ID: 1091480500

View in Genome Browser
Species Human (GRCh38)
Location 12:824638-824660
Sequence CTGTAATTAGGGAGGTGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091480500 Original CRISPR CTGTAATTAGGGAGGTGCTA TGG Intronic
901333263 1:8426645-8426667 CTGTTCTTAGGTAGGGGCTAAGG - Intronic
901614612 1:10528437-10528459 TTATCATTAGGGAGGTGCTGGGG + Intronic
907343915 1:53758590-53758612 ATGTGATTTGGGAGGTGCCAGGG - Intergenic
909562621 1:77023333-77023355 CTGTACCTAGGGATGTGCAAGGG - Intronic
914891387 1:151626807-151626829 TTGTATTTAGGCAGTTGCTAAGG + Intronic
922620938 1:226987726-226987748 CTGTAAGAAGGGAGGTGGGAGGG + Intergenic
1063752803 10:8970275-8970297 TGGTAATAAGGGAGGTGGTAAGG + Intergenic
1075487740 10:122839660-122839682 GAGCAACTAGGGAGGTGCTAAGG - Intronic
1076522201 10:131088380-131088402 GTGTAATTAGGGACGTGTTCAGG - Intergenic
1078548583 11:12264391-12264413 CTATACTTCGGGTGGTGCTAGGG - Intergenic
1079266599 11:18939051-18939073 TTGGAATAAGGGAGGTGATATGG + Intronic
1083032851 11:59610129-59610151 CTGAAGGGAGGGAGGTGCTATGG - Intronic
1087225679 11:95595765-95595787 CTGTAATTACGGAGCTGAGAAGG + Intergenic
1089091757 11:115883915-115883937 CTGTAAGCAGGGAGGTGACATGG - Intergenic
1089115332 11:116090225-116090247 CTGTAATTAGGCAGCAGCTTGGG - Intergenic
1091480500 12:824638-824660 CTGTAATTAGGGAGGTGCTATGG + Intronic
1092875397 12:12843243-12843265 CTGTATTTAGCCAGGTGCTGTGG - Intergenic
1093331455 12:17848128-17848150 CTGTATTTAAGGAGTTTCTAGGG - Intergenic
1094079485 12:26517180-26517202 CTATATATAGGGAGATGCTATGG + Intronic
1094429165 12:30347762-30347784 GTGCAAGAAGGGAGGTGCTAAGG - Intergenic
1096258473 12:50076836-50076858 CTGTAATCATGGAGGGCCTAAGG + Intronic
1096574108 12:52541956-52541978 CTGTGATTTGGGGGATGCTATGG - Intergenic
1097587275 12:61529999-61530021 CTGAAATTTGGGAGGGGCTGGGG - Intergenic
1104501700 12:129292481-129292503 CTGTAATTAGAGAAGGGCCAGGG + Intronic
1104696351 12:130866973-130866995 CTGTAGCCAGGGAGGTACTATGG - Intergenic
1110235564 13:73214360-73214382 CTGAAATTGGAGAGGTGCTCCGG + Intergenic
1111036065 13:82676577-82676599 ATGAGATTAGGGAGGGGCTAAGG - Intergenic
1119070622 14:71579591-71579613 CTGTATTTAAGGACATGCTAAGG + Intronic
1124878717 15:33621768-33621790 CTTTAAGTAAAGAGGTGCTAAGG - Intronic
1129677740 15:77641605-77641627 CTGTAATTGGGGAGGGTGTAGGG - Intronic
1130339947 15:82991779-82991801 ATGTAATTAGGGAGGTTACAGGG - Intronic
1131599110 15:93828959-93828981 CTGTAAGTAGGGTGGTTCTCCGG - Intergenic
1134556581 16:15170951-15170973 TTGTAAATAGGGTGGTGATAAGG - Intergenic
1134917161 16:18082664-18082686 TTGTAAATAGGGTGGTGATAAGG - Intergenic
1136598251 16:31266278-31266300 CAGAAGCTAGGGAGGTGCTAGGG + Intronic
1140515808 16:75540498-75540520 GTGCAATTAGGCAGGGGCTAAGG - Intronic
1143931816 17:10437285-10437307 CTCTAATAAGGGAAGTGATATGG + Intergenic
1144171677 17:12665094-12665116 CTCTAAATAGGGAGGGGCTCTGG - Intergenic
1148602300 17:48903616-48903638 CTGTAGCTATGGAGGAGCTATGG + Intergenic
1150165075 17:62933518-62933540 GTATAATTAGGGAGGTGCCTAGG - Intergenic
1150562879 17:66310086-66310108 CTGTAATTAGAGAAGTGCATGGG - Intronic
1158902069 18:61973258-61973280 CTCTGATTCGGCAGGTGCTATGG - Intergenic
1159138038 18:64360560-64360582 CTGAGATTTGGGAGGTGCCATGG - Intergenic
1160476293 18:79192017-79192039 CTGGCATTAGGGAGCTGCTGTGG + Intronic
1160886617 19:1352725-1352747 CTGTGCTTTGGGAGGTGCTTTGG - Intergenic
1161511520 19:4674919-4674941 CTGTAATTTGGGTTGTGCTGAGG + Intergenic
1166018849 19:40006295-40006317 CTGTAACTAGGGAGTAACTAGGG - Intronic
1167774032 19:51543142-51543164 CTCTCATTAGGGAGGTTCTGGGG - Intergenic
925785391 2:7427535-7427557 CTGTAATTAAGGTGTTGCTTGGG + Intergenic
925826963 2:7859031-7859053 CTGTAAGAAGGGAGGTGGTAAGG - Intergenic
927480088 2:23446642-23446664 TTGTACTGAGGGATGTGCTAAGG + Intronic
928866822 2:35927274-35927296 CTTTCATTAGGTAGGTGATATGG + Intergenic
934097609 2:88621270-88621292 CTGTAAATAGGCAGGTGTTCTGG - Intronic
936228635 2:110680308-110680330 CTTTAATGAGGGAGGGGCTGAGG - Intergenic
937996106 2:127696154-127696176 CTGCACTGAGGGAGGTGCTCCGG - Intergenic
938234714 2:129696377-129696399 ATGAGATTTGGGAGGTGCTAGGG + Intergenic
941854703 2:170219208-170219230 CTGTATTAAGGGAGGGTCTAAGG - Intronic
942106901 2:172642344-172642366 ATGTAATTAGGAAGGTGGTGGGG + Intergenic
944269502 2:197765362-197765384 CTGTAATTTTGGAGGTGTTTTGG - Intronic
944458075 2:199916388-199916410 ATGAAATTTGGGAGGGGCTAGGG - Intronic
1169423396 20:5477404-5477426 CTGTAAGTGGGCAGCTGCTATGG + Intergenic
1172056792 20:32159799-32159821 CTGTCCTTAGGGAGGGGCCAGGG - Intronic
1172630340 20:36374261-36374283 CTGGAATGTGAGAGGTGCTAAGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1174667196 20:52270869-52270891 CTGTTAGCAGGGAGATGCTAAGG - Intergenic
1175516867 20:59575669-59575691 CTGGAATTAGGGAGGGGCCCTGG + Intergenic
1175990859 20:62788260-62788282 CTGTTAGGAGGGAGATGCTAGGG - Intergenic
1177202217 21:17970407-17970429 CTGTAATAAGGAAGGTGTTTGGG + Intronic
1177473203 21:21584801-21584823 GTGAAATTTGGGAGGGGCTAGGG + Intergenic
1180635376 22:17259218-17259240 CTGCAATTAGGAAGGTGATGGGG + Intergenic
1181445309 22:22968176-22968198 ATGAGATTTGGGAGGTGCTAGGG - Intergenic
1183847502 22:40554276-40554298 CTGTGATTTGGGAGGGGCCAGGG + Intronic
952737000 3:36700753-36700775 CTGTATCTAGGGAGGTACAAAGG + Intergenic
955349940 3:58185893-58185915 CTGTCAGAAGGGAGGTGGTATGG - Intergenic
956262474 3:67359964-67359986 CTGAAAATAGGGCGGTTCTAGGG - Intergenic
961097226 3:124167978-124168000 GTATAGTTAGGGAGCTGCTAAGG + Intronic
963011345 3:140773273-140773295 CCGTAATTAGTGAGCTGCTTAGG + Intergenic
964251795 3:154726654-154726676 CTGTATTTAGGCATGTGGTATGG - Intergenic
967397667 3:189024980-189025002 TTTTATTTTGGGAGGTGCTATGG + Intronic
967438385 3:189477810-189477832 CTGTATCTATGGTGGTGCTAGGG - Intergenic
967786624 3:193503817-193503839 GAGTAATTAGGGAGGTTCTCAGG - Intronic
969121005 4:4911131-4911153 CTGAAGTTTGAGAGGTGCTATGG - Intergenic
970362751 4:15326259-15326281 CTGAAATTAGGGAGTTGGCAGGG + Intergenic
971682962 4:29725132-29725154 AAGTAATTAGGGAGGATCTAAGG + Intergenic
971886781 4:32460258-32460280 ATGTAATTATGGATGTGATAAGG + Intergenic
972891778 4:43565787-43565809 CAGTAAGTAGGTATGTGCTATGG - Intergenic
975731984 4:77346497-77346519 CTGGAAGAAGTGAGGTGCTATGG + Intronic
978898517 4:113920510-113920532 CTGAAATTAGGGAGCTTCAAGGG + Intronic
979135927 4:117113365-117113387 ATGAAATTTGGGAGGTGCCATGG - Intergenic
981230777 4:142352675-142352697 ATGTAATTAGAGAGGTGGAAGGG - Intronic
985538988 5:479137-479159 CTGTCCTTAGGGAGGAGCTGCGG + Intronic
986969204 5:13312494-13312516 CTGGAATTAGACAGTTGCTATGG - Intergenic
992138202 5:73768764-73768786 ATGTAATTTGGGAGGGGCCAGGG + Intronic
992927283 5:81601728-81601750 CTGTAATTAGGAAGATGCTTTGG - Intronic
993229002 5:85207206-85207228 GTGCAATGAGGGAGGTGCTCTGG + Intergenic
998017597 5:138744982-138745004 CTGTGATTTGGGAGCTGCTGAGG - Intronic
1001997638 5:176174857-176174879 CTTTAATGAGGGAGGGGCTGAGG - Intergenic
1003181358 6:3794644-3794666 CTGCAATTAGGAAGGTTATATGG + Intergenic
1004681872 6:17903889-17903911 CAGTAATTTGGGAGGTGGTTAGG + Intronic
1005673200 6:28127716-28127738 TTGTAATTAGGGAGCTGGGATGG - Intronic
1005742893 6:28809345-28809367 CTGGAATGAGGGAATTGCTATGG + Intergenic
1013454458 6:110317665-110317687 CTGTCATTATGGAGGTGTTTAGG - Intronic
1014190868 6:118495264-118495286 ATGAAATTTGGGAGGTGCTGGGG + Intronic
1019512507 7:1424896-1424918 CAGGAATTAGGGATTTGCTAAGG - Intergenic
1024663231 7:51519778-51519800 CAGTAATGAGGCAGGTGCTTTGG + Intergenic
1027313515 7:76970263-76970285 CTGTTGTCAGGGAGGTGCCATGG + Intergenic
1030320071 7:108157157-108157179 CATAAATTTGGGAGGTGCTAAGG - Intronic
1032740337 7:134732307-134732329 ATGTATTTAGGGACCTGCTATGG + Intergenic
1033967904 7:147000720-147000742 CTATAATTAGTGCGGTGCTAGGG + Intronic
1034594642 7:152178360-152178382 CTATATTTAGGGAGGTTCGATGG + Intronic
1036653756 8:10662497-10662519 CTAAAGTTAGGGTGGTGCTAGGG + Intronic
1038389188 8:27179378-27179400 CTGTAAGTTGGGTGGGGCTAAGG + Intergenic
1041192967 8:55372085-55372107 GTGTAATTAGTCACGTGCTATGG + Intronic
1042664343 8:71189760-71189782 CTGTAAACAAGGAAGTGCTAGGG + Intergenic
1043773374 8:84233455-84233477 CTGGAATGAGTGAGGTGCTTTGG - Intronic
1050052942 9:1622311-1622333 ATGAAATTTGGGAGGGGCTAGGG - Intergenic
1050124852 9:2346443-2346465 CTATTATTAGGTAGGTGATACGG + Intergenic
1052972077 9:34382684-34382706 CTGTAGTTTGGGAGGTGGTGGGG + Intronic
1057746784 9:97758739-97758761 CTGTCATTTGGGAGTTGCTTTGG + Intergenic
1058927093 9:109677307-109677329 GTGAAATTAGGTTGGTGCTAGGG + Intronic
1059569997 9:115424447-115424469 ATGTTATTTGGGAGGTGCCAGGG - Intergenic
1061008270 9:127940775-127940797 CTGTCTTTAGGGAGGTGATAAGG - Exonic
1061723257 9:132566817-132566839 CTGTGATGAGGGAGGTGGGAAGG - Intronic
1187009428 X:15264993-15265015 TTGTAATTACACAGGTGCTAAGG - Intronic
1187140880 X:16592476-16592498 CTGGATCTAGGGAGGTGCTGTGG - Intronic
1187663095 X:21572829-21572851 ATGAAATTTGGGAGGGGCTAAGG - Intronic
1188041820 X:25377220-25377242 ATGAAATTTGGGAGGCGCTAGGG + Intergenic
1194078206 X:89423963-89423985 CTGCAATTAGGCAATTGCTATGG - Intergenic
1195868360 X:109458115-109458137 CTGTAATATAGGAGGTACTAGGG - Intronic
1200009144 X:153108377-153108399 TTGGAATAAGGGAGGTTCTATGG + Intergenic
1200030456 X:153291545-153291567 TTGGAATAAGGGAGGTTCTATGG - Intergenic
1200430853 Y:3079509-3079531 CTGCAATTAGGCAATTGCTATGG - Intergenic