGACTGG + Intergenic
990855871 5:60265757-60265779 CAGCATTTTTTGAAGGAGCAAGG - Intronic
991603754 5:68379715-68379737 CTGCTTTTTGGGCAGCAGTCTGG - Intergenic
992401085 5:76412135-76412157 CTGCAATTTGGGAATGACCTGGG - Intronic
995443457 5:112217369-112217391 CTGCCTTTTGGGGATGAGCCAGG - Intronic
995619784 5:114011849-114011871 CTGCCTTTAAGGAAGGAACCCGG - Intergenic
995748675 5:115430828-115430850 CTGGAGTTTGGGAAGGAGCTGGG - Intergenic
997346436 5:133195823-133195845 CTTCATTTAGGAAAGCAGCCAGG - Intergenic
999267211 5:150274653-150274675 CTGCATTTTAACAAGGTGCCTGG - Intronic
999624063 5:153501691-153501713 CTCCAGTTTGGGATGGAGTCTGG + Intronic
1000827369 5:166061917-166061939 CTGTATTTTTGGTAGTAGCCAGG - Intergenic
1001125918 5:169019104-169019126 CTGCATCCTGGGAAGGAGAAAGG + Intronic
1001133238 5:169081266-169081288 CAGCAGGGTGGGAAGGAGCCTGG + Intronic
1001396514 5:171422248-171422270 CAGCATCTTGGGAAAGAGCTGGG + Intronic
1001455647 5:171857991-171858013 CTGCATTTAGGAAAGGGGCACGG - Intergenic
1002449476 5:179310686-179310708 CTGCATTTTGGCAAGTTCCCAGG + Intronic
1007319774 6:41019170-41019192 CTGCCTTTTGGGAAGGTAACAGG + Intergenic
1007345219 6:41223913-41223935 CTGCAGTTTGGGAAGCCTCCAGG + Intergenic
1007590641 6:43018730-43018752 CTGCATTTAGGGCAGGAACAAGG + Intronic
1007966919 6:46011878-46011900 CTGCAAGTGAGGAAGGAGCCAGG + Intronic
1009882524 6:69586218-69586240 CTGCAATTAGGGAAGGAAACTGG - Intergenic
1009897811 6:69774920-69774942 CTGTATTTTGGGCAGGAGTGCGG - Intronic
1010261715 6:73824532-73824554 CTGCAGTTTGGGAAAGAAGCTGG + Exonic
1010926879 6:81754079-81754101 CTCCATTTTGGGACGCAGCTCGG - Intergenic
1013295565 6:108755587-108755609 CTGCTTCTAGGGAGGGAGCCTGG - Intergenic
1014441531 6:121479431-121479453 ATTTATTTTGGGAAGGAGTCTGG + Intergenic
1014709851 6:124794124-124794146 ATGCTTTTTGGGGATGAGCCAGG + Intronic
1016297326 6:142587243-142587265 ATGTGTTTTGGGAAGGAACCAGG + Intergenic
1016884098 6:148942229-148942251 CTGCATGTTGGGAAGAAACAAGG + Intronic
1018655932 6:166035785-166035807 CTGCATTGTGGGCAGGGTCCTGG + Intergenic
1019260744 7:80587-80609 GTGCAGTTTGGGGAGCAGCCAGG - Intergenic
1019495558 7:1338416-1338438 CTGTATTTTGGGATGTAGTCAGG + Intergenic
1019637911 7:2086231-2086253 ATGCATTTTGGGGAGGAGGACGG - Intronic
1023891634 7:44396565-44396587 CTGGAGTTTGGGAAGGAGAAAGG - Intronic
1024240014 7:47427560-47427582 CTGCACTCTGGGAAGGGTCCGGG + Intronic
1028011852 7:85655495-85655517 CTGCATTTTGTCATGGAGCTCGG - Intergenic
1029130035 7:98322806-98322828 CTGCATTTTGGAAAGATCCCTGG - Intronic
1029195726 7:98804022-98804044 CTGGAGTTGGGGAAGGAGCGAGG + Intergenic
1030336020 7:108327145-108327167 CAGCATTTTGGAAAGGATACTGG + Intronic
1031580510 7:123468558-123468580 CTGAATTTAGGCAAGGGGCCAGG - Intronic
1032298368 7:130663657-130663679 CTGCATTTTGGCAAGATCCCAGG - Intronic
1032971084 7:137164496-137164518 CGGCATTTTGGCAAGGCACCGGG + Intergenic
1032985788 7:137335686-137335708 CTGAATTTTGGCAAAGACCCTGG + Intronic
1034273225 7:149813235-149813257 GGGCAGTTTGGGAAGGAGCTGGG - Intergenic
1034883230 7:154778370-154778392 GTGCATATTGGGGAGAAGCCTGG - Intronic
1035219158 7:157395209-157395231 CAGCATTTTGGGAGGGGGCTGGG + Intronic
1035332345 7:158104627-158104649 ATGGATTTTGGGATGGAGCTGGG - Intronic
1036579684 8:10062213-10062235 CTGCTGCATGGGAAGGAGCCTGG - Intronic
1037156804 8:15710622-15710644 CTGCATTTTAATAAGTAGCCTGG - Intronic
1037964561 8:23124078-23124100 CAGCATTTTGGGAAGGACCGAGG + Intergenic
1039439101 8:37582263-37582285 CTGCATTTTTGGATGCAGGCAGG - Intergenic
1040915293 8:52562629-52562651 CTGCATTTAGGGAAGTTGCCTGG + Intronic
1041506305 8:58601857-58601879 CTGCAGTTTAGGAAGGAGGAGGG - Intronic
1042178416 8:66060257-66060279 ATGCATCTTAGGAAAGAGCCAGG - Intronic
1044992258 8:97806621-97806643 CTGTATTGTGGGAGGGACCCAGG + Intronic
1047243213 8:123113408-123113430 CTGCTTTTTGGGAAAGAGTGAGG + Intronic
1047526673 8:125639964-125639986 CTCCATTTTGAGTAGGAGCTGGG + Intergenic
1047654900 8:126966500-126966522 CTGCAATCTTGGAAGGAACCTGG + Intergenic
1048226541 8:132592629-132592651 CTGCATTTTTGGAAGGTTGCTGG + Intronic
1048327965 8:133453243-133453265 CTGCATTTTGGGGAGGGGTCGGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048472572 8:134716613-134716635 CAGCATTTTTGGAAGGAACCTGG - Intergenic
1049884448 9:17964-17986 CTGGATACTGGGGAGGAGCCGGG - Intergenic
1051169637 9:14307308-14307330 GCGCAGTTTGGCAAGGAGCCTGG + Exonic
1051722013 9:20047050-20047072 CTAGAGTTTGGGAAGGAGCCGGG + Intergenic
1052295424 9:26892354-26892376 CTGCTTTTTCGGAAGAAGTCGGG - Intronic
1052759008 9:32570368-32570390 ATGCATTTTGGGAAGTGGCGTGG - Intronic
1055380399 9:75700370-75700392 CTGCATTTTAGACAGGAGACAGG + Intergenic
1056274031 9:84975215-84975237 TTGCATTTTGGGAAAGAGGGGGG - Intronic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1056447337 9:86678580-86678602 CTGAAGTATGGGAGGGAGCCAGG + Intergenic
1056763246 9:89429093-89429115 CTGCATTTGGGGAAGGAGCTGGG - Intronic
1057540445 9:95963531-95963553 CTGCATTTTGGAGAGGAGTGTGG - Intronic
1060666299 9:125434074-125434096 CTGCTATTTGGAAAGCAGCCAGG - Intergenic
1187675596 X:21712996-21713018 ATGCATTATGGGAAGAAGGCAGG - Intronic
1187678358 X:21740803-21740825 TTGCATCTTGTAAAGGAGCCAGG + Intronic
1187937748 X:24352497-24352519 CTAGAATTTGGGAAGGTGCCAGG + Intergenic
1188592256 X:31852100-31852122 CTGCATCTTTGGAAGGATCTTGG + Intronic
1189481660 X:41396661-41396683 CTGCCTTTGGGGAGGGACCCAGG - Intergenic
1190566113 X:51732067-51732089 CAGGACTTTGGGGAGGAGCCCGG + Intergenic
1190904706 X:54715515-54715537 CTATATGTTGGGAAGGACCCTGG + Intergenic
1192636481 X:72824383-72824405 CTGCATATTTGGCAGCAGCCTGG + Intronic
1192645233 X:72896431-72896453 CTGCATATTTGGCAGCAGCCTGG - Intronic
1192794494 X:74415270-74415292 ATGGATTGTGAGAAGGAGCCAGG - Intergenic
1197909727 X:131467807-131467829 TTGCATTTTGTCAAGGAGACTGG - Intergenic
1198014750 X:132598519-132598541 CAGCATTTTGGGAAGCTGACAGG + Intergenic
1198160890 X:134007050-134007072 GTGCATTTTGGGATGGAGGGAGG + Intergenic
1199449272 X:147961468-147961490 CTCCATTTTGGAAAGGAAACAGG - Intergenic
1199807835 X:151318428-151318450 CTTCTTTTGGGGAAGGACCCAGG - Intergenic
1200104202 X:153703335-153703357 CTGCTGCTTGGGAAGGAGGCAGG - Intronic
1200360827 X:155604405-155604427 CTGCATTGTGGGCCCGAGCCAGG - Intronic
1200401357 X:156022192-156022214 CTGGATACTGGGGAGGAGCCGGG + Intergenic
1201015733 Y:9599602-9599624 CTGCCTTGTGAGAAGGTGCCTGG + Intergenic
1202061370 Y:20891790-20891812 CAGCAACTTTGGAAGGAGCCTGG - Intergenic