ID: 1091475680

View in Genome Browser
Species Human (GRCh38)
Location 12:769840-769862
Sequence CCACGTGCTCACATGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 1, 1: 1, 2: 22, 3: 121, 4: 707}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091475673_1091475680 23 Left 1091475673 12:769794-769816 CCTAGAAGTCCAGGCAAGACAGA 0: 1
1: 0
2: 5
3: 18
4: 269
Right 1091475680 12:769840-769862 CCACGTGCTCACATGGCAGAGGG 0: 1
1: 1
2: 22
3: 121
4: 707
1091475675_1091475680 14 Left 1091475675 12:769803-769825 CCAGGCAAGACAGAGGCATCTGT 0: 1
1: 0
2: 1
3: 15
4: 255
Right 1091475680 12:769840-769862 CCACGTGCTCACATGGCAGAGGG 0: 1
1: 1
2: 22
3: 121
4: 707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091475680 Original CRISPR CCACGTGCTCACATGGCAGA GGG Intronic
900265978 1:1757441-1757463 CCACGGGCTCACAGGGCCTAGGG + Intronic
900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG + Intronic
900909840 1:5587244-5587266 CCACATCCTCACATGGCAGAAGG - Intergenic
900967273 1:5967396-5967418 CCACGTGCGCACTTCTCAGAAGG + Intronic
901656540 1:10772909-10772931 CCACCTGCTGTCATGGCAGGCGG - Intronic
902154348 1:14472080-14472102 CTGCTTACTCACATGGCAGAAGG + Intergenic
902379559 1:16046270-16046292 TCACGAGCCCACTTGGCAGATGG + Intronic
902545370 1:17186436-17186458 CCCCGTGCTCCCAGGGCAGAGGG + Intergenic
902967172 1:20014050-20014072 CTGTGTCCTCACATGGCAGAAGG + Intergenic
903217761 1:21852604-21852626 CCTCTTGCTGACAGGGCAGAAGG - Intronic
903640271 1:24854784-24854806 CTACGTTATAACATGGCAGAGGG - Intergenic
904299235 1:29543467-29543489 CTGCATCCTCACATGGCAGAAGG - Intergenic
904352854 1:29920271-29920293 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905000453 1:34664045-34664067 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905953364 1:41971900-41971922 CCGTGTCCTCACATGGTAGAAGG - Intronic
905956678 1:42002802-42002824 CCACATGCTCATACAGCAGATGG + Intronic
905969648 1:42131870-42131892 CCACTTGCTCACAAGGCCAAGGG - Intergenic
906745663 1:48220698-48220720 CTGTGTCCTCACATGGCAGAAGG + Intergenic
907252275 1:53147593-53147615 CCACGTGCTCATTTTGCAGTGGG - Intergenic
907390896 1:54157641-54157663 CCATGTCCTCACATGGTGGAAGG + Intronic
908151521 1:61307313-61307335 CCACATCCTCACGTGGCAGAAGG - Intronic
908158930 1:61386947-61386969 CTGTGTCCTCACATGGCAGAAGG + Intronic
908499475 1:64728910-64728932 CTGTGTCCTCACATGGCAGAAGG - Intergenic
908584817 1:65556141-65556163 CCATGTCTTCACATGGCAGAAGG - Intronic
908612728 1:65880597-65880619 CCATGTCCTCATATAGCAGAAGG - Intronic
908714683 1:67056433-67056455 CCATGTCCTCACATGGCAGAAGG + Intergenic
908846111 1:68325947-68325969 GCACGTTCTTACATGGCAGCAGG - Intergenic
908901103 1:68957540-68957562 CTGTGTCCTCACATGGCAGAAGG - Intergenic
909107696 1:71433122-71433144 CCGTATCCTCACATGGCAGAAGG - Intronic
909239122 1:73190527-73190549 CTATGTCCTCACATGGGAGAAGG + Intergenic
909301700 1:74020878-74020900 CTATGTCTTCACATGGCAGAAGG + Intergenic
909875495 1:80797671-80797693 CTATATTCTCACATGGCAGAAGG + Intergenic
909878833 1:80847465-80847487 CTGTGTACTCACATGGCAGAAGG + Intergenic
910100549 1:83570856-83570878 CTATGTCTTCACATGGCAGAAGG + Intergenic
910191082 1:84596513-84596535 CCACATCCTCACATGGCAGAAGG + Intergenic
912367330 1:109145186-109145208 CTGCATCCTCACATGGCAGAAGG - Intronic
912429125 1:109619977-109619999 CCACGTGCTCCCAAGGGAGCGGG - Intronic
912977104 1:114340911-114340933 CTATGTCCTCACATGACAGAAGG + Intergenic
913435247 1:118840957-118840979 CTGCATCCTCACATGGCAGAAGG + Intergenic
914438939 1:147685646-147685668 TCACATTCTCATATGGCAGAAGG - Intergenic
915663125 1:157420128-157420150 CCATGTCCTCATATGGTAGAAGG - Intergenic
915663130 1:157420159-157420181 CCATGTCCTCACATGGTGGAAGG - Intergenic
916142860 1:161714205-161714227 CCACGTCCTCATATGGTGGAAGG - Exonic
916970813 1:170013067-170013089 CCATGTCCTCACATGGCAGAAGG - Intronic
917050622 1:170918243-170918265 CTATGTCCTCACATGGCAGAAGG - Intergenic
917225654 1:172779046-172779068 ACACGTTCTCTAATGGCAGAAGG + Intergenic
917493513 1:175518906-175518928 CCAGGTTCTTGCATGGCAGAGGG - Intronic
917594636 1:176516616-176516638 CTATGTCCTCATATGGCAGAAGG - Intronic
918189759 1:182162855-182162877 CTGCGTGATCCCATGGCAGAAGG - Intergenic
918507935 1:185278314-185278336 CTGTGTTCTCACATGGCAGAAGG - Intronic
918681990 1:187367328-187367350 CTGCATCCTCACATGGCAGAAGG + Intergenic
918740616 1:188126699-188126721 CTTCATCCTCACATGGCAGAAGG + Intergenic
918961136 1:191279682-191279704 CTGTGTTCTCACATGGCAGAAGG + Intergenic
919418171 1:197337183-197337205 CTATGTCCTCACATGGTAGAAGG - Intronic
920396133 1:205647506-205647528 CTGTGTCCTCACATGGCAGAAGG + Intergenic
920411185 1:205762183-205762205 CTGCTTCCTCACATGGCAGAAGG - Intergenic
920989355 1:210921956-210921978 ATACGTGTTCACATGACAGAGGG - Intronic
921364510 1:214360987-214361009 GCACGTCTTCACATGGCAGCAGG - Intronic
923038500 1:230302072-230302094 CCATGTGCTGACATCGCGGATGG - Intergenic
923416860 1:233770867-233770889 CTTCTTCCTCACATGGCAGAAGG - Intergenic
923676854 1:236087869-236087891 CTGTGTCCTCACATGGCAGAAGG + Intergenic
923707810 1:236359408-236359430 CTATGTCCTCACATGGCGGAAGG - Intronic
924494866 1:244577595-244577617 CTGTGTCCTCACATGGCAGAAGG + Intronic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
924811933 1:247410539-247410561 CCATGTCCTCACATGGCCCATGG + Intergenic
1063041132 10:2338374-2338396 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063559131 10:7110215-7110237 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1063728876 10:8672496-8672518 CTATGTTTTCACATGGCAGAAGG + Intergenic
1064144198 10:12814601-12814623 CCATGTCCTCACATGGCAAAAGG + Intronic
1064691245 10:17920570-17920592 TCACGTCCTCACATAGTAGAAGG - Intergenic
1065228826 10:23575562-23575584 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1065460343 10:25956070-25956092 CTGTGTTCTCACATGGCAGAAGG + Intronic
1066020085 10:31289723-31289745 CTGTGTCCTCACATGGCAGATGG - Intergenic
1066474902 10:35737703-35737725 CTATGTCCTCACATGGCAGGAGG + Intergenic
1066479448 10:35781382-35781404 CTATGTGCTCACATGACAGAAGG - Intergenic
1066630024 10:37450138-37450160 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1067394454 10:45901130-45901152 TCTTGTCCTCACATGGCAGAGGG - Intergenic
1067524484 10:47029854-47029876 CCATGTGAGGACATGGCAGAAGG - Intergenic
1067846452 10:49725927-49725949 CTGTGTCCTCACATGGCAGATGG - Intergenic
1067862777 10:49870261-49870283 TCTTGTCCTCACATGGCAGAGGG - Intronic
1068594468 10:58888016-58888038 TCCCTTCCTCACATGGCAGAAGG + Intergenic
1069490466 10:68856477-68856499 CCTCGTGCCCACGTGGGAGACGG - Intronic
1069656366 10:70092163-70092185 CTGTGTCCTCACATGGCAGAAGG - Intronic
1070256320 10:74815735-74815757 CTACGTCCTCACATGGCAGACGG + Intergenic
1070572371 10:77649999-77650021 CCATGGGCTCACCTGGCAGTGGG - Intergenic
1070688867 10:78510120-78510142 CTATGACCTCACATGGCAGAAGG + Intergenic
1070706698 10:78644827-78644849 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1071388307 10:85144035-85144057 CTGCATCCTCACATGGCAGAAGG - Intergenic
1071533516 10:86407993-86408015 CTGCATCCTCACATGGCAGAAGG + Intergenic
1071728565 10:88224262-88224284 CAGAGTTCTCACATGGCAGAAGG + Intergenic
1071846529 10:89526691-89526713 ACACCTGCTCAGATAGCAGAAGG + Intronic
1072100174 10:92221869-92221891 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072313613 10:94180816-94180838 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072422412 10:95300191-95300213 CTATGTCCTTACATGGCAGAAGG + Intergenic
1072494669 10:95945033-95945055 CTGTGTCCTCACATGGCAGATGG - Intergenic
1072601118 10:96930821-96930843 CTGCGCTCTCACATGGCAGAAGG - Intronic
1073529915 10:104221474-104221496 CCATGTCCTCACATGGTAGAAGG - Intronic
1073722458 10:106188576-106188598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1073758438 10:106605817-106605839 CCACTTTTTCACTTGGCAGAAGG - Intronic
1074244987 10:111680717-111680739 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1074836473 10:117300789-117300811 CTATGTCCTCACATGGCAGAAGG - Intronic
1074962790 10:118463283-118463305 CTGCGTGCTCACGTGGTAGAAGG - Intergenic
1075003530 10:118814839-118814861 CTATGTCCTCACATGGCAGAAGG + Intergenic
1075350958 10:121724981-121725003 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075436191 10:122444675-122444697 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075989043 10:126817299-126817321 CCATGTCCTCACATGGTAGAAGG - Intergenic
1076425865 10:130367206-130367228 CCACCTCATCACATGGCAGAGGG - Intergenic
1077260030 11:1612460-1612482 CCAATTGCCCACATGGCACAGGG - Intergenic
1078461297 11:11517050-11517072 CCGTGTCCTCACATGGCTGAAGG - Intronic
1079242527 11:18730584-18730606 TCATGTCCTCACGTGGCAGAAGG - Intronic
1079651387 11:22934324-22934346 TTACATCCTCACATGGCAGAAGG - Intergenic
1079721664 11:23822525-23822547 CTATGTTCTCACATGGCTGAAGG - Intergenic
1080081847 11:28229601-28229623 CTGTGTCCTCACATGGCAGAAGG - Intronic
1080174114 11:29341301-29341323 CTATCAGCTCACATGGCAGAAGG + Intergenic
1080307788 11:30855019-30855041 CCGCATCATCACATGGCAGAAGG - Intronic
1080397284 11:31901942-31901964 CTGAGTCCTCACATGGCAGAAGG + Intronic
1080420936 11:32109922-32109944 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1080695034 11:34596061-34596083 CCGTGACCTCACATGGCAGAAGG - Intergenic
1081783619 11:45731006-45731028 CTATGTCTTCACATGGCAGAAGG + Intergenic
1081797182 11:45828793-45828815 CCATGAGCCCACATAGCAGAGGG - Intergenic
1082687510 11:56259080-56259102 CTGCATCCTCACATGGCAGAAGG + Intergenic
1083140881 11:60720547-60720569 CTATGTCCTCACATGGCAGAGGG + Intergenic
1084010608 11:66346471-66346493 CCAGGTGCTCATAAGGGAGAGGG - Exonic
1084081106 11:66825528-66825550 CTGTGTCCTCACATGGCAGAAGG - Intronic
1084158345 11:67328934-67328956 TTGCGTCCTCACATGGCAGAAGG + Intronic
1084404852 11:68965739-68965761 CTATGTCCTCACATGGCTGAAGG + Intergenic
1085925806 11:81019145-81019167 CCACATCATTACATGGCAGAAGG - Intergenic
1087238201 11:95744696-95744718 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1087603479 11:100345273-100345295 CCGTGTCCTCACTTGGCAGAAGG + Intronic
1087923147 11:103890055-103890077 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1088224647 11:107606326-107606348 CCAGCTCCTCACATGGCAGGTGG + Intronic
1088338555 11:108736710-108736732 CTGCATCCTCACATGGCAGAAGG - Intronic
1089238750 11:117055854-117055876 CTGTGTCCTCACATGGCAGAAGG - Intronic
1089333877 11:117709357-117709379 CTGTGTCCTCACATGGCAGATGG + Intronic
1089393987 11:118122939-118122961 CTATGTCCTCACATGGCAGAAGG - Intergenic
1089420532 11:118330087-118330109 CCATATCCTCACATGGTAGAAGG + Intergenic
1090374472 11:126279280-126279302 CTGCATCCTCACATGGCAGAAGG + Intergenic
1090729325 11:129556022-129556044 TCACATCCTCCCATGGCAGAAGG - Intergenic
1090742843 11:129681878-129681900 CTGCGTCCTCACATGGCAGGTGG - Intergenic
1091475680 12:769840-769862 CCACGTGCTCACATGGCAGAGGG + Intronic
1091553872 12:1557458-1557480 CTGTGTCCTCACATGGCAGAAGG + Intronic
1091764993 12:3113915-3113937 CCACGTGCTCACTGGGCAGTAGG + Intronic
1092395091 12:8118914-8118936 CCATGTCTTCACATGGCAGAAGG - Intergenic
1092747946 12:11691108-11691130 CTGTGTCCTCACATGGCAGAAGG + Intronic
1093021613 12:14209176-14209198 CCACATCCTCACATGGCAGAAGG + Intergenic
1093032749 12:14303689-14303711 CCATGTCATAACATGGCAGATGG + Intergenic
1093158997 12:15722751-15722773 CAGTGTCCTCACATGGCAGAAGG + Intronic
1093269493 12:17041776-17041798 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1093794802 12:23298542-23298564 CTATGTTCTAACATGGCAGAAGG - Intergenic
1095163837 12:38948393-38948415 ATATGTCCTCACATGGCAGATGG + Intergenic
1097373847 12:58817374-58817396 CCATGTGCTCACACGGTAGAAGG - Intergenic
1097842099 12:64331665-64331687 CTGCATGCTCACATGGCAGGAGG - Intronic
1098015802 12:66103423-66103445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098327063 12:69313846-69313868 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1099168188 12:79333275-79333297 CCATGTCCTCACATGTCAGACGG + Intronic
1099232468 12:80043175-80043197 CTATGTCCTCACATGGTAGAAGG + Intergenic
1099339469 12:81410072-81410094 ATGCGTCCTCACATGGCAGAAGG - Intronic
1099507500 12:83497652-83497674 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1099593324 12:84624051-84624073 CCATGTCCTCACATGGCTGAAGG - Intergenic
1100752190 12:97710583-97710605 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1100759040 12:97785941-97785963 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1103222122 12:119254724-119254746 CTGGGTCCTCACATGGCAGAAGG + Intergenic
1103483389 12:121265898-121265920 CCGCATCCTTACATGGCAGAGGG - Intronic
1104092017 12:125525450-125525472 CCATGTCCTCGCATGGCGGAAGG - Intronic
1104522465 12:129488039-129488061 CCATGTCCTCACAAGGCATACGG - Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1104992685 12:132635029-132635051 CCAGGGGCTCAGATGTCAGAGGG - Intronic
1105518424 13:21110899-21110921 CTGCGTCCTCACATGGCAGAAGG - Intergenic
1106272192 13:28165822-28165844 CCACCTGCTCACATGGTGGAAGG + Intronic
1107414041 13:40184621-40184643 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1107447643 13:40482761-40482783 GCACGTCTTCACATGGCAGCAGG + Intergenic
1107876084 13:44791576-44791598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1108451352 13:50568639-50568661 CTCTGTCCTCACATGGCAGAAGG + Intronic
1108745068 13:53385173-53385195 CTGCGTCCTCACATGGCAGATGG + Intergenic
1108932028 13:55837166-55837188 ATACATTCTCACATGGCAGAAGG + Intergenic
1109029764 13:57177620-57177642 CCAGGTGCTTACATGGAAGCAGG + Intergenic
1109330005 13:60917910-60917932 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109330229 13:60919912-60919934 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109413504 13:62005659-62005681 TTATGTTCTCACATGGCAGAAGG - Intergenic
1109605181 13:64685038-64685060 CAACTTGCTCAAAAGGCAGACGG - Intergenic
1109874259 13:68378754-68378776 CTGTGTACTCACATGGCAGAAGG + Intergenic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1110823741 13:79947273-79947295 CCATGTTCTAACATGGTAGAAGG - Intergenic
1111116649 13:83787197-83787219 CCTTCTGCTCACATTGCAGAGGG - Intergenic
1111246168 13:85544546-85544568 CCAGGTCCTCACACAGCAGAAGG - Intergenic
1111258716 13:85706787-85706809 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1111641485 13:90976286-90976308 CTATGTTCTCACATGGCAGAAGG - Intergenic
1112250503 13:97774733-97774755 CGAGGTGCTCAGATTGCAGACGG + Intergenic
1112732539 13:102381443-102381465 CTGCATCCTCACATGGCAGAAGG - Intronic
1112884031 13:104147007-104147029 CTGTGTGCTCACATGGTAGAAGG + Intergenic
1113074167 13:106451726-106451748 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1113525916 13:110976318-110976340 CTACATCCTAACATGGCAGAAGG - Intergenic
1113838471 13:113345417-113345439 CCACGTGCACACCTGCCAAAGGG + Intronic
1114084303 14:19228205-19228227 CCATGTCCTCACATGACAGAAGG - Intergenic
1114903860 14:27100488-27100510 CCAGGTACTCTCATGGAAGAAGG + Intergenic
1115022218 14:28696120-28696142 CCAAATGATCACATGGGAGAAGG - Intergenic
1115373875 14:32651614-32651636 CTGTGTCCTCACATGGCAGAAGG + Intronic
1115986130 14:39104912-39104934 CTTTGTTCTCACATGGCAGAAGG + Intronic
1116672265 14:47858504-47858526 GCATGTTCTCACATGGCAGAAGG - Intergenic
1116699084 14:48215455-48215477 CTGCATCCTCACATGGCAGAAGG - Intergenic
1116814306 14:49569436-49569458 CCATGTCATCCCATGGCAGAAGG + Intergenic
1117732081 14:58733222-58733244 CCATATCCTCACATGGCAGAAGG + Intergenic
1117733080 14:58743481-58743503 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1118050888 14:62026422-62026444 CTGCATCCTCACATGGCAGAAGG + Intronic
1118437854 14:65787765-65787787 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1119609133 14:76047002-76047024 CTATGGACTCACATGGCAGAAGG + Intronic
1119894714 14:78210259-78210281 ATGTGTGCTCACATGGCAGAAGG + Intergenic
1120015657 14:79470430-79470452 CCATGTTTTCACATGGCAGAAGG + Intronic
1120395591 14:83963273-83963295 CAATGTCCTCACATGGTAGAAGG + Intergenic
1120413156 14:84184060-84184082 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120566719 14:86068755-86068777 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120640100 14:87000226-87000248 GCATGTTCTCACATGACAGAAGG + Intergenic
1121728743 14:96171867-96171889 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1121835049 14:97084853-97084875 CCGTGTCCTCACATGGTAGATGG + Intergenic
1121873391 14:97429815-97429837 CTATGTCCTCAGATGGCAGAAGG + Intergenic
1121968054 14:98328846-98328868 CCATGTCCTCACATGGTAGAAGG + Intergenic
1122174643 14:99908050-99908072 CCACGTGCTCGCACGGCACGTGG + Intronic
1122304697 14:100755511-100755533 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1122671528 14:103376389-103376411 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1122776855 14:104120954-104120976 CCATGTCCTCACACGACAGAAGG + Intergenic
1202895917 14_GL000194v1_random:10067-10089 CCATGTCCTCACATGACAGAAGG - Intergenic
1124124657 15:26928621-26928643 CATTGTCCTCACATGGCAGAAGG - Intronic
1124684817 15:31773430-31773452 CCCCATCCTCACATGGTAGAAGG + Intronic
1124839541 15:33229014-33229036 CTTTGTACTCACATGGCAGAAGG + Intergenic
1125365134 15:38905431-38905453 CTATGTCCTCACATGGCAGAAGG + Intergenic
1125441802 15:39711276-39711298 CTACGTCCTCACATGGTAAAAGG + Intronic
1126565300 15:50090509-50090531 CTGTGTCCTCACATGGCAGAAGG - Intronic
1127303928 15:57683749-57683771 CTATGTCCTCACATAGCAGAAGG + Intronic
1127331619 15:57945352-57945374 CCACATCATCTCATGGCAGAAGG - Intergenic
1127492082 15:59474400-59474422 CTGCATGCTTACATGGCAGAAGG + Intronic
1128591786 15:68904486-68904508 CTATGTCCTCACATGGCAGAAGG + Intronic
1129514355 15:76148048-76148070 CCACCTGCTCACAAGGCGCAGGG + Intronic
1129592235 15:76927038-76927060 CTATGTCCTCACGTGGCAGAAGG - Intergenic
1129630013 15:77248566-77248588 CTGTGTCCTCACATGGCAGAAGG - Intronic
1129791553 15:78343949-78343971 CCCCACGCTCACATGGCAGAAGG + Intronic
1130043592 15:80426900-80426922 CTATGTCCTCACGTGGCAGAGGG + Intronic
1130405984 15:83602453-83602475 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130429607 15:83833349-83833371 CTGTGTCCTCACATGGCAGAAGG + Intronic
1131132200 15:89907517-89907539 CTGAGTCCTCACATGGCAGAAGG - Intronic
1131481774 15:92788483-92788505 GCACGTCTTCACATGGCAGTAGG - Intronic
1131507661 15:93031436-93031458 CCAGGTGCTCAGCGGGCAGATGG - Intergenic
1131560745 15:93437250-93437272 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1131975289 15:97939759-97939781 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1133487472 16:6234032-6234054 CCGTGTCCTCACATGGCAGATGG + Intronic
1134285674 16:12860162-12860184 CTGGATGCTCACATGGCAGAAGG - Intergenic
1134824382 16:17272760-17272782 CCGCGTGCAGACATGCCAGAGGG - Intronic
1135279682 16:21143376-21143398 CTGCATGCTCACATGGGAGAAGG - Intronic
1135568725 16:23531783-23531805 CCAGGTGCACACCTGGCTGATGG + Intronic
1136019665 16:27431992-27432014 CTGCATCCTCACATGGCAGAAGG + Intronic
1137309376 16:47239046-47239068 CCACGTCCTCACATGGCAGAAGG - Intronic
1137384231 16:48026794-48026816 CTATGTCCTTACATGGCAGAAGG + Intergenic
1137388731 16:48063923-48063945 GCACGTCTTCACATGGCAGCAGG - Intergenic
1137681447 16:50349469-50349491 GCACGTCTTCACATGGCAGCAGG - Intronic
1139011111 16:62635532-62635554 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139022812 16:62772857-62772879 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1140706875 16:77638972-77638994 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1140777650 16:78264756-78264778 CTGTGTCCTCACATGGCAGAAGG - Intronic
1141717481 16:85735146-85735168 CCACCAGCTCTCATGGCAGAGGG - Intronic
1141757722 16:86003465-86003487 CTTTGTCCTCACATGGCAGAAGG - Intergenic
1142160819 16:88556495-88556517 GCACGTCCTCACATGGCGGCAGG - Intergenic
1142285475 16:89169876-89169898 CCACATGCTCCCAGGGCAGCAGG - Intergenic
1144141649 17:12355304-12355326 TCACGTCTTCACATGGCAGCAGG + Intergenic
1144243997 17:13345305-13345327 CTAGATGCTCACATGGGAGAAGG + Intergenic
1144457014 17:15427009-15427031 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1144720761 17:17468350-17468372 CTCTGTTCTCACATGGCAGAAGG + Intergenic
1144951767 17:18998220-18998242 CCAGCTGCTCTCAAGGCAGAGGG + Intronic
1145322526 17:21774598-21774620 ACACGTGCACCCATGGAAGAAGG + Intergenic
1145378411 17:22373054-22373076 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1149258632 17:54855477-54855499 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1149384877 17:56132756-56132778 CCATGTCCTCACATGGTGGAAGG + Intronic
1149937716 17:60825695-60825717 CCATGTCCTCACATGGTGGAAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150378615 17:64702952-64702974 CTACATACTCACATGGCTGACGG - Intergenic
1150600663 17:66648113-66648135 CTGTGTCCTCACATGGCAGAAGG + Intronic
1150907976 17:69358916-69358938 CAACATCCTCACATGACAGAGGG - Intergenic
1151184758 17:72355636-72355658 TGATGTGCTCACATGGCAAAAGG + Intergenic
1151988865 17:77561303-77561325 CCACGTCCTCAGATCTCAGAAGG - Intergenic
1151988917 17:77561621-77561643 CCACGTCCTCAGATCTCAGAAGG - Intergenic
1151988976 17:77561992-77562014 CCACGTCCTCAGATCTCAGAAGG - Intergenic
1152292476 17:79448000-79448022 GCACGTCTTCACATGGCAGCAGG - Intronic
1152485217 17:80586618-80586640 CCACAGGCCCCCATGGCAGAGGG - Intronic
1152636197 17:81431436-81431458 CCAGGTCCACACCTGGCAGAGGG + Intronic
1152810788 17:82381562-82381584 CCACGTGTACACATGACACAGGG - Intergenic
1152810795 17:82381618-82381640 CCACGTGTACACATGACACAGGG - Intergenic
1152810802 17:82381674-82381696 CCACGTGTGCACATGACACAGGG - Intergenic
1153711049 18:7799205-7799227 CTGCATCCTCACATGGCAGAAGG + Intronic
1154014617 18:10605232-10605254 CCCTGTGCTCACAAGGCAGAGGG - Intergenic
1154179467 18:12119525-12119547 CTGTGTCCTCACATGGCAGAAGG + Intronic
1154213426 18:12398431-12398453 CTGCGTTCTCACGTGGCAGAAGG - Intergenic
1154333991 18:13451739-13451761 CTATGTGCTTACATGGCAGAAGG + Intronic
1156685297 18:39637693-39637715 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1156931444 18:42649641-42649663 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1157231480 18:45920547-45920569 CTGCGTCCACACATGGCAGAAGG + Intronic
1157301752 18:46484438-46484460 CTGTGTCCTCACATGGCAGAAGG - Intronic
1157311737 18:46557840-46557862 ACACCTGCACACATTGCAGAGGG - Intronic
1157942666 18:51946133-51946155 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158094509 18:53755524-53755546 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158400350 18:57116186-57116208 CTGCGTCCTCACACGGCAGAAGG + Intergenic
1158465789 18:57688781-57688803 CTATGTCCTCGCATGGCAGAAGG - Intronic
1158727566 18:59987384-59987406 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1159106346 18:64005518-64005540 CTGTGTACTCACATGGCAGAGGG - Intronic
1159479779 18:68974264-68974286 CTGGGTCCTCACATGGCAGAAGG - Intronic
1159560435 18:69987043-69987065 CTGCGTCCTAACATGGCAGAAGG + Intergenic
1159939836 18:74398373-74398395 CCACATCCTCACATGGCTGAAGG + Intergenic
1159955737 18:74517120-74517142 GCTTGTCCTCACATGGCAGAGGG + Intronic
1160553178 18:79708478-79708500 CCACGTCCCCACGTGGCACACGG - Intronic
1161599059 19:5169706-5169728 CCACCTTCTCACATGTCAGAAGG + Intronic
1161692050 19:5741475-5741497 CCACGTCCTCACACAGCAGAAGG + Intronic
1163296989 19:16418789-16418811 CCGTGTCCTCACATGGCAAAAGG - Intronic
1163786145 19:19275882-19275904 CCATGTGCTCTCCTGGCAGGTGG - Intergenic
1164916299 19:32054902-32054924 CCATGTCCTCATGTGGCAGAAGG + Intergenic
1165600086 19:37047349-37047371 CTGTGTCCTCACATGGCAGAAGG - Intronic
1165642249 19:37399674-37399696 CTCCGTCCTCACATGGCAGAAGG + Intergenic
1165963603 19:39555777-39555799 CCACATCATCCCATGGCAGAAGG - Intergenic
1167030232 19:46954067-46954089 TCGTGTCCTCACATGGCAGAGGG - Intronic
1167845339 19:52158999-52159021 CTGTGTCCTCACATGGCAGAAGG - Intronic
925496091 2:4450907-4450929 CCAGGTCCTCACATGGCAGAAGG - Intergenic
925880638 2:8349604-8349626 CTGTGTCCTCACATGGCAGAAGG + Intergenic
926383678 2:12315493-12315515 CCGTGTCCTCACATAGCAGAAGG - Intergenic
927431855 2:23033261-23033283 CTATGTCTTCACATGGCAGAAGG + Intergenic
927531716 2:23811353-23811375 CAATGTCCTCACATGGCAGAAGG - Intronic
927622673 2:24678073-24678095 ACACATGGACACATGGCAGAGGG - Intronic
928307158 2:30179639-30179661 CTGTGTCCTCACATGGCAGAAGG + Intergenic
929314959 2:40465935-40465957 CTGTGTCCTCACATGGCAGAAGG - Intronic
929754484 2:44752771-44752793 ACGTGTCCTCACATGGCAGAAGG + Intronic
929797852 2:45073735-45073757 CTGTGTCCTCACATGGCAGAGGG - Intergenic
930207418 2:48602065-48602087 CCGTGTCCTCACATGGCAGGAGG + Intronic
930394024 2:50796985-50797007 CTGTGTCCTCACATGGCAGAAGG + Intronic
930992959 2:57682752-57682774 CTGCCTTCTCACATGGCAGAGGG - Intergenic
931210202 2:60186487-60186509 CTGTGTCCTCACATGGCAGAAGG + Intergenic
932414604 2:71566034-71566056 CCACCTGCTCACATGCCACCTGG + Intronic
932577815 2:72972439-72972461 CCAAGATCTCAGATGGCAGAGGG - Intronic
932857778 2:75255614-75255636 CCATGTCCTCACATGGCAGAAGG - Intergenic
933107911 2:78356713-78356735 CTGTGTCCTCACATGGCAGAAGG + Intergenic
933971959 2:87477086-87477108 CCATGTGCTCACTGGGCAGCTGG - Intergenic
934891438 2:98073884-98073906 TCATGTTCTCAGATGGCAGAAGG + Intergenic
934942161 2:98510550-98510572 CCATGTCCTCACATGACAAAAGG + Intronic
935272576 2:101447945-101447967 CTACATCCTCACATGGCAGAAGG + Intronic
935277030 2:101483952-101483974 CTGCGTCCTCACATGGCATAAGG - Intergenic
935429520 2:102960159-102960181 CTATGTCTTCACATGGCAGAAGG + Intergenic
935478678 2:103557951-103557973 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
935716455 2:105943509-105943531 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935851434 2:107224372-107224394 CTGCGTCCTCACATGGTAGAAGG + Intergenic
935991881 2:108726572-108726594 TCTTGTCCTCACATGGCAGAGGG + Intronic
936254282 2:110897468-110897490 CTGAGTCCTCACATGGCAGAAGG + Intronic
936321767 2:111473111-111473133 CCATGTGCTCACTGGGCAGCTGG + Intergenic
936472253 2:112809689-112809711 GCACATCCTCACATGGCAGCAGG - Intergenic
936543126 2:113368274-113368296 CAGGGTCCTCACATGGCAGAAGG + Intergenic
936596902 2:113856785-113856807 CTGTGTCCTCACATGGCAGAAGG - Intergenic
936726196 2:115319846-115319868 CTGCATTCTCACATGGCAGAAGG + Intronic
937013600 2:118583548-118583570 CTGCATCCTCACATGGCAGAAGG + Intergenic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
937486351 2:122318757-122318779 TCACATCCTCACATGGCAGAAGG + Intergenic
937594501 2:123657633-123657655 CCATGTGCTCACATGGCAGTAGG + Intergenic
938118997 2:128620729-128620751 CCATTTCCTCACATGGCAGAAGG - Intergenic
938492287 2:131767884-131767906 CCATGTCCTCACATGACAGAAGG + Intergenic
938495282 2:131794466-131794488 CCATGTCCTCACATGACAGAAGG - Intergenic
938961485 2:136345504-136345526 CTGCATCCTCACATGGCAGAAGG + Intergenic
938974723 2:136465276-136465298 CTGTGTCCTCACATGGCAGAAGG + Intergenic
939231973 2:139439145-139439167 CCAGGTACTCTCAGGGCAGATGG + Intergenic
939271073 2:139940415-139940437 CTGGGTGCTCACAAGGCAGATGG + Intergenic
939455935 2:142435671-142435693 CTATATTCTCACATGGCAGAAGG + Intergenic
939489965 2:142865553-142865575 CCGTGTCCTCACATGGTAGAAGG + Intergenic
939499365 2:142963492-142963514 GCCCTTCCTCACATGGCAGAAGG + Intronic
939549586 2:143597925-143597947 CCATGTACTCACCTGTCAGAAGG + Intronic
939839515 2:147170121-147170143 CTGTGTTCTCACATGGCAGAAGG - Intergenic
940094034 2:149953225-149953247 CCACATCATCATATGGCAGAAGG + Intergenic
940121086 2:150266850-150266872 CTATGTCCTCAGATGGCAGAAGG + Intergenic
940372571 2:152919115-152919137 CTGTGTCCTCACATGGCAGAAGG - Intergenic
940478721 2:154200622-154200644 CTATGTCCTCACATGGCAGAAGG + Intronic
940619222 2:156089729-156089751 ATATGTCCTCACATGGCAGAAGG - Intergenic
940669655 2:156651230-156651252 CTGTGTTCTCACATGGCAGAAGG + Intergenic
941380354 2:164785044-164785066 CTTCATCCTCACATGGCAGAAGG - Intronic
941591385 2:167424446-167424468 CCACCTGCTAAAATGCCAGAAGG + Intergenic
941856277 2:170234360-170234382 CTATGTCCTCACATGGCAGAAGG + Intronic
942471607 2:176266702-176266724 ACATGTCCTCACATGGCAGAAGG - Intergenic
943039453 2:182786956-182786978 CCGTGTTCTCCCATGGCAGAAGG - Exonic
943115951 2:183670521-183670543 CTGCGTCCTTACATGGCAGAGGG - Intergenic
943370876 2:187014173-187014195 CTACGTCCTCACATGGCAGAAGG - Intergenic
943644819 2:190399051-190399073 CTGCATCCTCACATGGCAGAAGG + Intergenic
943677434 2:190729782-190729804 CTACGTTCTCACATGGTAGAAGG + Intergenic
944223578 2:197326648-197326670 CCATGTCCTCACATGGCAGAAGG - Intergenic
944467605 2:200018786-200018808 CTGTGTCCTCACATGGCAGAAGG + Intergenic
945609672 2:211984162-211984184 CCATGTCCTCACATGGTGGAAGG + Intronic
945650039 2:212545866-212545888 CCAGGTCCTCCCATGACAGATGG + Intergenic
945657980 2:212648884-212648906 CTGCATCCTCACATGGCAGAAGG + Intergenic
945930721 2:215852544-215852566 CTGTGTCCTCACATGGCAGAAGG + Intergenic
946089405 2:217207605-217207627 CCTCGTGCTCATTTTGCAGATGG + Intergenic
946637703 2:221747863-221747885 CTGTGTCCTCACATGGCAGAAGG - Intergenic
946891009 2:224276396-224276418 CTGCATCCTCACATGGCAGAAGG - Intergenic
947069819 2:226276182-226276204 CTACGTCCTCACATGGCAGAAGG + Intergenic
947231279 2:227889363-227889385 CTGCGTCTTCACATGGCAGAGGG + Intronic
947251914 2:228115973-228115995 CCATATCCTCACATGGGAGAAGG - Intronic
948511332 2:238467184-238467206 CTGTGTCCTCACATGGCAGAGGG + Intergenic
948669382 2:239558282-239558304 CCAGATGCTCTCATGGCAAACGG - Intergenic
1168788418 20:559327-559349 CCGTGTCCTCACATGGTAGAAGG - Intergenic
1168865363 20:1081372-1081394 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1168918037 20:1507491-1507513 CCCTGTCCTCACATGGCAGAGGG - Intergenic
1168975058 20:1958605-1958627 CCATGTCCTTATATGGCAGAGGG - Intergenic
1169301276 20:4443835-4443857 CCGCGTCCTCACGTAGCAGAAGG + Intergenic
1169331398 20:4719302-4719324 CTGTGTGCCCACATGGCAGAAGG + Intergenic
1169737294 20:8850682-8850704 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169830832 20:9823140-9823162 CTGTGTCCTCACATGGCAGAAGG - Intronic
1170957045 20:20991160-20991182 CCGCGTCCTCACATGGCAGAAGG + Intergenic
1171451453 20:25238784-25238806 CTGCATGCTTACATGGCAGAAGG - Intergenic
1171524866 20:25800936-25800958 CTGTGTCCTCACATGGCAGAAGG + Intronic
1171534055 20:25870603-25870625 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1171551961 20:26054947-26054969 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171793071 20:29546247-29546269 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171855380 20:30338159-30338181 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1172308150 20:33896481-33896503 CCTTGTCCTCACATGGCAGAAGG - Intergenic
1172602712 20:36194996-36195018 CCCTGTGCTCACAAGGTAGACGG - Intronic
1173234171 20:41228565-41228587 CACTGTCCTCACATGGCAGAAGG + Intronic
1173295424 20:41751140-41751162 CTATGTGCTCACATAGGAGAAGG - Intergenic
1173364807 20:42375479-42375501 CCATGTCCTCATATGGCAGAAGG - Intronic
1173904806 20:46618593-46618615 CTGTGTCCTCACATGGCAGAAGG - Intronic
1174517770 20:51106303-51106325 CTGCATCCTCACATGGCAGAAGG - Intergenic
1174706530 20:52662066-52662088 CTTTGTCCTCACATGGCAGAAGG + Intergenic
1174722337 20:52826435-52826457 CTGCATCCTCACATGGCAGAAGG + Intergenic
1175287069 20:57844158-57844180 CCATGTGTTCACCTGGCACATGG + Intergenic
1176037353 20:63046172-63046194 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1176135223 20:63519601-63519623 CCACGTGCTCAGGGGGCACAAGG + Intergenic
1176615603 21:9026119-9026141 CCATGTCCTCACATGACAGAAGG - Intergenic
1176709569 21:10137685-10137707 CCATGTCCTCACATGACAGAAGG + Intergenic
1177003968 21:15648032-15648054 CTATATCCTCACATGGCAGAAGG - Intergenic
1177006246 21:15675872-15675894 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1177155103 21:17493602-17493624 CCAGGTGTTCACGTGGCAGGTGG - Intergenic
1177208941 21:18045820-18045842 CTGTGTCCTCACATGGCAGAAGG - Intronic
1177326155 21:19591827-19591849 CCACCTGCTCAGGAGGCAGAGGG - Intergenic
1177500365 21:21947200-21947222 CCACCTGCTCAGAAGGCTGAGGG + Intergenic
1177504772 21:22006235-22006257 CCATATCCTCATATGGCAGAAGG + Intergenic
1178071408 21:28972152-28972174 CTGTGTCCTCACATGGCAGAAGG - Intronic
1178272701 21:31207294-31207316 ACTGGTGCTCAGATGGCAGATGG + Intronic
1178383192 21:32128687-32128709 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1178982028 21:37272382-37272404 CCATGTCCTCTCTTGGCAGAAGG - Intergenic
1179149824 21:38800215-38800237 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179626473 21:42652433-42652455 CCACCTGCTCTCATGGCGGGGGG - Intergenic
1180113660 21:45681000-45681022 CTGCATTCTCACATGGCAGAAGG + Intronic
1180293668 22:10864998-10865020 CCATGTCCTCACATGACAGAAGG + Intergenic
1180496473 22:15894413-15894435 CCATGTCCTCACATGACAGAAGG + Intergenic
1180942632 22:19669409-19669431 CTGCATCCTCACATGGCAGAAGG - Intergenic
1181385571 22:22543065-22543087 CTTTGTCCTCACATGGCAGAAGG - Intergenic
1181436868 22:22916303-22916325 GGACGTGCTCACAGGGCAGCAGG - Intergenic
1182076486 22:27498925-27498947 TCACCTCCTCACCTGGCAGATGG - Intergenic
1182459401 22:30473107-30473129 CCACGGGCTCCCCAGGCAGAGGG - Intergenic
1182817640 22:33180014-33180036 CTGTGTCCTCACATGGCAGAAGG - Intronic
1182829295 22:33291743-33291765 CCATGTTCTCACGTGGAAGAAGG - Intronic
1183112488 22:35660721-35660743 CTGTGTTCTCACATGGCAGAAGG + Exonic
1183124060 22:35758140-35758162 CCACCTGTTTACATGGAAGATGG - Intronic
1183489844 22:38110463-38110485 CCATGTGCTCACCTTGTAGATGG + Exonic
1184559782 22:45255542-45255564 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1184733178 22:46382047-46382069 CCTTCTGCTCACATTGCAGAAGG - Exonic
1184740534 22:46426466-46426488 CCACATCCTCACATGACAGAAGG + Intronic
949210894 3:1499769-1499791 CCAAGTCATCCCATGGCAGAAGG + Intergenic
949583226 3:5411972-5411994 CCACTCACTCACATGGCAGTAGG - Intergenic
949726921 3:7059779-7059801 CTGAGTTCTCACATGGCAGAAGG - Intronic
950816052 3:15703505-15703527 CCATATCCTCACATGGTAGAAGG - Intronic
951626317 3:24667652-24667674 CTGTGTTCTCACATGGCAGAAGG - Intergenic
952011422 3:28904527-28904549 CTGTGTCCTCACATGGCAGAAGG + Intergenic
952597619 3:35037576-35037598 CTACTTCCTCACATGGCAGAAGG + Intergenic
953206700 3:40837651-40837673 CTATGTCCTCACATGGCGGAAGG + Intergenic
953467572 3:43136966-43136988 CGATATCCTCACATGGCAGAAGG + Intergenic
953892916 3:46767959-46767981 CTACATCCTAACATGGCAGAAGG + Intronic
954273588 3:49527942-49527964 ACACGAGCTCACATGGCAGAGGG - Intronic
955241644 3:57183234-57183256 CTGTGTCCTCACATGGCAGAAGG + Intergenic
955649241 3:61175699-61175721 CCATGTCCTCACATGGCAGGAGG - Intronic
956049202 3:65229541-65229563 CTTTGTCCTCACATGGCAGAAGG + Intergenic
956271571 3:67453418-67453440 CTGTGTCCTCACATGGCAGAAGG + Intronic
956689554 3:71863426-71863448 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956758361 3:72412967-72412989 CTGTGTCCTCACATGGCAGAAGG - Intronic
956919189 3:73908274-73908296 CTGTGTCCTCACATGGCAGAAGG - Intergenic
957016559 3:75070427-75070449 CTGCATCCTCACATGGCAGAAGG - Intergenic
957180802 3:76875150-76875172 CTATATCCTCACATGGCAGAAGG - Intronic
957310304 3:78510337-78510359 CTGTGTCCTCACATGGCAGAAGG + Intergenic
957363427 3:79188967-79188989 GCATCTTCTCACATGGCAGAAGG - Intronic
958069905 3:88596915-88596937 CTGTGTCCTCACATGGCAGAAGG - Intergenic
958163280 3:89846426-89846448 CTGAGTCCTCACATGGCAGAAGG - Intergenic
958602301 3:96312148-96312170 CTGCATCCTCACATGGCAGAAGG + Intergenic
958686799 3:97408670-97408692 CTGTGTCCTCACATGGCAGAAGG + Intronic
959003124 3:100988251-100988273 CCAGCTGCTCACCTGGCAGCTGG - Intronic
959508970 3:107188652-107188674 CGATGTTCTCACATGGTAGAAGG + Intergenic
959569318 3:107866400-107866422 CTGCGTCTTCACATGGCAGAAGG - Intergenic
959593686 3:108105914-108105936 CCACTTGCACTCATGGCGGAAGG + Intergenic
959891678 3:111563050-111563072 CCATGTCCTCACATGGTGGAAGG + Intronic
960268340 3:115647191-115647213 TCATGTTCTCACATGGCAGAAGG - Intronic
960358432 3:116680638-116680660 CTATGTCCTCACATGGCAGAAGG - Intronic
962252579 3:133845361-133845383 CTGCGTCCTCACATGGCAGAGGG - Intronic
962351827 3:134661961-134661983 CTATGTTCTCACATGGCGGAAGG - Intronic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
963287878 3:143453960-143453982 CTATGTCCTCACATGACAGAAGG - Intronic
965797562 3:172457243-172457265 CTGCATCCTCACATGGCAGAAGG + Intergenic
966288750 3:178329581-178329603 CTGTGTCCTCACATGGCAGAAGG + Intergenic
966433354 3:179855767-179855789 CTGGGTCCTCACATGGCAGAAGG - Intronic
966834205 3:184036886-184036908 CCCTGAGCTCACATGGAAGATGG - Exonic
966840259 3:184082198-184082220 CCAGGTGCTGACATGGCTGCTGG - Intergenic
967259205 3:187625427-187625449 CTATGTTCTCACATGGCTGAAGG - Intergenic
967719608 3:192801606-192801628 CTGTGTCCTCACATGGCAGAAGG - Intronic
967989146 3:195118495-195118517 CCAGGTGTGGACATGGCAGAAGG + Intronic
968590934 4:1459310-1459332 CCACCTGCATCCATGGCAGAAGG - Intergenic
969042660 4:4312803-4312825 CCAAGGGCTCACATGGAGGACGG + Intronic
969081367 4:4621173-4621195 CTGTGTTCTCACATGGCAGAAGG + Intergenic
969189306 4:5504102-5504124 CTGCGTCCTCACATGGTAGAAGG - Intergenic
969271045 4:6102463-6102485 CCATGTCCTCACATGGCAGAAGG - Intronic
969328472 4:6458415-6458437 CTGCGTCCTCACATGACAGAAGG + Intronic
969355862 4:6625258-6625280 CTCCGTCCTCACATGGCAGAAGG + Intergenic
969719247 4:8884054-8884076 CAGCGTCCTCACATGGCAGAAGG - Intergenic
970162718 4:13205358-13205380 CTGTGTCCTCACATGGCAGAAGG + Intergenic
970441641 4:16085175-16085197 GCACATCTTCACATGGCAGAAGG - Intergenic
970568926 4:17360451-17360473 TCGCATCCTCACATGGCAGAAGG + Intergenic
970778850 4:19710787-19710809 CTATGTCCTCACATGGCAGATGG - Intergenic
970858793 4:20678298-20678320 CTGTGTGTTCACATGGCAGAAGG + Intergenic
970964564 4:21913404-21913426 CTGTGTCCTCACATGGCAGAAGG - Intronic
971520576 4:27545864-27545886 CTATGCCCTCACATGGCAGAAGG + Intergenic
971536782 4:27762343-27762365 CCATGTCCTCATATGGCACAAGG + Intergenic
971599580 4:28575314-28575336 CTCTGAGCTCACATGGCAGAAGG + Intergenic
972142307 4:35976089-35976111 CTGTGTTCTCACATGGCAGAAGG + Intronic
972181369 4:36470847-36470869 CTGTGTCCTCACATGGCAGAAGG - Intergenic
972840143 4:42921191-42921213 CTATGTCCTCACATGGTAGAAGG - Intronic
973062862 4:45750927-45750949 CTGTGTCCTCACATGGCAGAAGG + Intergenic
973582376 4:52357080-52357102 CCGTGTCCTCACATGGCAGAGGG - Intergenic
973627287 4:52785432-52785454 CTCTGTCCTCACATGGCAGAAGG - Intergenic
973766126 4:54164670-54164692 CTGTGTCCTCACATGGCAGAAGG + Intronic
973783067 4:54308233-54308255 ACATGGTCTCACATGGCAGAGGG + Intergenic
973918487 4:55661001-55661023 CCACGTTCTTACATGGCGGCAGG + Intergenic
973962650 4:56127139-56127161 CCATGTCCTCATATGGCAGGAGG - Intergenic
974202033 4:58655152-58655174 CTGTGTCCTCACATGGCAGAAGG + Intergenic
974677411 4:65111426-65111448 CAACAATCTCACATGGCAGATGG - Intergenic
974821462 4:67071374-67071396 CTGTGTCCTCACATGGCAGAGGG - Intergenic
975421860 4:74174094-74174116 CTATGTCCTCACATGGCAGAAGG + Intronic
975602169 4:76113038-76113060 TCACCATCTCACATGGCAGAAGG + Intergenic
975923786 4:79424447-79424469 CTGCGTCCTCACATGGTAGAAGG + Intergenic
976192430 4:82501014-82501036 CTACGTGCTATAATGGCAGAGGG + Intronic
977490705 4:97706427-97706449 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748467 4:100579864-100579886 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748602 4:100581009-100581031 CTGTGTCCTCACATGGCAGAAGG - Intronic
977880495 4:102198942-102198964 CTGTGTCCTCACATGGCAGAAGG + Intergenic
978630878 4:110742801-110742823 CTATGTCCTCACATGGTAGAAGG + Intergenic
978964446 4:114724604-114724626 CTGTGTTCTCACATGGCAGAAGG - Intergenic
979080262 4:116329840-116329862 CTGCATCCTCACATGGCAGAAGG - Intergenic
979174388 4:117644490-117644512 CTGTGTCCTCACATGGCAGAAGG + Intergenic
979418216 4:120469843-120469865 CTATGTCCTCACATGGCAGAAGG - Intergenic
980414878 4:132473526-132473548 CCATGTCCTCTCATGGCAGAAGG + Intergenic
980454127 4:133016994-133017016 CTATGTTCTAACATGGCAGACGG - Intergenic
980662324 4:135878579-135878601 CTGTGTCCTCACATGGCAGAAGG - Intergenic
980972146 4:139576787-139576809 CTATGTTCTCACATGGCAGAAGG + Intronic
981193053 4:141885945-141885967 GCACGTCTTCACATGGCAGCAGG - Intergenic
981260421 4:142712107-142712129 CTACGTCCTCACATGGTAGAAGG - Intronic
981377559 4:144033419-144033441 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981687806 4:147474605-147474627 CTCTGTCCTCACATGGCAGAAGG + Intergenic
981698361 4:147581530-147581552 TTATGTCCTCACATGGCAGAAGG - Intergenic
981874635 4:149527437-149527459 CTGCATCCTCACATGGCAGAAGG - Intergenic
982268653 4:153564337-153564359 CTATGTCCTCAAATGGCAGAAGG - Intronic
982401644 4:154974344-154974366 CTGCGTCCTCACATGGCAGAAGG - Intergenic
982527490 4:156497752-156497774 CCAGGTCTTCAGATGGCAGAAGG + Intergenic
982832724 4:160084655-160084677 CTGCCTCCTCACATGGCAGAAGG + Intergenic
982951193 4:161698147-161698169 CTGTGTCCTCACATGGCAGAAGG - Intronic
983500638 4:168495397-168495419 CTGTGTCCTCACATGGCAGAAGG - Intronic
983656297 4:170088849-170088871 CTATGTCCTCACGTGGCAGAAGG - Intronic
984100871 4:175484349-175484371 CCACCTGCTCTGATGGCTGAGGG + Intergenic
984246705 4:177283493-177283515 ACGAGTTCTCACATGGCAGAAGG + Intergenic
984385801 4:179056052-179056074 CACTGTTCTCACATGGCAGAAGG - Intergenic
984621357 4:181956115-181956137 CCGTGTTCTCACATGGAAGAAGG + Intergenic
984863387 4:184259187-184259209 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984900649 4:184583230-184583252 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984983196 4:185302628-185302650 CCACATCCTCACATGGCAGAAGG - Intronic
985230193 4:187807604-187807626 CCACAAAGTCACATGGCAGAGGG + Intergenic
985254736 4:188058473-188058495 CTGTGTCCTCACATGGCAGAAGG + Intergenic
985745096 5:1642396-1642418 CTGCGTCCTCACATGGCGGACGG + Intergenic
986174300 5:5338899-5338921 CCACATCCTCACATGGCCGAAGG - Intergenic
986535650 5:8784129-8784151 CTGTGTCCTCACATGGCAGAAGG - Intergenic
987049685 5:14139032-14139054 CCACATGCTCAGATAGCAGAAGG + Intergenic
987571064 5:19659716-19659738 CTGCATCCTCACATGGCAGAAGG - Intronic
987609444 5:20182725-20182747 CTAAGTCCTCAGATGGCAGAAGG - Intronic
987700355 5:21390180-21390202 CCTCTAGCTCACATGGCAGAAGG - Intergenic
987758103 5:22123214-22123236 CTAGGTGCTCACATAGCAGAAGG - Intronic
987816330 5:22905686-22905708 CCATGTCCTCACATGGCAGTAGG + Intergenic
987972083 5:24959783-24959805 TCCTGTCCTCACATGGCAGAGGG + Intergenic
988288567 5:29254896-29254918 CTGTGTCCTCACATGGCAGAAGG + Intergenic
988345323 5:30030077-30030099 CCCTGTCCTCACATGGCAGAAGG - Intergenic
988752054 5:34197885-34197907 CCTCTAGCTCACATGGCAGAAGG + Intergenic
989055457 5:37361968-37361990 CTCTGTCCTCACATGGCAGAGGG - Intronic
990538700 5:56750559-56750581 CCATTTCCTCACATGGTAGAAGG + Intergenic
991134059 5:63160723-63160745 CCATGTCCTCACATGGTAAAAGG + Intergenic
991214020 5:64140965-64140987 CTACATCTTCACATGGCAGAAGG + Intergenic
991221529 5:64224907-64224929 CTGCATCCTCACATGGCAGAAGG - Intronic
991357512 5:65784527-65784549 CTATATCCTCACATGGCAGAAGG + Intronic
991487357 5:67151337-67151359 CTATTTCCTCACATGGCAGAAGG + Intronic
991514851 5:67424000-67424022 CTGTGTCCTCACATGGCAGAAGG - Intergenic
991532093 5:67626849-67626871 CTGCATTCTCACATGGCAGAAGG - Intergenic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
991739818 5:69658701-69658723 CCTCTAGCTCACATGGCAGAAGG + Intergenic
991757681 5:69894476-69894498 CCTCTAGCTCACATGGCAGAAGG - Intergenic
991791393 5:70238442-70238464 CCTCTAGCTCACATGGCAGAAGG + Intergenic
991819281 5:70534826-70534848 CCTCTAGCTCACATGGCAGAAGG + Intergenic
991837084 5:70770358-70770380 CCTCTAGCTCACATGGCAGAAGG - Intergenic
991883842 5:71238784-71238806 CCTCTAGCTCACATGGCAGAAGG + Intergenic
992029451 5:72707166-72707188 TCTCGGGCTCACATGGCACAGGG - Intergenic
992485921 5:77195193-77195215 ACATGCCCTCACATGGCAGAAGG + Intergenic
992810439 5:80382409-80382431 CTGTGTTCTCACATGGCAGAAGG + Intergenic
992919148 5:81494557-81494579 CATAATGCTCACATGGCAGAAGG - Intronic
992920874 5:81518470-81518492 CAGCATCCTCACATGGCAGAGGG - Intronic
993023362 5:82618478-82618500 CTGTGTCCTCACATGGCAGAAGG + Intergenic
993309135 5:86307054-86307076 CCATGTTCTCACACGGTAGAAGG + Intergenic
993861925 5:93146701-93146723 CCACGTCATAACATGGCAGAAGG + Intergenic
994777618 5:104054805-104054827 CTATGTTCTCAAATGGCAGAAGG - Intergenic
995027347 5:107439226-107439248 CTGAGTCCTCACATGGCAGAAGG - Intronic
995290773 5:110450098-110450120 GCACGTTTTCACATGGCAGCAGG - Intronic
995593060 5:113719794-113719816 TGACATCCTCACATGGCAGAAGG - Intergenic
995621743 5:114033084-114033106 CTGCGTCCTCACATAGCAGAAGG - Intergenic
995755482 5:115499190-115499212 CTGTGTCCTCACATGGCAGAAGG + Intergenic
996231924 5:121075202-121075224 CTGTGTGCTCACATGGTAGAAGG + Intergenic
996752234 5:126900454-126900476 CTATGTCCTCACATGGTAGACGG - Intronic
997087258 5:130816391-130816413 CTCTGTCCTCACATGGCAGAAGG + Intergenic
997201567 5:132012878-132012900 CCACATGCACTCATGGCTGATGG - Intergenic
997385805 5:133471519-133471541 CTGTGTCCTCACATGGCAGAAGG - Intronic
997559959 5:134837643-134837665 CTATGTTCTCACATGGCAGAAGG - Intronic
998980966 5:147701732-147701754 CTGCATCCTCACATGGCAGAAGG - Intronic
999498597 5:152124733-152124755 CCACCTGCTGAGATGGGAGAAGG - Intergenic
999886680 5:155931954-155931976 CTGTGTGCTCACATGGTAGAAGG + Intronic
1000151641 5:158507882-158507904 CCATGTTCTCACATGGCAGAAGG + Intergenic
1000221693 5:159220520-159220542 ACGTGTCCTCACATGGCAGAAGG - Intergenic
1000862862 5:166477114-166477136 CTATGTCCTCACCTGGCAGAAGG - Intergenic
1000966044 5:167658161-167658183 CTGTGTCCTCACATGGCAGATGG + Intronic
1001676522 5:173522262-173522284 CTGCGTTCTCACATGGAAGAGGG - Intergenic
1001814271 5:174654928-174654950 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1001923749 5:175621051-175621073 CCATGTCCTCACATGGTGGAAGG - Intergenic
1001979080 5:176025764-176025786 CCGTGTTCTCACATGGCAGGAGG - Intronic
1001982798 5:176047980-176048002 CCACGTGCACACGTGGCACCAGG - Intergenic
1002234665 5:177796077-177796099 CCACGTGCACACGTGGCACCAGG + Intergenic
1002238337 5:177818000-177818022 CCGTGTTCTCACATGGCAGGAGG + Intergenic
1002592139 5:180298181-180298203 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002883979 6:1277496-1277518 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1003144119 6:3495384-3495406 CCGTGTTCTCACATGGCAGAAGG - Intergenic
1003318013 6:5028860-5028882 CTATGTCCTCATATGGCAGAAGG - Intergenic
1003567754 6:7234953-7234975 CCACATGTCCACATTGCAGAAGG + Intronic
1003619927 6:7690910-7690932 CCACTGGCTTCCATGGCAGATGG + Intergenic
1003903169 6:10674120-10674142 TCATGTCTTCACATGGCAGAGGG + Intronic
1004241998 6:13931952-13931974 CCGTGTTCTCACATGGCAGAAGG - Intronic
1004271567 6:14200723-14200745 CCATGTGCTCACATGGTGGAAGG + Intergenic
1004791102 6:19027424-19027446 CTACATGTTCACATGGCAGAAGG - Intergenic
1004823194 6:19392499-19392521 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1004971752 6:20918153-20918175 CTGTGTCCTCACATGGCAGAAGG - Intronic
1005130857 6:22506146-22506168 CCTCGGGCACACATGGCCGAAGG - Intergenic
1005550214 6:26904599-26904621 CCTCTAGCTCACATGGCAGAAGG + Intergenic
1006826246 6:36938457-36938479 CCGTGTCCTCACATTGCAGAAGG + Intergenic
1006869023 6:37233473-37233495 CTGCATGCTCACATGGGAGAAGG + Intronic
1007076123 6:39067454-39067476 CTGTGTCCTCACATGGCAGAGGG + Intronic
1007164520 6:39819788-39819810 CTGTGTCCTCACATGGCAGATGG + Intronic
1008614813 6:53216472-53216494 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1009532043 6:64830143-64830165 CCATGTCCTCACATGGTGGAAGG - Intronic
1009637464 6:66284453-66284475 CATCCTTCTCACATGGCAGAAGG - Intergenic
1009763122 6:68034770-68034792 CCATGTCCTCACATGGCAGAAGG - Intergenic
1009845172 6:69125497-69125519 CCCTGTCTTCACATGGCAGAAGG - Intronic
1009882816 6:69590605-69590627 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1010209350 6:73350759-73350781 CCACCTACTCAGATGGCTGAGGG + Intergenic
1010339580 6:74732555-74732577 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1010652971 6:78477730-78477752 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1011073264 6:83409063-83409085 CTGTGTCCTCACATGGCAGAAGG - Intronic
1011171814 6:84513188-84513210 CTGCGTCCTTACATGGCAGAAGG - Intergenic
1011403244 6:86987794-86987816 CAGTGTCCTCACATGGCAGAAGG + Intronic
1012065753 6:94549423-94549445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1012599619 6:101079070-101079092 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1013427590 6:110027895-110027917 CTGCATCCTCACATGGCAGAAGG + Intergenic
1013692615 6:112663798-112663820 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1013832586 6:114292313-114292335 CTGCGTTCTCACGTGGCAGAAGG + Intronic
1014181808 6:118392736-118392758 CTACATCCTCACATGGCAGAAGG + Intergenic
1014336141 6:120139971-120139993 CCACATCATAACATGGCAGAGGG + Intergenic
1014350697 6:120341298-120341320 CTATGTCCTCACATGGCAGAAGG - Intergenic
1015210110 6:130687242-130687264 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1015606389 6:134959311-134959333 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1015975594 6:138787292-138787314 CCATGTCCTCACATGGTAGAAGG - Intronic
1016062682 6:139646748-139646770 CCACATTCCCACATGGCTGAAGG - Intergenic
1016265397 6:142227390-142227412 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1016388040 6:143548172-143548194 CTGTGTCCTCACATGGCAGAGGG + Intronic
1018127021 6:160691644-160691666 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1018149537 6:160925436-160925458 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1018805141 6:167253462-167253484 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1018805444 6:167255830-167255852 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1018870664 6:167779891-167779913 CCACGTCCTCACATGGCAGGAGG + Intergenic
1019636070 7:2076371-2076393 CCCTGTCCTCACAGGGCAGAGGG - Intronic
1021367738 7:19801667-19801689 CCATGTCCTCACATGGCAGAAGG - Intergenic
1021465439 7:20938001-20938023 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1021976937 7:26020223-26020245 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022150292 7:27596222-27596244 CTGTGTCCTCACATGGCAGAAGG + Intronic
1022212470 7:28224970-28224992 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1023606000 7:41931516-41931538 GCTGGTGCTCACATGGAAGATGG + Intergenic
1023677614 7:42646933-42646955 CCATGTCTTCCCATGGCAGAAGG - Intergenic
1023886674 7:44361930-44361952 CCATGTTCTCACATGGCAAAGGG + Intergenic
1023988877 7:45115997-45116019 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1024700300 7:51899330-51899352 CTGCGTCCTCACATGGCTGAAGG + Intergenic
1024716333 7:52083440-52083462 CTGCATCCTCACATGGCAGAAGG + Intergenic
1024808863 7:53183756-53183778 CTATGTCCTTACATGGCAGAAGG + Intergenic
1025121481 7:56307644-56307666 CTATGTACTCACATGGCAGAAGG - Intergenic
1025285527 7:57657536-57657558 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1025887896 7:65615578-65615600 CTGTGTCCTCACATGGCAGATGG + Intergenic
1026482883 7:70794023-70794045 CTACGTTCTGACATTGCAGATGG - Intergenic
1026774966 7:73225776-73225798 CCCCGTGCTCACCTGGGAGGTGG - Intergenic
1027015821 7:74779147-74779169 CCCCGTGCTCACCTGGGAGGTGG - Exonic
1027072208 7:75166790-75166812 CCCCGTGCTCACCTGGGAGGTGG + Intergenic
1027154866 7:75759715-75759737 CTGCTTCCTCACATGGCAGAAGG - Intergenic
1027569650 7:79847994-79848016 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1027950493 7:84808948-84808970 ATACGTTCTCACATGGCAGAAGG + Intergenic
1028498684 7:91492402-91492424 CTATGTCCTCACATGGTAGAAGG - Intergenic
1028916551 7:96265898-96265920 CTCCATCCTCACATGGCAGAAGG + Intronic
1030203446 7:106929056-106929078 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1030353512 7:108518073-108518095 CCGTGTCCTCACATGGTAGAAGG + Intronic
1030874800 7:114800544-114800566 CTTTGTCCTCACATGGCAGAAGG + Intergenic
1031161919 7:118179057-118179079 CTGCATCCTCACATGGCAGAAGG - Intergenic
1031203447 7:118721863-118721885 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1031255207 7:119438082-119438104 GCATGTGGTCACAAGGCAGATGG + Intergenic
1031650406 7:124282155-124282177 CTACGTCCTCACAAGGTAGAAGG - Intergenic
1031854493 7:126906160-126906182 CTGTGTCCTCACATGGCAGATGG - Intronic
1033030895 7:137825353-137825375 TCACGTTATCCCATGGCAGACGG + Intronic
1033980219 7:147155221-147155243 CTGTGTCCTCACATGGCAGAAGG - Intronic
1034278738 7:149837285-149837307 CTCTGTCCTCACATGGCAGAAGG + Intergenic
1034283996 7:149872837-149872859 CCAGGAGCACACATGGCTGACGG + Intergenic
1034716448 7:153247053-153247075 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1034922213 7:155092763-155092785 CTCTGTTCTCACATGGCAGAAGG - Intergenic
1035088369 7:156281359-156281381 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1035897732 8:3422897-3422919 CACTGTCCTCACATGGCAGAAGG + Intronic
1036119417 8:5999523-5999545 CTATGTCCTCACATGGCAAAAGG - Intergenic
1036161794 8:6395872-6395894 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036180661 8:6581872-6581894 CTGCGTCCTCACATGGCAGAAGG + Intronic
1036566869 8:9945342-9945364 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1036985925 8:13531069-13531091 CCATGTCTTCACCTGGCAGAGGG - Intergenic
1037102312 8:15061679-15061701 CTCTGTCCTCACATGGCAGAAGG - Intronic
1038074848 8:24060547-24060569 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1038291312 8:26252226-26252248 CTGTGTGCTCACGTGGCAGAAGG + Intergenic
1038394307 8:27235778-27235800 CTGCATCCTCACATGGCAGAAGG - Exonic
1038841435 8:31188075-31188097 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1038862460 8:31402202-31402224 ACACGTGCTCACAGGGAAGCTGG + Intergenic
1040673246 8:49717623-49717645 TAACTTCCTCACATGGCAGATGG - Intergenic
1040850038 8:51890892-51890914 CCACAGGATTACATGGCAGAAGG + Intronic
1041080748 8:54212723-54212745 CAAAATGCTCAGATGGCAGAGGG + Intergenic
1041422891 8:57689346-57689368 CTGCATCCTCACATGGCAGAAGG + Intergenic
1041815168 8:61962292-61962314 CTATGTCCTTACATGGCAGAAGG + Intergenic
1042169553 8:65978341-65978363 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1042449513 8:68928273-68928295 CTACCTCCTCACATGGAAGAAGG - Intergenic
1042640370 8:70927582-70927604 CTATGACCTCACATGGCAGAAGG + Intergenic
1042990278 8:74631817-74631839 CTGCATCCTCACATGGCAGAAGG + Intronic
1043322431 8:79006125-79006147 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1043337818 8:79198973-79198995 CTATGTCCTCACATGGTAGAAGG + Intergenic
1043604016 8:81977356-81977378 CTGTGTCCTCACATGGCAGAGGG - Intergenic
1044213057 8:89573316-89573338 CCATGTTATCCCATGGCAGAAGG - Intergenic
1044213433 8:89579108-89579130 CCGCATCCTCACAAGGCAGAAGG - Intergenic
1044537483 8:93374200-93374222 CTCTGTCCTCACATGGCAGAAGG + Intergenic
1044886464 8:96783405-96783427 CCACATCATAACATGGCAGAAGG + Intronic
1045142029 8:99296774-99296796 CTATGTCCTCACGTGGCAGAAGG - Intronic
1045683144 8:104683850-104683872 CTGTGTCCTCACATGGCAGAAGG + Intronic
1046074186 8:109297537-109297559 ATACGTCCTCACATGACAGAAGG - Intronic
1046396055 8:113641108-113641130 CTGCATGCTCACATAGCAGAAGG - Intergenic
1046426216 8:114053499-114053521 CTATGTCCTCACATGGCAGAAGG + Intergenic
1046953382 8:120039192-120039214 CTATGTCCTCACATGGTAGAAGG - Intronic
1047014642 8:120710660-120710682 CTGTGTTCTCACATGGCAGAAGG - Intronic
1047252866 8:123193772-123193794 CTGTGTCCTCACATGGCAGAAGG + Intronic
1047767549 8:128001816-128001838 CCGCGTCCTCACATGGAGGAAGG + Intergenic
1048131265 8:131700371-131700393 CCACATGATCACATGACAAAGGG + Intergenic
1049950556 9:639854-639876 CTATGTCCTTACATGGCAGATGG + Intronic
1050036087 9:1437662-1437684 CCAAGGGGTCACATGTCAGATGG - Intergenic
1050041291 9:1496535-1496557 CCACGTCCACTCATGGCAGAAGG - Intergenic
1050225983 9:3456044-3456066 CTGTGTCCTCACATGGCAGAAGG + Intronic
1050310421 9:4347146-4347168 CCACTTCCACTCATGGCAGAAGG + Intronic
1050755412 9:8996673-8996695 CTATGTCCTCACATGGCAGAAGG + Intronic
1051884256 9:21873504-21873526 ACGTGTTCTCACATGGCAGAAGG - Intronic
1051921436 9:22271090-22271112 CCATCTCCTCACATGGTAGAAGG + Intergenic
1051964842 9:22815283-22815305 CTATGTCCTCACATGGTAGAAGG - Intergenic
1051964846 9:22815314-22815336 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1052195393 9:25707084-25707106 CCACATCCTCATATGGAAGAAGG + Intergenic
1052338911 9:27346135-27346157 CTGCATTCTCACATGGCAGAAGG - Intronic
1052782268 9:32793762-32793784 CTATGTCTTCACATGGCAGAAGG - Intergenic
1053185832 9:36015661-36015683 CTATGTCCTCACATGGCAGAAGG + Intergenic
1053793209 9:41701444-41701466 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054151968 9:61613395-61613417 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054181618 9:61913456-61913478 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054471740 9:65544525-65544547 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054760145 9:68997555-68997577 CAATGTGATCACCTGGCAGAAGG - Intronic
1054997968 9:71413708-71413730 CCATGACCTCACATGGCAGAAGG - Intronic
1055633935 9:78255552-78255574 CCATGTCCTCACATGGTGGAAGG + Intronic
1055753884 9:79536316-79536338 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1056100283 9:83294196-83294218 CTGTGTCCTCACATGGCAGAAGG - Intronic
1056177429 9:84049120-84049142 CTATGCCCTCACATGGCAGAGGG - Intergenic
1056594751 9:87997787-87997809 CTTCATCCTCACATGGCAGAAGG - Intergenic
1057035106 9:91806317-91806339 CTGTGTCCTCACATGGCAGAAGG + Intronic
1057979214 9:99641888-99641910 CTACATCATCACATGGCAGAAGG + Intergenic
1058140666 9:101354293-101354315 CTGCATCCTCACATGGCAGAAGG + Intergenic
1058293900 9:103280505-103280527 CTATGTCCTCACATGGCAGAAGG - Intergenic
1058586617 9:106513863-106513885 CTATGTCGTCACATGGCAGAAGG + Intergenic
1058959339 9:109978151-109978173 CCAGGTGCTGAGGTGGCAGAGGG + Intronic
1059761519 9:117342224-117342246 CCACATGCTAAAATGCCAGATGG + Intronic
1060333816 9:122702919-122702941 ACACATGCTCACAGTGCAGATGG - Intergenic
1060431676 9:123556188-123556210 CTGTGTGCTCACATAGCAGAAGG - Intronic
1060768114 9:126310012-126310034 CTGTGTGCTTACATGGCAGAAGG - Intergenic
1061599107 9:131654755-131654777 CCCAGTGCTGACATGGCAGTTGG + Intronic
1062203236 9:135320216-135320238 CCAGGTGCTCCCATGTCTGAGGG - Intergenic
1062405299 9:136393349-136393371 CCATGAGCTCTCAAGGCAGAGGG - Intronic
1202794328 9_KI270719v1_random:106652-106674 CCATGTCCTCACATGACAGAAGG + Intergenic
1203782856 EBV:110517-110539 GCACTTGCTCAAAAGGCAGAGGG + Intergenic
1185636098 X:1553241-1553263 CCATGTCCTCACATGGTAGAAGG - Intergenic
1186121165 X:6362540-6362562 CCAGCTGCTCCCATGTCAGAGGG - Intergenic
1186289980 X:8086587-8086609 GGACCTGCTCACATGGCAGCAGG + Intergenic
1186562017 X:10622586-10622608 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186610225 X:11131584-11131606 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1186651976 X:11570981-11571003 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186689701 X:11962282-11962304 CCACATCCTCACATGGTAGAAGG + Intergenic
1187276074 X:17817610-17817632 CCACCTTCTCACATGGGTGAGGG - Intronic
1187316712 X:18202522-18202544 CTGTGTCCTCACATGGCAGAAGG - Intronic
1187426233 X:19179867-19179889 CCGTGTCCTCACATGGCATAAGG - Intergenic
1187440508 X:19313758-19313780 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1187802784 X:23082660-23082682 CTGCATGCTCACATGGCAAAAGG + Intergenic
1188293511 X:28417564-28417586 CTGCATCCTCACATGGCAGAAGG + Intergenic
1188884080 X:35528454-35528476 CTGCGTCCTCACATGGCAGAAGG - Intergenic
1189124768 X:38434802-38434824 CTATGTACTCACTTGGCAGAAGG + Intronic
1189254252 X:39625242-39625264 CTATGTCCTCACGTGGCAGAAGG + Intergenic
1189494600 X:41497840-41497862 GCACGTCTTCACATGGCAGCAGG + Intergenic
1189556263 X:42148452-42148474 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1189569759 X:42283940-42283962 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1189916161 X:45857742-45857764 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1190164027 X:48056713-48056735 CCATGTCCTCACATGGCAGAAGG - Intronic
1191734574 X:64375662-64375684 CTGCCTCCTCACATGGCAGAAGG - Intronic
1192115858 X:68410364-68410386 CCGTGTTCTCACATGGCAGAAGG + Intronic
1192285156 X:69727475-69727497 CTGTGTTCTCACATGGCAGAAGG + Intronic
1193698095 X:84734320-84734342 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1193903418 X:87212763-87212785 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1194236773 X:91394376-91394398 CTACGTTCTCACATGGTAGAAGG + Intergenic
1194818002 X:98469022-98469044 CTTCATCCTCACATGGCAGAAGG + Intergenic
1195050662 X:101093873-101093895 CTGTGTCCTCACATGGCAGAAGG + Intronic
1195196701 X:102503942-102503964 CTACAAACTCACATGGCAGAAGG + Intergenic
1195629287 X:107037343-107037365 CTATGTCCTGACATGGCAGAAGG + Intergenic
1196538180 X:116872463-116872485 CTAGGTTCTCACATGACAGAAGG + Intergenic
1196760447 X:119196410-119196432 CCGTGTCCTCACATGGCAGAAGG + Intergenic
1197482126 X:127000283-127000305 CTATGTCCGCACATGGCAGAAGG + Intergenic
1198315273 X:135459779-135459801 CTTTGTCCTCACATGGCAGAAGG - Intergenic
1198546442 X:137697449-137697471 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1198574044 X:137990599-137990621 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1198948097 X:142038115-142038137 CCTCTTGCTTACATGGCAGAAGG + Intergenic
1199130179 X:144175944-144175966 CTATGTCCTCACATGGTAGAAGG + Intergenic
1199425000 X:147691177-147691199 CCACATCCTCACATGGTAAAAGG + Intergenic
1199736064 X:150687766-150687788 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1199751736 X:150826107-150826129 CTGTGTTCTCACATGGCAGAAGG - Intronic
1199778215 X:151034214-151034236 CTGCATTCTCACATGGCAGAAGG - Intergenic
1199949427 X:152695647-152695669 CTATGTCCTCACATGGAAGAAGG - Intergenic
1199960249 X:152772802-152772824 CTATGTCCTCACATGGAAGAAGG + Intergenic
1199971668 X:152866216-152866238 CCATGTCCTCACATGGTGGAAGG + Intronic
1200017059 X:153173927-153173949 CCATGTCCTCACATGGAAGACGG - Intergenic
1200076410 X:153553493-153553515 CCACCTTCTCACCTGGTAGAAGG - Intronic
1201148990 Y:11084774-11084796 CCATGTCCTCACATGACAGAAGG - Intergenic
1201673840 Y:16557129-16557151 CTATGTCCTCACATGGTAGAAGG - Intergenic
1201676102 Y:16586110-16586132 CTGTGTCCTCACATGGCAGAAGG - Intergenic