ID: 1091475450

View in Genome Browser
Species Human (GRCh38)
Location 12:767883-767905
Sequence CTGCTACTCCCTTTGAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091475446_1091475450 24 Left 1091475446 12:767836-767858 CCTTCCTAATTGATAGAGACAGA 0: 1
1: 0
2: 0
3: 30
4: 351
Right 1091475450 12:767883-767905 CTGCTACTCCCTTTGAATTCAGG 0: 1
1: 0
2: 1
3: 13
4: 142
1091475447_1091475450 20 Left 1091475447 12:767840-767862 CCTAATTGATAGAGACAGATTTT 0: 1
1: 0
2: 0
3: 39
4: 378
Right 1091475450 12:767883-767905 CTGCTACTCCCTTTGAATTCAGG 0: 1
1: 0
2: 1
3: 13
4: 142
1091475445_1091475450 25 Left 1091475445 12:767835-767857 CCCTTCCTAATTGATAGAGACAG 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1091475450 12:767883-767905 CTGCTACTCCCTTTGAATTCAGG 0: 1
1: 0
2: 1
3: 13
4: 142
1091475444_1091475450 28 Left 1091475444 12:767832-767854 CCTCCCTTCCTAATTGATAGAGA 0: 1
1: 0
2: 0
3: 3
4: 123
Right 1091475450 12:767883-767905 CTGCTACTCCCTTTGAATTCAGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091475450 Original CRISPR CTGCTACTCCCTTTGAATTC AGG Intronic
904576876 1:31510629-31510651 CTGCTACTAGCTTTGAATTTGGG + Intergenic
906670494 1:47650772-47650794 CTGTGAGTCCCTTTGAAGTCTGG - Intergenic
906695343 1:47819649-47819671 CTGATACTCCCTCTGAAGACGGG + Intronic
908811157 1:67983568-67983590 CTGCTACCCCTTTTCAATCCTGG + Intergenic
912005827 1:104899902-104899924 CTATTACTCCATTTCAATTCAGG - Intergenic
919148122 1:193660685-193660707 ATGCTTCTTCCTTTGCATTCAGG + Intergenic
921367954 1:214392544-214392566 CTGCTGTTGCCTTTGACTTCTGG - Intronic
1063786447 10:9390668-9390690 CTCCTACTCCCTTTTGCTTCTGG - Intergenic
1072210052 10:93238292-93238314 CTGCTAATCCTTTTAAATCCTGG - Intergenic
1074935350 10:118173317-118173339 CTGCTAAACCCTTTTAATTTAGG - Intergenic
1076490269 10:130856145-130856167 CTGCATCTCCCTGTGAATGCAGG - Intergenic
1078771575 11:14357531-14357553 CTGCTAAAACCTTTGAATCCAGG - Intronic
1080188283 11:29518433-29518455 ATACTACTCCCTTTGGACTCAGG - Intergenic
1080648084 11:34201744-34201766 CTGTTCCTCCCTTTGAAACCAGG - Intronic
1087861915 11:103168461-103168483 CTGCTTCTCCCTCTGAATGCAGG - Intronic
1088595153 11:111435654-111435676 CTGCCACTCACTGTGGATTCTGG + Intronic
1088766808 11:112990026-112990048 CTGCTACTCCTTTTGCAGTGGGG + Intronic
1090532134 11:127601560-127601582 CTGTGACTCCCTTTAAACTCAGG + Intergenic
1091475450 12:767883-767905 CTGCTACTCCCTTTGAATTCAGG + Intronic
1099734082 12:86544126-86544148 CTTCTCCTCTCTTTGAATCCAGG - Intronic
1100344153 12:93710731-93710753 CTTCCCCTCCCTTTGAATTTGGG - Intronic
1101768952 12:107730617-107730639 CTGCTCCTGCCTTTGGATACAGG - Intergenic
1102203488 12:111074620-111074642 CTGCTGCTTCCTGTGAAGTCAGG - Intronic
1103592002 12:121998518-121998540 TTGCTTCTCCCATTCAATTCTGG + Intronic
1106571323 13:30930548-30930570 CTATTCCTGCCTTTGAATTCTGG - Intergenic
1107424622 13:40280903-40280925 ATGCTGCTGCCTTTGTATTCAGG - Intergenic
1108427277 13:50315748-50315770 ATGATAACCCCTTTGAATTCTGG - Intronic
1108809124 13:54199387-54199409 GTGCTCCTCTCTTTGCATTCCGG + Intergenic
1110783052 13:79489453-79489475 TTTCTTCTCCCTTTGAATTTGGG - Intronic
1113711584 13:112468787-112468809 CTGCTCATCCCTTTGCATTGTGG - Intergenic
1116327487 14:43549200-43549222 TTGCTACTCCCTGTGAATTTTGG - Intergenic
1118629880 14:67693113-67693135 CTGCAACTCCCTGTGTCTTCTGG + Intronic
1120042054 14:79764858-79764880 CTGCTAATTCCTTTCAAGTCTGG + Intronic
1120124689 14:80727372-80727394 CTGTAACTCCCTCTGACTTCTGG - Intronic
1120579299 14:86226524-86226546 CTGATCATCCCCTTGAATTCTGG + Intergenic
1121161578 14:91746627-91746649 CTGCTTCTCTAGTTGAATTCTGG + Intronic
1121209005 14:92192573-92192595 ATTCTCCTCCCTTTGAATTCAGG + Intergenic
1121755906 14:96401769-96401791 CTGCTATTCCCTGAGCATTCTGG + Intronic
1125282043 15:38052546-38052568 CTATTAATCCCTTTAAATTCTGG - Intergenic
1125314456 15:38416389-38416411 ATGCTACTCCATTTCAATTCTGG + Intergenic
1125462821 15:39922075-39922097 CTGTTACTAGTTTTGAATTCGGG - Intergenic
1126921405 15:53529695-53529717 CTGATTCTCCCTTTGGATTGAGG - Intronic
1129430647 15:75499171-75499193 CTGTGTCTCCCTTGGAATTCTGG - Intronic
1130704047 15:86215278-86215300 CTGCTAGTCCCTCTCAATTCAGG + Intronic
1130787505 15:87116229-87116251 CTTCTGCTGCCTTTGAATACTGG + Intergenic
1131853103 15:96563629-96563651 CTGGGACTTCCTTTGTATTCAGG - Intergenic
1133615451 16:7472152-7472174 ATGCTTCTCCCTTTGAACTATGG - Intronic
1138765403 16:59596639-59596661 ATGCTATTCATTTTGAATTCAGG - Intergenic
1139229842 16:65273094-65273116 CTTCTAGTCCCTTTGGATTAAGG + Intergenic
1140395167 16:74620199-74620221 CTGCTAGTTTCTTTGAATCCAGG - Intergenic
1144434843 17:15231214-15231236 GTGCTACCTCCTTTCAATTCTGG - Intronic
1146496626 17:33328401-33328423 ATCCAACTCCCTCTGAATTCTGG - Intronic
1148670877 17:49409158-49409180 CTGCTCCTCCCTTTGAAACCAGG - Exonic
1150320307 17:64208047-64208069 CTACTACTCCCTTTGCATTCAGG + Intronic
1157843564 18:50981612-50981634 TTCCTTCTCCCTTTGAAATCAGG + Intronic
1157884476 18:51353207-51353229 TGGCTTCTCCCTTTGGATTCTGG - Intergenic
1157908686 18:51594787-51594809 CTCTTCCTGCCTTTGAATTCAGG - Intergenic
1158747411 18:60217553-60217575 CTAGTTCTCCCTTTGAATACAGG - Intergenic
1158973892 18:62693012-62693034 CTGCTGCTGGCTTAGAATTCAGG + Intergenic
1159833396 18:73306096-73306118 CTGGTACTAACTTGGAATTCTGG + Intergenic
1166345223 19:42161531-42161553 CTCCTCCTCCTTTTGAACTCTGG - Intronic
1168162755 19:54522835-54522857 CTGCTTTCCCCCTTGAATTCTGG + Intergenic
926572448 2:14544410-14544432 CTGCTTCTCTCTTTCAATTTTGG - Intergenic
930444857 2:51457339-51457361 CTACAAATCCCTTTAAATTCTGG + Intergenic
931879542 2:66554019-66554041 CAGCAACTGCCTTTGAATGCTGG - Intronic
937076498 2:119111225-119111247 CTGCCCCTCCCTTGGGATTCTGG - Intergenic
938597205 2:132800328-132800350 CTGCAAATCCCAATGAATTCTGG + Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
942892899 2:181013806-181013828 TTTCTGCTCCCTTTGAATTTGGG - Intronic
945610643 2:211997233-211997255 CTGATGCTTCCTATGAATTCTGG - Intronic
948014450 2:234676646-234676668 CTGCTCCTCCCTGGGAATGCTGG + Intergenic
1169986614 20:11452148-11452170 CTGCCACTCCCTTTGAAACAGGG + Intergenic
1171498623 20:25575928-25575950 CTCCTTCTCCATTTGAAATCGGG + Intronic
1173761759 20:45567441-45567463 CTGCATGTCACTTTGAATTCTGG - Intronic
1174848751 20:53970309-53970331 CTTCCACTACCTTTGAAGTCAGG + Intronic
1175978379 20:62725059-62725081 CTGCCTCTCCCCTTGAATTGTGG - Intronic
1177398138 21:20563786-20563808 ATTCTACTCCCTTTGAATCTGGG - Intergenic
1179188485 21:39103703-39103725 CTGCTACTGACTTGGATTTCAGG - Intergenic
1179277029 21:39901053-39901075 CTGCAACTCTCTTTAAAGTCTGG + Intronic
1180867780 22:19129283-19129305 CAGCTGCTCCCTGTGAATCCAGG + Intergenic
1182426121 22:30273707-30273729 CTGCTGCTCTCTTTGAGTCCAGG + Intergenic
950463365 3:13138754-13138776 CTTCCACTCCCTTTGCAGTCAGG + Intergenic
952445495 3:33377378-33377400 CTCCAAGTCACTTTGAATTCGGG - Intronic
956024753 3:64971020-64971042 CTCCTTCTCCCTTTGCATGCTGG + Intergenic
956055781 3:65297247-65297269 CTTATACTCTCTTTGAACTCAGG - Intergenic
960053812 3:113262184-113262206 CTGCTCCTCCCTTTGCAGGCAGG - Intronic
961751004 3:129094881-129094903 CTGGGACTCCCTCTGAACTCAGG + Intronic
965728279 3:171743594-171743616 CTCCTGCTCCCTTTGAGGTCCGG + Intronic
967269170 3:187718857-187718879 GAGCTATTCCCTTTGAAATCTGG - Intronic
969887875 4:10232460-10232482 CTGCTAGTCTCTTTGAGTTCTGG + Intergenic
971045321 4:22799418-22799440 CTTCTCCTGCCTTTGCATTCAGG + Intergenic
971408779 4:26347832-26347854 CAGTTACCCCCTTTTAATTCAGG - Intronic
974448060 4:62012986-62013008 CTGCTGCTCCCTTTGATTCTTGG - Intronic
974716121 4:65670281-65670303 CTGCCAGTCTCTTTGAACTCTGG - Exonic
974722657 4:65762204-65762226 CTGCTCCAGGCTTTGAATTCTGG + Intergenic
975133739 4:70853662-70853684 GTGCTATGCCCTGTGAATTCAGG + Intergenic
976644852 4:87376720-87376742 CTGCAACAACCTTTGAAATCTGG - Intronic
977314499 4:95428716-95428738 CTGAAACTCCTTTTTAATTCTGG - Intronic
980994708 4:139769287-139769309 CTTCTACTACCTCTGGATTCGGG - Intronic
982635101 4:157886027-157886049 CTATTACTCACTCTGAATTCTGG - Intergenic
983312805 4:166086718-166086740 ATTCTCCTCCCTTTGAATCCTGG - Intronic
989818734 5:45767628-45767650 CTTTTTCTCCCTTTGAATCCAGG - Intergenic
991328361 5:65463459-65463481 CTGGTACTCCCACTAAATTCAGG - Intronic
993559793 5:89391784-89391806 CTGTTACTACCTTTTTATTCAGG + Intergenic
997361673 5:133299229-133299251 GTGCACCTCCCTTTGAAGTCAGG - Intronic
997574044 5:134959373-134959395 CTGATACTCCGGTTTAATTCAGG - Intronic
997928650 5:138054082-138054104 CAGATTCTTCCTTTGAATTCAGG + Intergenic
998364938 5:141623721-141623743 CTGCTTCTGTCTTAGAATTCAGG - Intronic
998414383 5:141935501-141935523 CTGCTGCTTCCTTTGTTTTCTGG + Intronic
999160227 5:149489391-149489413 GTGCTAGTCCCTGGGAATTCAGG - Intergenic
999807244 5:155093653-155093675 CAGCTACTCCCTTGTTATTCTGG - Intergenic
999854325 5:155577327-155577349 TTCCTACTCCCTTTGAAGTTAGG - Intergenic
1000528541 5:162388938-162388960 CAGCTGCTCCATTTGAATTCTGG + Intergenic
1002796371 6:474241-474263 CTGCTAATCCCTGTAAATGCGGG + Intergenic
1003443558 6:6165003-6165025 CTTCTACTCCATTTGGATTTAGG + Intronic
1004310048 6:14537310-14537332 TTCCTACTCCCTTTGAGATCTGG - Intergenic
1007491909 6:42229628-42229650 CTACTACTCCCTTTCACTTAAGG + Intronic
1008434059 6:51454627-51454649 CTGCTACACCCTTTTTTTTCTGG + Intergenic
1009549366 6:65067516-65067538 CTGATACACCCATTGATTTCTGG - Intronic
1012969596 6:105714407-105714429 CTGATAATCCCCTTTAATTCGGG - Intergenic
1024829063 7:53426604-53426626 CTGCTAGTGCCTCTGAATGCTGG - Intergenic
1029952165 7:104598177-104598199 TTGCTAGTCCCTTTCAATTAAGG - Intronic
1030569987 7:111211423-111211445 CTACTCCTCCCATTGAATTGCGG - Intronic
1030858045 7:114586314-114586336 CTGATACTCCTTTTTATTTCAGG + Intronic
1031257724 7:119477778-119477800 GTGCTACTACATTTGTATTCAGG + Intergenic
1031945406 7:127834462-127834484 CTGCGTCTCCCTTCAAATTCAGG - Intronic
1033771910 7:144561834-144561856 CTGCCACTCTCTGTGATTTCAGG - Intronic
1034252859 7:149706343-149706365 CTTCTCCTCCCTTTGCTTTCAGG + Intergenic
1034428712 7:151028976-151028998 CTTCGACTCACTTTGAATCCTGG - Intronic
1035736716 8:1893220-1893242 ATGATACTTCCTATGAATTCAGG - Intronic
1037026321 8:14042729-14042751 CTGTGACTCCCTATGGATTCAGG - Intergenic
1040838538 8:51758936-51758958 CTGCTACTACCTATGAATCTTGG + Intronic
1043033141 8:75164400-75164422 CTGATACTTCCTATGAATTGAGG + Intergenic
1043147206 8:76673709-76673731 CTCCTACTCCCTTTGGATTGGGG - Intergenic
1043721682 8:83552591-83552613 ATGGTACTCCCATTGAATACTGG - Intergenic
1045854390 8:106747091-106747113 GTGCTTTTCCCTTGGAATTCTGG - Intronic
1046505667 8:115135246-115135268 CTGTTACTCTCTTAGAATTGAGG + Intergenic
1046729878 8:117713424-117713446 CTGAAAGTCCCTTTGAAATCTGG - Intergenic
1048998023 8:139806205-139806227 CTGCTGCTCCCTTTGATTGCAGG - Intronic
1049963794 9:760641-760663 CTGCTATTTCCTTTTTATTCAGG + Intergenic
1050624998 9:7493953-7493975 CTGCTTCTGCCTTTGGATTTGGG + Intergenic
1050698035 9:8301058-8301080 CTGCCACTCGCTTTGTAATCTGG - Intergenic
1052161196 9:25262031-25262053 CTGCTACTTCCTTTGAGTGATGG - Intergenic
1054764503 9:69032268-69032290 ATTCTCCTCCCTTCGAATTCGGG - Intergenic
1055113991 9:72587742-72587764 CACCTACTCCCTCTGAATTCAGG - Intronic
1056884803 9:90431019-90431041 CAACTACTCCCTAAGAATTCTGG - Intergenic
1057036243 9:91813701-91813723 TTGCCACTCCATATGAATTCAGG + Intronic
1058122917 9:101158390-101158412 CAGCTTCTTCATTTGAATTCTGG - Intronic
1060465372 9:123899549-123899571 CTGCTACTCCCTGTCTATTCTGG + Intronic
1203490325 Un_GL000224v1:98549-98571 CTGCTCCTTTCTTTGATTTCTGG - Intergenic
1203502948 Un_KI270741v1:40430-40452 CTGCTCCTTTCTTTGATTTCTGG - Intergenic
1186106229 X:6209680-6209702 CTGATACTCGCTTAGAAGTCTGG + Intronic
1187072963 X:15906853-15906875 TTGCCACTGCCTTTGAAATCAGG - Intergenic
1194544471 X:95215673-95215695 CTGCTTCTCTCTCTGAATTTAGG + Intergenic
1199374881 X:147096555-147096577 AAGTTACTCCATTTGAATTCAGG - Intergenic
1202299712 Y:23399463-23399485 CTTCTCCTCACTTTGAATTTCGG - Intergenic
1202571097 Y:26271135-26271157 CTTCTCCTCACTTTGAATTTCGG + Intergenic