ID: 1091474048

View in Genome Browser
Species Human (GRCh38)
Location 12:753982-754004
Sequence CGCTGCCGCCCCTGGGGAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091474040_1091474048 -7 Left 1091474040 12:753966-753988 CCCAGCAGCCTCCAGCCGCTGCC 0: 1
1: 0
2: 3
3: 50
4: 440
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1091474039_1091474048 1 Left 1091474039 12:753958-753980 CCAGGTAGCCCAGCAGCCTCCAG 0: 1
1: 0
2: 1
3: 44
4: 299
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1091474037_1091474048 8 Left 1091474037 12:753951-753973 CCACTTCCCAGGTAGCCCAGCAG 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1091474041_1091474048 -8 Left 1091474041 12:753967-753989 CCAGCAGCCTCCAGCCGCTGCCG 0: 1
1: 0
2: 3
3: 39
4: 463
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1091474032_1091474048 23 Left 1091474032 12:753936-753958 CCGTGACCGCCACCGCCACTTCC 0: 1
1: 0
2: 6
3: 34
4: 464
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1091474036_1091474048 11 Left 1091474036 12:753948-753970 CCGCCACTTCCCAGGTAGCCCAG 0: 1
1: 0
2: 5
3: 51
4: 495
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1091474038_1091474048 2 Left 1091474038 12:753957-753979 CCCAGGTAGCCCAGCAGCCTCCA 0: 1
1: 0
2: 3
3: 39
4: 366
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1091474034_1091474048 17 Left 1091474034 12:753942-753964 CCGCCACCGCCACTTCCCAGGTA 0: 1
1: 0
2: 2
3: 181
4: 2675
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1091474035_1091474048 14 Left 1091474035 12:753945-753967 CCACCGCCACTTCCCAGGTAGCC 0: 1
1: 1
2: 1
3: 44
4: 502
Right 1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091474048 Original CRISPR CGCTGCCGCCCCTGGGGAAC AGG Exonic
900094796 1:936011-936033 CCATGCAGCCCCTGGGGGACAGG - Intronic
900181577 1:1313373-1313395 GGCTGCTGCTGCTGGGGAACGGG - Intronic
901109572 1:6784748-6784770 CGCTGCCGGCCGTGGGGGAGGGG - Intergenic
901110001 1:6786040-6786062 CGCTGCCGCCCGACGGGGACCGG - Intronic
901150728 1:7099459-7099481 AGCAGCCGCCCCTGGGAAACAGG - Intronic
902653874 1:17854208-17854230 GGCTGCTGCCCCTCGGGAATGGG - Intergenic
902842559 1:19084473-19084495 AGATGCCGCCCCTGGGACACAGG + Intronic
904428381 1:30446319-30446341 CCCCGAAGCCCCTGGGGAACAGG - Intergenic
904583918 1:31568542-31568564 CTCTGCTGCCCTAGGGGAACTGG + Intergenic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
917517752 1:175722116-175722138 AGCTGCCGCCCAAGGGGACCAGG - Intronic
1063663933 10:8050894-8050916 CGCTGCCCGACCTGGGTAACAGG - Intergenic
1064381123 10:14842665-14842687 CTCTGACGCCCCAGGGGAAGAGG + Intronic
1064791448 10:18960990-18961012 CTCTGCCACCTCTGGGGACCCGG + Intergenic
1066059207 10:31707354-31707376 GGCTGCCCCTCCCGGGGAACAGG + Intergenic
1068549067 10:58385662-58385684 CCCTGCTGCCCCTAGGGCACAGG - Intronic
1070490462 10:76971053-76971075 CGCTGATGCCCCTGGGTGACAGG - Intronic
1071527589 10:86367058-86367080 TTCTCCCGCCCCTGGCGAACCGG - Intergenic
1072189464 10:93068325-93068347 CGCTCCAGCCCTTGGGGATCTGG - Exonic
1072791441 10:98321069-98321091 CACTGGGGCCCCTGGGGATCTGG + Intergenic
1073540097 10:104311008-104311030 TGCTGCCTCTCCTAGGGAACAGG + Exonic
1074866061 10:117545031-117545053 CGCTGCTGCCTCTCGCGAACTGG - Intronic
1075576868 10:123584156-123584178 CGGAGCCACCCCTGGAGAACGGG - Intergenic
1075768993 10:124917369-124917391 CGCGGTCGCCCCTGGGGCGCCGG - Intergenic
1076603610 10:131675276-131675298 GGCTGCTGCCCTTGGGGACCTGG - Intergenic
1076824303 10:132959522-132959544 CGCGGCCGCTCCTGGAGCACCGG + Intergenic
1077072459 11:682077-682099 CGAGGCCGCCCCAGGAGAACAGG - Intronic
1077079866 11:720479-720501 CTCTGGCGCCGCTGGGGAATGGG - Intronic
1077289514 11:1782418-1782440 GGCTGGCACCCCTGGGGCACTGG - Intergenic
1080715274 11:34794131-34794153 CACTGCCTCCACTGGGAAACTGG - Intergenic
1081669986 11:44937411-44937433 AGCTGCCATCCCTGGGGATCTGG - Intronic
1081938119 11:46918547-46918569 CGCTGCCCCGCCAGGGGACCGGG + Exonic
1081957697 11:47107861-47107883 CGCTGCTGCCCCAAGGGAACTGG - Intronic
1082013154 11:47464539-47464561 CGCTGCTGCCTGTGGGGGACGGG - Intergenic
1083272722 11:61580411-61580433 CGCTGGCACCCCCGGGGCACCGG + Intronic
1083419004 11:62543080-62543102 CGCTCCAGCCCCCGGGGGACCGG + Intronic
1084044077 11:66559192-66559214 CCCTGCCGCCACTGGGTGACCGG + Intronic
1084220357 11:67674160-67674182 CCCTGGGGCTCCTGGGGAACAGG + Intronic
1084423446 11:69071840-69071862 CCTTCCCTCCCCTGGGGAACAGG - Intronic
1085776087 11:79368056-79368078 CGCTGCGGCCCTTGGGGATTCGG + Intronic
1090412434 11:126518584-126518606 GGCAGCCCCCCTTGGGGAACTGG + Intronic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1092330358 12:7581394-7581416 AGCTTCTGCCCCTGTGGAACTGG - Intergenic
1094219450 12:27975985-27976007 CGTTGCGGCCCCTGGGGTAGGGG - Intergenic
1096633537 12:52944777-52944799 CTCTCCCACCCCTGGGGAAGAGG + Intronic
1101249444 12:102917415-102917437 CGCTGCCCGCCCTGGGTAAAGGG + Exonic
1102299466 12:111760468-111760490 TTCTGCCTCCCCTGGGGATCAGG - Intronic
1102915402 12:116748672-116748694 GGCTGGCCCCTCTGGGGAACTGG + Intronic
1105454225 13:20525713-20525735 CGCTGCTGCCCCTGGAGCCCGGG - Intronic
1111976124 13:94968403-94968425 TGCTGCCGTCCCCGGGGAAAGGG + Intergenic
1121244011 14:92449788-92449810 GGCTGCTGCCCCAGGGGAAGGGG - Intronic
1121367999 14:93332561-93332583 CGCCGCCGTCCCTGGGGCAGGGG - Intronic
1121729090 14:96173903-96173925 CGCTGCAGGCCCAGGGGAGCTGG + Intergenic
1123113481 14:105883532-105883554 GCCTGCTGCCCCTGGGGACCTGG + Intergenic
1123480685 15:20628737-20628759 CGCCGCCGCCCGAGGAGAACGGG - Intergenic
1123637324 15:22371630-22371652 CGCCGCCGCCCGAGGAGAACGGG + Intergenic
1123716897 15:23040115-23040137 CCAAGCCGCCCCTGAGGAACAGG - Intergenic
1124442369 15:29696510-29696532 TGCTGCTGCCCCTGGGGGACAGG - Intergenic
1125381703 15:39092908-39092930 TGCTGCCTACCCTGGGGAGCAGG + Intergenic
1128482862 15:68054683-68054705 CCCTGCCCCCCATGGGGAGCTGG + Intronic
1131171929 15:90184965-90184987 CGGCGCAGCCCCTGGGGACCCGG - Intronic
1131441287 15:92461495-92461517 CACTGCAGCCCCTGGCGCACAGG + Intronic
1132554502 16:566603-566625 CGCTGTCACCCGTGGGGAGCAGG + Intergenic
1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG + Intronic
1133319662 16:4905078-4905100 CACTGCCTCCCCTGCGGGACTGG - Intronic
1138249052 16:55488544-55488566 CGTTGCCGCCCATGGTGAACAGG - Exonic
1139546705 16:67653113-67653135 CCCTGCCGCCCCTGGGCCCCCGG + Exonic
1139795921 16:69482749-69482771 CACTGCCTTCCCTGGGGACCTGG + Intergenic
1141380090 16:83568582-83568604 CCCTGCCCCCACTCGGGAACTGG - Intronic
1141491347 16:84376021-84376043 CACCGCCACCCCTGGGGATCTGG - Intronic
1142211198 16:88809429-88809451 GGCTCCCTGCCCTGGGGAACAGG + Exonic
1142795514 17:2303891-2303913 CGGTCCCGCCCCTCTGGAACCGG - Exonic
1144952889 17:19003682-19003704 CGCTGCCCTCCCTGGAGTACTGG - Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1147038968 17:37702460-37702482 CGCTGAGCCCCCTGGGGAACTGG - Intronic
1147971294 17:44220067-44220089 TGCTGCCGCCGCCGGGGAAGGGG + Intronic
1147976920 17:44253176-44253198 GGCTGCAGCCCCTGGGGTGCTGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148768017 17:50050685-50050707 CACTCCTGCCCCTGAGGAACCGG + Intergenic
1148787200 17:50151115-50151137 CGCAGCCGCCGCTGGGGGACTGG + Intergenic
1148851935 17:50559804-50559826 CGCAGCCCCTCCTGGGGATCCGG + Intergenic
1149423174 17:56530405-56530427 GGCTGCCGTATCTGGGGAACTGG - Intergenic
1149599714 17:57885534-57885556 CGCTGCTGCTCCGGCGGAACAGG + Exonic
1151750394 17:76033953-76033975 CGCAGCCGCCCCTGTTGTACAGG + Intergenic
1151983767 17:77529069-77529091 CGCTGCAGTCCCTGGGAAATGGG + Intergenic
1152146627 17:78572469-78572491 CTCTGCAGCCCCTGGGGCTCTGG - Intronic
1160254844 18:77239612-77239634 AGCAGCAGCCCCTGGGGGACGGG - Intergenic
1161059755 19:2209082-2209104 CCCTGCCGCCCCTCGGGGCCCGG + Intronic
1162428552 19:10612620-10612642 CGCTGCAGCCCTTGGGGACTTGG + Intronic
1162479824 19:10921676-10921698 CGGGGCCGCCCATGGTGAACTGG - Exonic
1163687345 19:18719328-18719350 TGCTGCAGGCCCTGGGGACCCGG - Intronic
1163694503 19:18757154-18757176 CGTTTCCGCCCCTGGGGCCCTGG - Intronic
1166792647 19:45406937-45406959 TGAGGTCGCCCCTGGGGAACAGG + Intronic
1167379294 19:49129368-49129390 CGCTCCCGGACCTGGGGATCGGG - Exonic
1167557120 19:50203532-50203554 CGGCCCCGCCCCTGGGGGACGGG - Intronic
1167648516 19:50718221-50718243 CGCTGCCGCGCGTGGGGGAGGGG - Intronic
1168423063 19:56217722-56217744 CGCTGCAGTCCTTGGGGAAGCGG + Intergenic
927210937 2:20638627-20638649 CCCTGCAGCCCCTGGGGATCTGG + Exonic
927937292 2:27083017-27083039 CTCTGGGGCCCCTGGGGAGCAGG + Exonic
928516020 2:32045604-32045626 CGCTTCCGCCCCTGAGTAGCTGG - Intergenic
933719691 2:85390039-85390061 GGCTGGCTCCCCTGGGGAAATGG + Intronic
934768352 2:96893191-96893213 CTCTGCTGCCCCTGGGGACTCGG - Intronic
937472343 2:122185043-122185065 CTCTGCTGCTCCTGGGGAATGGG + Intergenic
937908412 2:127063932-127063954 AGCTGCCGTCCCTGTGGAACAGG - Exonic
938895139 2:135742146-135742168 CGCAGCCGTCCCTGGGGCGCGGG - Intronic
948062055 2:235049274-235049296 CGCTCTCTCCCCAGGGGAACTGG - Intronic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
948427032 2:237894869-237894891 CGTTGCCAGCCCTGGGGAACAGG + Intronic
948484047 2:238268652-238268674 CTCTGTCGACCCTGGGGTACAGG + Intronic
948534601 2:238636548-238636570 GGCTGCCTCCACTGGGGAGCAGG - Intergenic
948798831 2:240420888-240420910 GGCTTCCAGCCCTGGGGAACAGG - Intergenic
1172039086 20:32031266-32031288 CGCTCCCGCCCCTGGAGCCCCGG - Exonic
1172480260 20:35267310-35267332 CTCGGCCGCCCCTCGGGGACCGG + Exonic
1172951185 20:38724342-38724364 CGCTCCCGCCCCTCGGAATCAGG - Intergenic
1174569684 20:51492676-51492698 CGCTCCAGCCCTTGGGGAGCAGG + Intronic
1175717862 20:61267358-61267380 GGATGCAGCCCCTGGGGAATCGG - Intronic
1175822618 20:61918492-61918514 CTCTGCCACCCCTGGGGCAGGGG - Intronic
1176081826 20:63277284-63277306 CGCTGCCGTCCATGGTGCACCGG + Exonic
1177897535 21:26872250-26872272 CTCTGACTCCCCTGGGGAAAGGG + Intergenic
1178431482 21:32522121-32522143 GGCTGCAGCCCCAGGGGGACAGG - Intergenic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1179664835 21:42903983-42904005 CTCTGCCGCCCCAGGAGGACTGG - Exonic
1179923676 21:44521184-44521206 AGCTGCCTCCTCCGGGGAACTGG + Intronic
1180032415 21:45221581-45221603 GGGTGCTGCCCCTGGTGAACAGG - Intronic
1180132573 21:45835876-45835898 CACGGCAGCCCCAGGGGAACAGG + Intronic
1180197855 21:46208201-46208223 GGCGGCCTCCCCTGGGGGACGGG + Intronic
1180745803 22:18088150-18088172 CACAGGCGCCCCTGGGGAAATGG + Exonic
1184391500 22:44205996-44206018 CACTGCAGCCCCAGGGGAAGAGG + Intronic
1184660800 22:45964674-45964696 CTCTGCCACCCCTGGGCAATCGG + Intronic
1185257725 22:49845365-49845387 AGCTGCCAGCCCTGGGGAGCTGG + Intergenic
1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG + Intronic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
951527113 3:23664160-23664182 TGCTGCAGCCTTTGGGGAACAGG + Intergenic
954004295 3:47579129-47579151 CGGTCCCGCCCCAGGTGAACAGG + Exonic
954135299 3:48579587-48579609 CCCTGGAGCCCCTGGGGAAAGGG - Exonic
954660748 3:52225612-52225634 CGCTGCTGCCCCTGTGGGAAGGG - Exonic
961202401 3:125055578-125055600 CGCTCCCGCCTCTGGGGGCCCGG + Exonic
961644656 3:128386425-128386447 GGCTGGGGGCCCTGGGGAACTGG - Intronic
961675220 3:128560864-128560886 CCCTGCTGCCACTGGGGACCAGG - Intergenic
981782528 4:148444353-148444375 CGCTGGCGGCCCTGGGGCAAGGG - Intronic
986559432 5:9046106-9046128 GGCTGCTGCCCATGGGGTACTGG + Intronic
988110036 5:26807886-26807908 CACTGCAGGCACTGGGGAACAGG - Intergenic
992530216 5:77645658-77645680 CGCTGCGCCCCCTGGGGGCCGGG - Intergenic
996039394 5:118793270-118793292 CGCTCCCTCCCCTGGGGATCCGG - Intergenic
997912494 5:137889644-137889666 CACAGCCTCCCCTGGGGAAGCGG + Intronic
998435907 5:142108769-142108791 CGACGCGGCCCCTGGGGAAGAGG - Exonic
998517843 5:142771354-142771376 CGCTGCCTCCCCTTGGGAAAAGG + Intronic
1000039870 5:157477588-157477610 CGCAGGCTCCCCTGGGGAAGGGG + Exonic
1000220462 5:159209312-159209334 CGCCGCCGCCCGAGGAGAACGGG - Intronic
1001561260 5:172670343-172670365 CGCGGCGCCCCCTGGGGACCTGG + Intronic
1002591276 5:180292620-180292642 CGCTGCGGCGCCGGAGGAACGGG + Intergenic
1002887664 6:1311234-1311256 CACAGCCGCCCCAGGGGAAGAGG + Intergenic
1006030151 6:31172017-31172039 AGCTGCCCCCTCTGGGGACCGGG - Intronic
1007927644 6:45663235-45663257 CGCTGGCGGACCTGGGGAAAAGG - Intronic
1018423769 6:163662479-163662501 CACTGCAGCCTCTGGGGACCGGG + Intergenic
1018669994 6:166169402-166169424 GCCTGCCGCCCGTGGGGGACAGG + Intergenic
1019323282 7:425166-425188 AGCGGCCGCCCCTGGGGAGCGGG - Intergenic
1019355685 7:577630-577652 CACTGCCGGCCCTGGGGTTCCGG + Intronic
1019562637 7:1666086-1666108 CGCCGCCGCGCTCGGGGAACCGG + Intergenic
1019587656 7:1813924-1813946 CCCTGCTGCCCCTGGGGCAGAGG + Intergenic
1021027534 7:15687175-15687197 CGCTGCGGCGCCCGGGGCACGGG - Intergenic
1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG + Intronic
1024948478 7:54834581-54834603 CGCTTCCGCCACTGGGACACTGG - Intergenic
1025943548 7:66089824-66089846 CGCTCCTGCTCCTGGGGAACAGG + Intronic
1029842692 7:103383235-103383257 CTCTGCCTCCCCTGTGGCACTGG - Intronic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1035074219 7:156167973-156167995 CGCTCCCGCAGCTGGGCAACTGG + Intergenic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1037803697 8:22048407-22048429 GCCAGCCGCCCCTGGGGCACCGG - Exonic
1038828467 8:31032901-31032923 CGCTGCGGCGCCGGGGGAGCCGG - Exonic
1041719828 8:60965660-60965682 CTCTGCTGCCCCTGGCGAAGGGG + Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1049517024 8:143065312-143065334 CTCTTCCTCCCCTGGGGAACAGG + Intergenic
1049601664 8:143510594-143510616 CGCTGCACACCCTGGGGAACAGG - Intronic
1049766874 8:144358997-144359019 CGCTGCGGCCCCAGGGGAGGAGG - Exonic
1056186810 9:84143270-84143292 TGCTGCAGCCGCTGGGGAATAGG - Intergenic
1057049852 9:91915293-91915315 CTCTGGCACCCCTGGGGAAGAGG + Intronic
1057186284 9:93059063-93059085 CGCTGCGGCCACTCGGGAACGGG - Intronic
1061666419 9:132163009-132163031 CGCTGCCGCCTGTGGCGACCCGG - Intronic
1062084237 9:134640814-134640836 CCCTGCAGCCCTTGGGGAAGGGG + Intergenic
1062696583 9:137878861-137878883 CGCGGCCGCCCCTAGGGATGGGG + Intronic
1187155804 X:16719677-16719699 CGCTGCGGTCTCTGGGGATCGGG + Exonic
1197720309 X:129740510-129740532 CTCAGCCCCCCCTGAGGAACTGG - Intronic