ID: 1091481647

View in Genome Browser
Species Human (GRCh38)
Location 12:838554-838576
Sequence ATGGACACACACCACCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 7, 3: 128, 4: 534}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091481641_1091481647 3 Left 1091481641 12:838528-838550 CCTCAGCCTCCTGAGTATCTGGG 0: 1294
1: 99205
2: 205259
3: 239367
4: 154863
Right 1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG 0: 1
1: 0
2: 7
3: 128
4: 534
1091481645_1091481647 -6 Left 1091481645 12:838537-838559 CCTGAGTATCTGGGACCATGGAC 0: 2
1: 5
2: 131
3: 1937
4: 19706
Right 1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG 0: 1
1: 0
2: 7
3: 128
4: 534
1091481638_1091481647 7 Left 1091481638 12:838524-838546 CCCGCCTCAGCCTCCTGAGTATC 0: 910
1: 83004
2: 182459
3: 214078
4: 146346
Right 1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG 0: 1
1: 0
2: 7
3: 128
4: 534
1091481643_1091481647 -3 Left 1091481643 12:838534-838556 CCTCCTGAGTATCTGGGACCATG 0: 3
1: 88
2: 1143
3: 12706
4: 75317
Right 1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG 0: 1
1: 0
2: 7
3: 128
4: 534
1091481637_1091481647 26 Left 1091481637 12:838505-838527 CCTGGGCTCAAGTGATTCTCCCG 0: 110
1: 4531
2: 64130
3: 172090
4: 262634
Right 1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG 0: 1
1: 0
2: 7
3: 128
4: 534
1091481639_1091481647 6 Left 1091481639 12:838525-838547 CCGCCTCAGCCTCCTGAGTATCT 0: 298
1: 14230
2: 28713
3: 41536
4: 38218
Right 1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG 0: 1
1: 0
2: 7
3: 128
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091481647 Original CRISPR ATGGACACACACCACCATGC TGG Intronic
900163899 1:1237121-1237143 ATGGCCACACTGCACCACGCTGG + Intergenic
900209298 1:1445856-1445878 ACAGGCACCCACCACCATGCCGG - Intergenic
900240263 1:1613589-1613611 ACAGACATGCACCACCATGCCGG - Intergenic
900242424 1:1623453-1623475 ATGGACCCAGACCCCCAGGCGGG + Exonic
901220742 1:7582374-7582396 ATGGACACACCCAAGGATGCAGG - Intronic
901277553 1:8004471-8004493 AGGAAAACACACCACCATTCAGG + Intronic
901399395 1:9005662-9005684 ACAGGCACACGCCACCATGCCGG - Intronic
901475191 1:9484701-9484723 ATAGGCGCACACCACCATGCTGG - Intergenic
901531987 1:9859425-9859447 ATGAACTCCCACCAGCATGCTGG + Intronic
902109972 1:14070025-14070047 ACAGGCACACACCACCACGCTGG - Intergenic
902354452 1:15887115-15887137 ACAGCCACACACCACCACGCTGG + Intronic
902631583 1:17707753-17707775 ACAGGCACCCACCACCATGCCGG + Intergenic
902907868 1:19572371-19572393 ACAGGCACACACCACCATGCTGG + Intergenic
902928186 1:19711628-19711650 ACAGACACACACCACCATGCTGG + Intronic
903858013 1:26348417-26348439 ACAGGCACACACCACCATGCTGG - Intronic
904560410 1:31393397-31393419 ACAGGCGCACACCACCATGCTGG - Intergenic
905541920 1:38766707-38766729 ATCGGCACATGCCACCATGCTGG + Intergenic
905608158 1:39323061-39323083 ACAGGCACACACCACCGTGCTGG - Intronic
905848012 1:41249983-41250005 ACAGGCACGCACCACCATGCCGG + Intergenic
905991129 1:42337655-42337677 AAGGATGCACACCACCCTGCCGG - Intergenic
906724941 1:48037302-48037324 AGGGCCTCACACCTCCATGCAGG - Intergenic
907211701 1:52829288-52829310 ATAGGCGCACACCACCACGCTGG - Intergenic
908233664 1:62130190-62130212 ACAGGCACACACCACCATGCCGG - Intronic
908649437 1:66315595-66315617 ATAGGCACACGCCACCACGCCGG + Intronic
908831474 1:68183040-68183062 ACAGGCACACGCCACCATGCTGG + Intronic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
909733672 1:78929371-78929393 AAAGAAACATACCACCATGCTGG - Intronic
909920972 1:81379656-81379678 ACGGACAGACGCCAGCATGCAGG - Intronic
911394939 1:97293804-97293826 ACAGACTCACACCACCATGCTGG - Intronic
912780494 1:112542611-112542633 ACAGGCACACACCACCATGCTGG - Intronic
914224061 1:145705890-145705912 ACAGACACATGCCACCATGCAGG + Intronic
914357511 1:146899414-146899436 ACAGGCACCCACCACCATGCTGG - Intergenic
914413629 1:147456780-147456802 ATAGGCATACACCACCATGCTGG - Intergenic
914933252 1:151953533-151953555 TTGGACACTCACCACCAGACTGG + Intergenic
915020479 1:152774718-152774740 ATGGACAAACCCCATAATGCAGG + Intronic
915207390 1:154280267-154280289 ATGCACACACACAACTGTGCTGG + Intergenic
915450035 1:155998424-155998446 ACAGGCACCCACCACCATGCCGG + Intronic
918574346 1:186038299-186038321 ATGGATATAAACCACCATGTGGG - Intronic
919119532 1:193321827-193321849 ACAGGCACACACCACCATGCTGG - Intergenic
919274308 1:195392955-195392977 ACAGGCACACACCACCATGCCGG + Intergenic
919743350 1:200993606-200993628 ATGGGCACACACCACCACACCGG - Intronic
919765733 1:201126265-201126287 ATAGCTACACACCACCATGCTGG + Intronic
919842175 1:201617582-201617604 AAGGACACACACCACCACACTGG - Intergenic
920204252 1:204280354-204280376 ATGCACACACACTCCCAGGCTGG + Intronic
920865669 1:209751286-209751308 ATAGGCACACGCCACCATGCTGG - Intergenic
921347246 1:214199064-214199086 ACGGGCACGCACCACCATGCTGG - Intergenic
922553308 1:226513525-226513547 ATAGGCGCACACCACCATGCTGG + Intergenic
922583382 1:226715473-226715495 ATCAACACACACAACCATCCTGG + Intronic
922943660 1:229491634-229491656 ACAGGCACACGCCACCATGCTGG - Intronic
923097810 1:230789329-230789351 ATAGGCATGCACCACCATGCTGG - Intronic
923355201 1:233148170-233148192 ATGAGCACACACCAGCAAGCGGG + Intronic
924284091 1:242467728-242467750 ATGCACACACACCACCTGGTGGG - Intronic
924318269 1:242821178-242821200 ACGGGCACAAGCCACCATGCAGG - Intergenic
1063385379 10:5613308-5613330 ACAGGCACACACCACCATGCTGG - Intergenic
1063795825 10:9513002-9513024 ACAGGCACGCACCACCATGCTGG - Intergenic
1064227675 10:13501703-13501725 ACAGGCACACACCACCATGCTGG - Intronic
1064467317 10:15597234-15597256 AAGGTCACACACCACCATCCTGG + Exonic
1065007914 10:21396549-21396571 ACAGGCACCCACCACCATGCCGG + Intergenic
1065285820 10:24186746-24186768 ACAGGCACTCACCACCATGCTGG - Intronic
1065432750 10:25675976-25675998 ACAGATGCACACCACCATGCTGG + Intergenic
1065576576 10:27126298-27126320 ACAGGTACACACCACCATGCCGG - Intronic
1065896481 10:30167272-30167294 ACAGGCACACACCACCACGCCGG + Intergenic
1066748183 10:38623673-38623695 ACAGACATGCACCACCATGCCGG - Intergenic
1067315352 10:45156062-45156084 AGGTACACAGACCACCATGGTGG - Intergenic
1067397495 10:45935686-45935708 ATAGGCACGCACCACCTTGCCGG - Intergenic
1068552893 10:58426221-58426243 ATGGACACTCAACACCAGCCTGG - Intergenic
1069004816 10:63305606-63305628 ACGGGCAAGCACCACCATGCTGG + Intronic
1069638976 10:69942987-69943009 ACAGGCACCCACCACCATGCCGG + Intronic
1069647413 10:70012215-70012237 ATAGGTACACACCACCATGCTGG + Intergenic
1069932845 10:71894433-71894455 ACAGGCACACACCACCAGGCTGG + Intergenic
1070171571 10:73937049-73937071 ATAGACACACACCACCACACTGG + Intergenic
1070236204 10:74629169-74629191 ACAGGCACACGCCACCATGCTGG + Intronic
1072211168 10:93248331-93248353 ATGGGCACGCACCACCACGCTGG - Intergenic
1072736430 10:97882492-97882514 AAGGAGACACACCACCAACCTGG - Intronic
1072761400 10:98059968-98059990 ACAGGCATACACCACCATGCTGG - Intergenic
1072907420 10:99467297-99467319 ATGGACACAAACCTCCAGGTGGG + Intergenic
1073032033 10:100534333-100534355 AAAGGCACACACCACCATGCCGG - Intronic
1073157362 10:101358235-101358257 ACAGGCACACACCACTATGCTGG + Intronic
1073252345 10:102128754-102128776 ACAGGCACCCACCACCATGCCGG + Intergenic
1074378706 10:112960827-112960849 ATAGGCGCACACCACCATGCTGG + Intronic
1074925475 10:118065597-118065619 ACAAACACACACCACCATGCTGG + Intergenic
1075499715 10:122961873-122961895 ACAGGCACACACCACCATGCCGG - Intronic
1075684091 10:124351964-124351986 ATGCACACACACCCCAAGGCGGG + Intergenic
1075757651 10:124827299-124827321 ACAGGCACACACCACCATGCTGG + Intronic
1076754411 10:132561774-132561796 ATTTACACACACCACCCTGCTGG + Intronic
1077197503 11:1288725-1288747 CTGGACCCACATCACCATCCCGG - Exonic
1077806123 11:5592773-5592795 AAGGGCATACACCACCGTGCCGG - Intronic
1078713366 11:13816446-13816468 AAAAGCACACACCACCATGCTGG - Intergenic
1078763313 11:14269464-14269486 ATAGGCACGCACCACCATGCTGG - Intergenic
1078832487 11:14991237-14991259 ATGGACACCCCCCGCGATGCGGG - Intronic
1079056367 11:17209301-17209323 ATGCACACACACTTCCAGGCAGG + Intronic
1079075188 11:17381101-17381123 AAGGCCTCAGACCACCATGCAGG - Intergenic
1081040651 11:38206275-38206297 ATAGGCACATGCCACCATGCTGG - Intergenic
1081472166 11:43384511-43384533 ATAGGCACACACCACCATGCTGG - Intronic
1081540030 11:44027771-44027793 ATGCATACACACAAACATGCAGG - Intergenic
1081898991 11:46611567-46611589 ACAGATGCACACCACCATGCTGG - Intronic
1083578688 11:63811418-63811440 ACAGGCACACACCACCATGCCGG + Intergenic
1083670718 11:64298538-64298560 ACAGGCACACACCACCACGCAGG - Intronic
1084755796 11:71237889-71237911 ATGAACACACACCACTACCCAGG + Intronic
1085758990 11:79225618-79225640 AGAGGCATACACCACCATGCTGG + Intronic
1085796977 11:79550635-79550657 ATGGACAGGGACCACCATTCTGG - Intergenic
1085836281 11:79960391-79960413 ATGCACACACACCATCAGACTGG - Intergenic
1087420662 11:97921652-97921674 ACAGGCGCACACCACCATGCCGG - Intergenic
1087747327 11:101964159-101964181 ATAGGCACGCACCACCATGCCGG - Intronic
1088073391 11:105816872-105816894 ATGGGCATGCACCACCATCCAGG - Intronic
1088218385 11:107539455-107539477 ATAGACGCCCACCACCATGCCGG - Intronic
1089183885 11:116601839-116601861 ATGGGCTCACACATCCATGCTGG - Intergenic
1089733927 11:120536765-120536787 ATGGACCCACACCAACAAGATGG + Intronic
1089842915 11:121434325-121434347 ACAGGCACACACCACCATGCTGG - Intergenic
1089965553 11:122652333-122652355 ACAGGCACACACCACCATGCTGG + Intergenic
1090930673 11:131295540-131295562 ACAGGCACCCACCACCATGCCGG + Intergenic
1090966853 11:131606192-131606214 TCAGGCACACACCACCATGCTGG + Intronic
1091321865 11:134657426-134657448 ATGCACACACACCCCGCTGCAGG - Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1091535535 12:1404996-1405018 AGAGGCACACACCACCACGCTGG - Intronic
1091789753 12:3265009-3265031 CTGGACCAACACCACCAGGCTGG - Intronic
1092139694 12:6174758-6174780 ACAGGCACACACCACCATGCTGG - Intergenic
1092368586 12:7897691-7897713 ATAGGCACACACCATTATGCCGG + Intergenic
1092855972 12:12674068-12674090 ACAGGCACTCACCACCATGCTGG - Intronic
1093470614 12:19497612-19497634 ACCGGCACACACTACCATGCCGG + Intronic
1094283770 12:28769586-28769608 ACAGGCACACACCACCATGCTGG + Intergenic
1094552654 12:31467496-31467518 ACAGGCACACGCCACCATGCTGG - Intronic
1094614092 12:32020834-32020856 ATAGGCACACACCACCAGGCTGG - Intergenic
1094638160 12:32247113-32247135 ACAGGCACACACCACCATACCGG - Intronic
1094811964 12:34147340-34147362 ATAGGCGCCCACCACCATGCCGG + Intergenic
1095216876 12:39559228-39559250 ACAGGCACACACCACCACGCTGG - Intronic
1095457508 12:42404385-42404407 ATAGGCACCCACCACCATGTTGG - Intronic
1096899302 12:54858218-54858240 AGGGACACACTCTACCATTCGGG - Exonic
1096976374 12:55701283-55701305 ATACACACACACCCCTATGCCGG + Intronic
1097052586 12:56232305-56232327 ACAGGCACACACCACCACGCCGG + Intronic
1098377798 12:69836184-69836206 ATGGACCCACACCGGCATGCCGG - Intronic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1100990439 12:100245406-100245428 ACAGGCACCCACCACCATGCTGG + Intronic
1101104021 12:101422507-101422529 ACAGACACACACCACCACGCCGG - Intergenic
1102056919 12:109903324-109903346 CTGGAAAAACATCACCATGCAGG - Intronic
1102335704 12:112077505-112077527 ACGGGCACACACCACCACACTGG - Intronic
1102361301 12:112290177-112290199 ACAGGCACACACCACCTTGCTGG - Intronic
1102370535 12:112379550-112379572 ACAGGCATACACCACCATGCCGG - Intronic
1102420259 12:112797828-112797850 AAGTACAGACACGACCATGCTGG + Intronic
1102473195 12:113171755-113171777 ATGGACACACACCAAAATGACGG + Intronic
1103682254 12:122703330-122703352 ACAGACACACACCTCCTTGCTGG - Exonic
1104041787 12:125135457-125135479 AAGGTCACACAGCATCATGCAGG + Intronic
1105448967 13:20481767-20481789 ATAGGCGCCCACCACCATGCCGG - Intronic
1105471576 13:20700044-20700066 ATAGACACGTGCCACCATGCTGG - Intergenic
1106089175 13:26572692-26572714 ATAGGCACGTACCACCATGCTGG + Intronic
1107025880 13:35800856-35800878 ACAGGCACCCACCACCATGCTGG + Intronic
1107354604 13:39553574-39553596 ACAGGCACAGACCACCATGCTGG - Intronic
1107375262 13:39797605-39797627 ATGAAAACTCACCATCATGCAGG + Intergenic
1107481345 13:40788899-40788921 ACAGACACGCACCACCACGCTGG + Intergenic
1108415577 13:50195227-50195249 ACGGGCACATGCCACCATGCTGG + Intronic
1108621825 13:52192419-52192441 ACAGGCACATACCACCATGCTGG - Intergenic
1108995762 13:56732387-56732409 ACGGGCACATACCACCACGCAGG - Intergenic
1109910752 13:68907149-68907171 GGAGAGACACACCACCATGCTGG - Intergenic
1111421155 13:88012735-88012757 ACAGGCACCCACCACCATGCCGG - Intergenic
1111855533 13:93632465-93632487 ACAGGTACACACCACCATGCTGG - Intronic
1113115360 13:106869267-106869289 ACAGGCTCACACCACCATGCCGG - Intergenic
1113156099 13:107323965-107323987 ACAGGCACACATCACCATGCCGG - Intronic
1113639055 13:111944286-111944308 GAGGACCCACACCCCCATGCAGG + Intergenic
1114271931 14:21105588-21105610 ACGGGCACCCACCACCATGCCGG - Intergenic
1115233125 14:31182707-31182729 ACAGGCGCACACCACCATGCTGG - Intronic
1115343699 14:32319310-32319332 ATAGGCATTCACCACCATGCTGG - Intergenic
1115588470 14:34839395-34839417 ACAGGCACACACTACCATGCCGG - Intronic
1116670388 14:47833875-47833897 ACACACACACACCACCACGCTGG + Intergenic
1116879754 14:50153752-50153774 ATAGACGCCCGCCACCATGCTGG + Intronic
1117400290 14:55352816-55352838 ATGAAGACTCACCACCATCCAGG + Exonic
1118072890 14:62265092-62265114 ACAGGCACACACCACCACGCCGG + Intergenic
1118155126 14:63232836-63232858 ATAGGCATGCACCACCATGCTGG + Intronic
1119248728 14:73134267-73134289 ACAGGCCCACACCACCATGCCGG + Intergenic
1119635092 14:76267222-76267244 ACAGGCACGCACCACCATGCCGG + Intergenic
1121198683 14:92098443-92098465 ACAGGTACACACCACCATGCTGG - Intronic
1121551255 14:94803042-94803064 ACAGGCACACACCACCATGCTGG - Intergenic
1122481833 14:102052273-102052295 ACAGACACACACCACCATGTCGG + Intergenic
1122511038 14:102267802-102267824 AAAGACACAGCCCACCATGCTGG + Intronic
1122639288 14:103148226-103148248 ACAGGTACACACCACCATGCTGG - Intergenic
1122934464 14:104949574-104949596 CTGGACATCCACCTCCATGCTGG + Exonic
1122935166 14:104952544-104952566 CTGGACATCCACCTCCATGCTGG + Exonic
1123214320 14:106792354-106792376 AAGGAAACACACCACAATGTGGG - Intergenic
1202889400 14_KI270722v1_random:141547-141569 ACAGGCACCCACCACCATGCTGG + Intergenic
1123725807 15:23100404-23100426 ATGGACACAGAGCAGCATGATGG - Intergenic
1124074395 15:26430544-26430566 ACAGGCACACACCACCATGCCGG + Intergenic
1124385911 15:29207981-29208003 AGGGACACAAACCCCCACGCTGG + Intronic
1124431893 15:29615295-29615317 ACAGGCACACACCACCATGCTGG + Intergenic
1125550564 15:40541472-40541494 ATGGGCACACACCACCAACCCGG + Intronic
1125804361 15:42479990-42480012 ATGGGCACATGCCACCACGCTGG + Intronic
1126332331 15:47546700-47546722 ATGTACACGCCCCACCATGGTGG - Intronic
1126621058 15:50640416-50640438 GTAGGCACATACCACCATGCCGG + Intronic
1127694335 15:61429708-61429730 ATAGGCGCACACTACCATGCCGG + Intergenic
1128104076 15:65029985-65030007 ACAGGCACACATCACCATGCTGG + Intergenic
1128318178 15:66674372-66674394 ACAGGCACACACCATCATGCCGG - Intronic
1128356689 15:66932928-66932950 ATGGTCACACACACTCATGCAGG + Intergenic
1129393341 15:75231477-75231499 ACAGGCACACACTACCATGCCGG - Intergenic
1131237714 15:90711264-90711286 AGGGACACACCACGCCATGCAGG - Intergenic
1131505772 15:93017465-93017487 ACAGGCACACACCACCATGCCGG + Intronic
1134007305 16:10826810-10826832 ACAGGCGCACACCACCATGCCGG - Intergenic
1134298733 16:12970650-12970672 ATAGGCACACACCACCACACCGG + Intronic
1134379827 16:13713510-13713532 ATGCACACACACACACATGCAGG + Intergenic
1134680660 16:16122740-16122762 ACAGGCACACACCACCATGATGG - Intronic
1135255840 16:20940956-20940978 ACAGACACAGGCCACCATGCTGG - Intronic
1135270610 16:21066507-21066529 ATGGGCAAACACCACCACACTGG + Intronic
1135583556 16:23648997-23649019 ACAGGCGCACACCACCATGCTGG + Intronic
1135696643 16:24593574-24593596 ACAGGCACACACCACCTTGCCGG + Intergenic
1136493391 16:30625648-30625670 ATAGGCACCCGCCACCATGCTGG - Intergenic
1136665315 16:31806268-31806290 ATGGAGACAGGCCACCATGGAGG - Intergenic
1136686776 16:31999702-31999724 ATGGGCGCATGCCACCATGCCGG + Intergenic
1136734579 16:32453628-32453650 ACAGACATGCACCACCATGCTGG + Intergenic
1136787387 16:32943243-32943265 ATGGGCGCACGCCACCATGCCGG + Intergenic
1137265258 16:46863698-46863720 ATTGGCACACACCATCATGCCGG - Intergenic
1137289292 16:47040950-47040972 ATAGGTGCACACCACCATGCCGG - Intergenic
1137414389 16:48260455-48260477 ACAGACACACACCAGCATGCTGG - Intronic
1137623831 16:49895089-49895111 ATAGGCACATGCCACCATGCTGG - Intergenic
1137637415 16:49998959-49998981 ATGGACACACGTCATCACGCTGG - Intergenic
1137665641 16:50247330-50247352 ATGGACCCAACTCACCATGCAGG - Intronic
1137975787 16:53030697-53030719 ACAGGCACGCACCACCATGCAGG - Intergenic
1139495203 16:67311754-67311776 AAAGACACACACCTACATGCAGG - Intronic
1139845013 16:69914613-69914635 ACAGGCACGCACCACCATGCGGG - Intronic
1140215749 16:73006479-73006501 ACAGGCACACACCACCATGCTGG - Intronic
1140227488 16:73090249-73090271 ATGGGCGCATGCCACCATGCTGG - Intergenic
1140343059 16:74184430-74184452 ACAGGCACCCACCACCATGCTGG - Intergenic
1141346522 16:83251639-83251661 ATGGCCACAGACCATCCTGCAGG - Intronic
1141425467 16:83941905-83941927 ACAGCCACACACCACCATACTGG + Intronic
1141693571 16:85609794-85609816 ACAGGCACACGCCACCATGCAGG + Intergenic
1141954670 16:87362700-87362722 ACAGGCACACAACACCATGCTGG + Intronic
1203018500 16_KI270728v1_random:375972-375994 ACAGACATACACCACCATGCTGG - Intergenic
1203036835 16_KI270728v1_random:649130-649152 ACAGACATACACCACCATGCTGG - Intergenic
1142588901 17:992221-992243 ATGGGCATGTACCACCATGCCGG - Intergenic
1143087313 17:4425822-4425844 ACAGGCACACGCCACCATGCTGG - Intergenic
1143566561 17:7725229-7725251 ACAGGCACACGCCACCATGCTGG + Intronic
1143603424 17:7965104-7965126 ACAGGCACGCACCACCATGCCGG + Intergenic
1143994058 17:10991544-10991566 ACAGATGCACACCACCATGCCGG - Intergenic
1144590536 17:16520109-16520131 ATAGGCACACACCACCACACTGG + Intergenic
1145003643 17:19322596-19322618 ACAGGCACACACCCCCATGCTGG - Intronic
1145027963 17:19483336-19483358 ACAGGCACATACCACCATGCTGG + Intergenic
1146453234 17:32991100-32991122 CTGCACACCCACCACCATCCTGG + Intronic
1146769630 17:35556641-35556663 ACAGGCACACACCACCATGTCGG - Intronic
1146969510 17:37061388-37061410 ACAGGCACGCACCACCATGCTGG + Intergenic
1147402385 17:40188800-40188822 ATGGACAACCAACACCAAGCAGG - Intronic
1147980387 17:44270426-44270448 ATAGGCGCCCACCACCATGCCGG + Intergenic
1147982463 17:44282938-44282960 ACAGCCACACACCACCATGCTGG + Intergenic
1148117150 17:45182826-45182848 ATGCACACACACCCCGGTGCAGG - Intergenic
1148586394 17:48784261-48784283 GCAGGCACACACCACCATGCCGG - Intronic
1148720806 17:49751800-49751822 ACAGACACCCGCCACCATGCCGG - Intronic
1148916103 17:50980344-50980366 ATAGGCGCACACCACCATGCCGG + Intronic
1149535410 17:57429802-57429824 AAGGACACACACCAGAATGCTGG - Intronic
1149922615 17:60673736-60673758 ACAGGCACACACCAACATGCTGG - Intergenic
1150051612 17:61969741-61969763 ATAGGCACACATCACCATACCGG + Intronic
1150368788 17:64616937-64616959 ACAGGCACACACCACCATGCCGG - Intronic
1151246425 17:72798553-72798575 ACAGGCACCCACCACCATGCAGG + Intronic
1151653534 17:75484894-75484916 ACAGGCACACACCACCATGTCGG - Intronic
1151950503 17:77350929-77350951 AGGCACACACACCCCCCTGCAGG - Intronic
1152333745 17:79688357-79688379 ACAGGCACACACCACCATGACGG + Intergenic
1153182390 18:2449424-2449446 ACAGGCACCCACCACCATGCCGG - Intergenic
1153896309 18:9564983-9565005 ACAGGCACACACCACCATGCTGG + Intronic
1154124833 18:11681880-11681902 ACGGGCGCACGCCACCATGCTGG - Intergenic
1154205496 18:12333503-12333525 ACAGATGCACACCACCATGCCGG + Intronic
1154271728 18:12926115-12926137 ATAGACACACACCCCGCTGCTGG + Intronic
1154275575 18:12956923-12956945 ACAGGCACCCACCACCATGCCGG - Intronic
1155008471 18:21751054-21751076 ACAGGCACACACCACCATGGTGG - Intronic
1155133255 18:22960402-22960424 ACAGGCACTCACCACCATGCTGG - Intronic
1155293816 18:24367118-24367140 ATGGGCTCAAACCACCGTGCTGG - Intronic
1155569019 18:27169746-27169768 ACAGGCACCCACCACCATGCCGG + Intronic
1155970272 18:32076455-32076477 ATAGACATGCACTACCATGCTGG + Intergenic
1156773600 18:40760379-40760401 ACGGGCAGTCACCACCATGCCGG - Intergenic
1158041634 18:53101529-53101551 CTAGTCACACACCAGCATGCTGG + Intronic
1158457340 18:57619827-57619849 ACAGGCACGCACCACCATGCTGG + Intronic
1158787230 18:60729440-60729462 ATGCACACACACAAAGATGCAGG - Intergenic
1159139569 18:64376840-64376862 ACAGGCACACACCACCATGTTGG + Intergenic
1159496959 18:69219382-69219404 ACAGGCACACACCACCATGCCGG + Intergenic
1159504194 18:69313455-69313477 ATGGACACGAGCCACCATGCTGG - Intergenic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1160768363 19:819116-819138 ACAGGCACACACCACCACGCTGG + Intronic
1161175092 19:2837298-2837320 ACGGGCATGCACCACCATGCCGG - Intergenic
1161397170 19:4050954-4050976 ATAGGCGCCCACCACCATGCCGG - Intronic
1161809298 19:6462682-6462704 ATGGATACATACCACCAGGGTGG - Intronic
1162241138 19:9355302-9355324 ACAGGCACACACCACCATGCTGG - Intronic
1162244978 19:9392299-9392321 ACAGGCACACACCACCATGCTGG - Intergenic
1162401576 19:10449950-10449972 ACAGACACATGCCACCATGCTGG - Intronic
1162482469 19:10936265-10936287 ACAGACACACACCACCACACCGG + Intergenic
1162575519 19:11496723-11496745 AAAGGCATACACCACCATGCCGG - Intronic
1163169642 19:15522001-15522023 ATAGGCACCCGCCACCATGCTGG - Intronic
1163285902 19:16347500-16347522 ATAGGCACCCACCACCACGCCGG - Intergenic
1163355854 19:16810294-16810316 ACAGGCACATACCACCATGCAGG - Intronic
1163877705 19:19888203-19888225 ATAGGCACCCACCACCATGCTGG + Intronic
1163987492 19:20967447-20967469 ATGGACACAGACCACTGTGGAGG + Intergenic
1164126138 19:22321009-22321031 ACAGGCACACACCACCATGCTGG + Intergenic
1164175417 19:22769622-22769644 ACAGGCACCCACCACCATGCCGG - Intronic
1164237737 19:23351840-23351862 CTGAACACACACCCCCATACAGG + Intronic
1164551608 19:29216980-29217002 AAGGACCCAGACCACCAAGCAGG - Intergenic
1165438128 19:35807915-35807937 ACAGGCACCCACCACCATGCCGG + Intronic
1165670241 19:37672258-37672280 ACAGGCATACACCACCATGCCGG - Intronic
1165699825 19:37929117-37929139 AGGGTCACATATCACCATGCTGG - Intronic
1165880702 19:39040849-39040871 ATAGGCACCCACCACCGTGCTGG + Intergenic
1165950116 19:39469584-39469606 AGAGACAGACACCACCAGGCAGG - Intronic
1166148792 19:40855799-40855821 ATAGACGTGCACCACCATGCTGG + Intronic
1166172846 19:41044026-41044048 ACAGGCACGCACCACCATGCCGG + Intergenic
1166666584 19:44683931-44683953 AGGCAGACACCCCACCATGCGGG + Exonic
1167061578 19:47151289-47151311 ACAGGCACTCACCACCATGCTGG + Intronic
1167134125 19:47607253-47607275 ACAAGCACACACCACCATGCTGG + Intergenic
1167459510 19:49616986-49617008 ACAGGCACACGCCACCATGCTGG - Intronic
1167539070 19:50073920-50073942 ACAGGCACACACCACCATGCTGG - Intergenic
1167919806 19:52773728-52773750 ACAGACATGCACCACCATGCCGG - Intronic
1168129552 19:54309321-54309343 ACAGGCACCCACCACCATGCCGG - Intronic
1168377475 19:55892561-55892583 ATAGGCGCACACCACCACGCCGG + Intronic
925097220 2:1216662-1216684 ATGGGAACCCACCAGCATGCTGG + Intronic
925532405 2:4878629-4878651 ATGGGCAAACACCATCATGGAGG + Intergenic
926024008 2:9524015-9524037 ACAGGCACACACCACCATGCCGG + Intronic
926172619 2:10561854-10561876 AGGGACACAGGTCACCATGCTGG - Intergenic
926699407 2:15793270-15793292 CTGCCTACACACCACCATGCTGG + Intergenic
927497990 2:23563480-23563502 ATGCACACACACACGCATGCAGG - Intronic
927872531 2:26632614-26632636 ATGGATGCGCGCCACCATGCTGG - Intronic
929037561 2:37709084-37709106 ATGCACACACACTGACATGCGGG - Intronic
929081990 2:38130173-38130195 GTGGCCACTCACCATCATGCAGG + Intergenic
930190782 2:48456908-48456930 ACAGGCACATACCACCATGCTGG - Intronic
930848781 2:55935305-55935327 ACAGATACACACCATCATGCTGG - Intergenic
931310531 2:61075397-61075419 ACGGGCATGCACCACCATGCCGG + Intronic
931695887 2:64870281-64870303 ATAGACATGCACCACCACGCTGG + Intergenic
932261679 2:70332486-70332508 ACAGGCACCCACCACCATGCTGG + Intergenic
933755931 2:85638473-85638495 ATAGATACACACCACCACACCGG + Intronic
933997350 2:87679583-87679605 ATTTACTCACACCACCCTGCAGG + Intergenic
934311148 2:91865821-91865843 ATAGACATGCACCACCATGCCGG - Intergenic
934973682 2:98785388-98785410 ATAGGCACGCACCACCATGCTGG + Intergenic
935244330 2:101205223-101205245 ACAGGCACACACCACCATGCCGG + Intronic
935401815 2:102667931-102667953 ACAGACATGCACCACCATGCCGG - Intronic
936296500 2:111271327-111271349 ATTTACTCACACCACCCTGCAGG - Intergenic
937390777 2:121484488-121484510 GGGCACAAACACCACCATGCAGG + Intronic
938050828 2:128169227-128169249 ACAGACACATGCCACCATGCCGG - Intronic
938437937 2:131298884-131298906 ATGGAGCCACACCGCCCTGCCGG + Intronic
940350873 2:152686213-152686235 ACAGATACACACCACTATGCTGG + Intronic
940635770 2:156294681-156294703 ACAGACACACACCACCATGCTGG + Intergenic
941100938 2:161294515-161294537 ACAGGCACGCACCACCATGCCGG + Intergenic
941125090 2:161575673-161575695 ATAGGCACATACCACCATGCTGG + Intronic
941448038 2:165626079-165626101 ATAGGCACCCACCACCATGCTGG - Intronic
941619164 2:167757314-167757336 CTGGACACCCACCATCATGGGGG - Intergenic
941828785 2:169930526-169930548 ATAGACACCCACCACCATGCTGG + Intronic
941962701 2:171269388-171269410 ATAGGCACACACCACCACACCGG - Intergenic
941963167 2:171274007-171274029 ATAGACACACACTACCATGCTGG + Intergenic
942343547 2:174976377-174976399 ACAGACGCCCACCACCATGCCGG + Intronic
942758117 2:179365628-179365650 ACAAGCACACACCACCATGCGGG - Intergenic
943173739 2:184440061-184440083 ATAGACATGCACCACCAAGCCGG + Intergenic
944267657 2:197746756-197746778 ACAGGCGCACACCACCATGCCGG - Intronic
944294435 2:198046695-198046717 ACAGGCACACACCACCATACCGG - Intronic
944670791 2:201992796-201992818 ATAGGCACCCACCACCATGCTGG - Intergenic
946219581 2:218215476-218215498 ATAGACATGCACCACCAAGCTGG - Intergenic
946642849 2:221802707-221802729 ACAGGCACACACCACCACGCAGG - Intergenic
947526684 2:230881246-230881268 ACAGGCGCACACCACCATGCCGG + Intergenic
947644874 2:231731115-231731137 ACAGGCACACACCACCACGCCGG - Intergenic
947747845 2:232518358-232518380 ACAGGCATACACCACCATGCCGG - Intergenic
948071292 2:235128919-235128941 ACAGGCACACACCATCATGCGGG + Intergenic
948316717 2:237032799-237032821 GTCTACACACACCACCATGTGGG + Intergenic
948623847 2:239254310-239254332 ATGGAAACAACCCACCATGTGGG + Intronic
948804060 2:240445569-240445591 GTGGCCAAACACCAGCATGCAGG + Intronic
948831716 2:240601530-240601552 AGGGACAAACAACACCAGGCCGG - Intronic
1168848563 20:961306-961328 ATGGACACACAGCTCCTTGCGGG - Intronic
1169330950 20:4715981-4716003 ACAGGCACACACCACCATGGTGG - Intergenic
1170047438 20:12100379-12100401 ACAGACACACACCACCACACTGG + Intergenic
1170081580 20:12482549-12482571 ACAGGCACCCACCACCATGCTGG - Intergenic
1170613721 20:17933395-17933417 AGGGGCACACTCCACCAAGCTGG - Intergenic
1170693807 20:18639030-18639052 ATGGAATCCCTCCACCATGCTGG - Intronic
1171343693 20:24449958-24449980 ACAGGCACACACCACCATGCCGG + Intergenic
1171500992 20:25593226-25593248 ACGGGCATACACCACCATGCCGG - Intergenic
1172346402 20:34204360-34204382 ATAGGCACACGCCACCATGCTGG + Intronic
1172884191 20:38220454-38220476 ACAGGCACGCACCACCATGCCGG + Intronic
1173364882 20:42376172-42376194 ATGGAAACGCTCCACCCTGCAGG + Intronic
1173388364 20:42609213-42609235 ACAGACACACATGACCATGCCGG + Intronic
1174323909 20:49763848-49763870 ACAGGCGCACACCACCATGCCGG + Intergenic
1174363337 20:50041852-50041874 ATAAGCACACACCACCTTGCCGG - Intergenic
1174663946 20:52239664-52239686 ACAGACACACAGCACCATGCTGG + Intergenic
1174946558 20:54992640-54992662 ATAGACACGAGCCACCATGCGGG - Intergenic
1175728117 20:61333287-61333309 ATGCACACACACCTGCATGGGGG + Intronic
1176516748 21:7789961-7789983 ATAGACATGCAGCACCATGCCGG + Intergenic
1176957133 21:15118584-15118606 ATAGGCACACGCCACCATGCTGG - Intergenic
1178256113 21:31053870-31053892 ACAGGCACACGCCACCATGCTGG - Intergenic
1178650776 21:34419973-34419995 ATAGACATGCAGCACCATGCCGG + Intronic
1179005278 21:37508427-37508449 ACAGACGCACATCACCATGCTGG + Intronic
1179678427 21:43000739-43000761 ACAGGCCCACACCACCATGCTGG - Intronic
1179910895 21:44448096-44448118 ACAGACACGCACTACCATGCAGG - Intergenic
1180220172 21:46353585-46353607 ATGCACACACACACACATGCTGG - Intronic
1180331531 22:11485235-11485257 ACAGGCACCCACCACCATGCTGG + Intergenic
1180537911 22:16411740-16411762 ACAGACATGCACCACCATGCCGG - Intergenic
1180652231 22:17387522-17387544 CTGGACACACGCCAGCAGGCTGG - Intronic
1180653108 22:17395484-17395506 ACAGGCACACGCCACCATGCTGG + Intronic
1180688693 22:17691502-17691524 ACAGGCACCCACCACCATGCTGG - Intronic
1181036310 22:20171442-20171464 GTGGACTCAGGCCACCATGCTGG - Intergenic
1181405586 22:22682483-22682505 ATGCACACACACCAGCACACAGG - Intergenic
1181587288 22:23860270-23860292 ACAGGCACACACCATCATGCTGG - Intronic
1181650198 22:24254864-24254886 ACGGGTACTCACCACCATGCAGG + Intergenic
1181694651 22:24587050-24587072 ATGGCCACACACCACTAAGCGGG + Intronic
1181707178 22:24655873-24655895 ACGGGTACTCACCACCATGCAGG - Intergenic
1182111161 22:27724760-27724782 ATGGACAGAGACCAAGATGCAGG - Intergenic
1182191484 22:28465480-28465502 ACAGGCACACACCACCACGCCGG - Intronic
1182386577 22:29947969-29947991 ATAACCACACACCACAATGCAGG - Intronic
1182514190 22:30843724-30843746 ACAGGCACACACCACCATGCTGG - Intronic
1182536692 22:31009029-31009051 ATAGGCACGCACCACCATGCCGG + Intergenic
1182837587 22:33356626-33356648 ACTGGCACACACCACCATGCTGG - Intronic
1183248294 22:36710653-36710675 ATAGGCATGCACCACCATGCTGG - Intergenic
1183531176 22:38354174-38354196 ACAGGCACACACCATCATGCCGG - Intronic
1183572614 22:38665320-38665342 ATAGGCACGCACCACCATGCTGG - Intronic
1183674812 22:39293230-39293252 ATAGGCGCACGCCACCATGCTGG - Intergenic
1183911703 22:41084446-41084468 ACAGGCACGCACCACCATGCAGG + Intergenic
1183937693 22:41272952-41272974 ATAGGTGCACACCACCATGCCGG + Intronic
1184331524 22:43830839-43830861 ATGGACCCACACCACAGTCCTGG + Intronic
1184769927 22:46590916-46590938 ACAGGCACCCACCACCATGCTGG - Intronic
1203267823 22_KI270734v1_random:28171-28193 ACAGGCACACATCACCATGCTGG - Intergenic
949182588 3:1152278-1152300 ACAGGCACGCACCACCATGCTGG + Intronic
950285754 3:11743473-11743495 ATAGGCACCCACCACCATGCCGG + Intergenic
950466084 3:13154405-13154427 ATGGAAACACACCAGGAAGCTGG + Intergenic
950963952 3:17133082-17133104 ACAGGCACCCACCACCATGCTGG - Intergenic
951600348 3:24367455-24367477 ATGGATACATACCAACATTCAGG + Intronic
953851117 3:46466096-46466118 ATAGGCATACACCACCATGCTGG - Intronic
954027715 3:47796208-47796230 ACGGGCGCACACCACCACGCCGG - Intergenic
954347281 3:50010759-50010781 ACAGGAACACACCACCATGCTGG - Intronic
954398558 3:50306742-50306764 ACAGGCACCCACCACCATGCCGG - Intronic
954742929 3:52769075-52769097 ATGGGTACACACCACCACGCCGG - Intronic
955744423 3:62125934-62125956 AAGGACAAAAATCACCATGCGGG + Intronic
957091134 3:75731416-75731438 ACAGGCACCCACCACCATGCTGG - Intronic
958044166 3:88263519-88263541 TTTGACTCACACCACCGTGCCGG - Intergenic
959402260 3:105917401-105917423 ACAGACACACGCCCCCATGCTGG + Intergenic
961911272 3:130318921-130318943 ACAGGCGCACACCACCATGCAGG - Intergenic
962070065 3:132024223-132024245 ACAGGCACACACCACCACGCCGG + Intronic
962361708 3:134748655-134748677 CTGGACACACACCAGCATACAGG - Intronic
964434996 3:156642020-156642042 ACAGGCACACTCCACCATGCTGG - Intergenic
965510312 3:169562002-169562024 ATAGGCACACACCACCATGCCGG - Intronic
966605967 3:181822037-181822059 ACAGGCACATACCACCATGCCGG - Intergenic
968076858 3:195820707-195820729 ATGGCCACACAACACGATGGAGG - Intergenic
968286347 3:197511083-197511105 ATAGGCACCCACCACCATGCCGG - Exonic
969562160 4:7956189-7956211 CTGAGCACACACCATCATGCTGG - Intergenic
971157114 4:24095257-24095279 ACAGGCACACACTACCATGCCGG + Intergenic
971387079 4:26150729-26150751 ATGGACACAGAACACAAAGCAGG + Intergenic
971411997 4:26383999-26384021 AGGGGCTCACACCACCATGCCGG + Intronic
971612232 4:28740467-28740489 ACAGGCACACACCACCATGCTGG + Intergenic
971890926 4:32521165-32521187 ACAGGCACCCACCACCATGCCGG + Intergenic
973700308 4:53531021-53531043 ATAGGCACACACCACCACACCGG - Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
975282533 4:72578097-72578119 ATAGCCACACGCCACCATGTCGG - Intergenic
975837154 4:78435595-78435617 ATAGTTGCACACCACCATGCTGG - Intronic
978129151 4:105173389-105173411 ACGGGAGCACACCACCATGCCGG - Intronic
978775757 4:112505514-112505536 ACAGGCATACACCACCATGCTGG + Intergenic
978894331 4:113869051-113869073 ACAGGCACACACCACCGTGCCGG - Intergenic
979274085 4:118795348-118795370 ACAGGCACACACCACCATACCGG + Intronic
979586280 4:122422264-122422286 ATAGGTGCACACCACCATGCTGG + Intronic
979620267 4:122790971-122790993 ACAGGCACGCACCACCATGCTGG + Intergenic
979668982 4:123342587-123342609 ACAGACACATGCCACCATGCTGG - Intergenic
979669592 4:123348024-123348046 ATAGGCACACACCACCACACCGG - Intergenic
979999121 4:127467893-127467915 ACAGGCACACACCACCATGGTGG + Intergenic
980940936 4:139273359-139273381 ACAGGCACACACCACCACGCTGG + Intronic
980941065 4:139274623-139274645 ACAGGCACACACCACCATGCTGG + Intronic
981678571 4:147367681-147367703 ATGGACACAAAGCACAAGGCTGG - Intergenic
982010951 4:151105832-151105854 ATAGGCACCCACCACCATGCTGG + Intronic
982121998 4:152151675-152151697 ATAGGCACCCACTACCATGCTGG - Intergenic
982165373 4:152609051-152609073 ACAGGCACCCACCACCATGCTGG - Intergenic
982600159 4:157439232-157439254 ACAGGCGCACACCACCATGCTGG - Intergenic
982776620 4:159448369-159448391 ACAGACACGCACCACCATGCCGG - Intergenic
987011177 5:13767264-13767286 ACAGGCACACACCACCATGCCGG + Intronic
987059991 5:14233346-14233368 ACAGACACACACCACCACACCGG - Intronic
987195088 5:15518130-15518152 ACAGGCCCACACCACCATGCCGG + Intronic
987369771 5:17182261-17182283 TCAGGCACACACCACCATGCTGG + Intronic
987446932 5:18031550-18031572 ATAGGCACATGCCACCATGCTGG + Intergenic
987916783 5:24225656-24225678 ACAGGCATACACCACCATGCTGG + Intergenic
988637937 5:33007771-33007793 ATAGGCATCCACCACCATGCTGG + Intergenic
988737570 5:34038074-34038096 AAGGTCACACAGCACCATGATGG - Intronic
989627941 5:43450134-43450156 ATAGGCATACACCACCATGCCGG + Intronic
990690344 5:58356679-58356701 ACAGGCACGCACCACCATGCCGG - Intergenic
990784526 5:59404515-59404537 ATAGGTGCACACCACCATGCTGG - Intronic
991096037 5:62740397-62740419 AGTGACGTACACCACCATGCAGG - Intergenic
991394087 5:66185281-66185303 ACAGGCACGCACCACCATGCCGG + Intergenic
991901531 5:71465401-71465423 ATAGGCACGCATCACCATGCTGG + Intronic
994349326 5:98726094-98726116 ACAGGCACCCACCACCATGCTGG - Intergenic
994404469 5:99327172-99327194 ATAGGCATGCACCACCATGCCGG + Intergenic
994997806 5:107086585-107086607 ATAGGCACCCATCACCATGCTGG - Intergenic
995194255 5:109346014-109346036 ATGGACAGAAAGCACCAGGCAGG - Intronic
995234308 5:109808843-109808865 ACACACACGCACCACCATGCTGG + Intronic
995461064 5:112403608-112403630 ACAGGCTCACACCACCATGCTGG + Intronic
995605863 5:113854606-113854628 ACAGGCACCCACCACCATGCTGG + Intergenic
996198785 5:120643861-120643883 ACAGACACCCACCACCATGCCGG - Intronic
997467517 5:134098337-134098359 ACAGGCACCCACCACCATGCTGG + Intergenic
997928167 5:138049994-138050016 ATGGGCACATACCACCACACCGG - Intronic
998217480 5:140248208-140248230 ACAGGCACACACCACCACGCTGG + Intronic
998445663 5:142196592-142196614 ATAGGCACGCACCACTATGCCGG + Intergenic
998980806 5:147699948-147699970 TAGGTCACACACCACCATGAAGG - Intronic
999468731 5:151831848-151831870 ATGGAGAGACACCTCCCTGCAGG + Intronic
999763525 5:154721203-154721225 ATAGACGTGCACCACCATGCCGG - Intronic
999967197 5:156821992-156822014 ACAGGCACATACCACCATGCTGG - Intergenic
1000789673 5:165590218-165590240 ACAGACATGCACCACCATGCAGG + Intergenic
1001112368 5:168907466-168907488 ATGGTCACACACTACCTTCCTGG - Intronic
1001396857 5:171423904-171423926 ACAGGTACACACCACCATGCTGG + Intronic
1002386400 5:178870416-178870438 ACAGGCACACGCCACCATGCCGG + Intronic
1003526214 6:6899795-6899817 ACAGGCACACACCACCACGCTGG - Intergenic
1004440815 6:15651691-15651713 ATGGACAAACAGCACAATCCTGG + Intronic
1005382142 6:25246364-25246386 ATAGGCAGATACCACCATGCTGG - Intergenic
1006559677 6:34899804-34899826 ATGCACAGACTCCACCAGGCTGG - Intronic
1006560282 6:34905262-34905284 ATGCACAGACTCCACCAGGCTGG - Intronic
1006964797 6:37971857-37971879 ACAGGCACACACCACCATACTGG - Intronic
1007071131 6:39039067-39039089 CAGGACACACATCACCATGGAGG + Intergenic
1008225898 6:48916142-48916164 ATGCACACACATATCCATGCGGG - Intergenic
1008282063 6:49608517-49608539 ATAGGCACCCACCACCATGCCGG + Intronic
1010192892 6:73211657-73211679 ACAGACATGCACCACCATGCCGG + Intronic
1010439502 6:75877117-75877139 ATAGGCATGCACCACCATGCTGG + Intronic
1010625296 6:78131248-78131270 ATGGAAACACACTGCCATGAAGG + Intergenic
1010725306 6:79326221-79326243 ATGGACAAACAGATCCATGCTGG + Intergenic
1011119641 6:83937659-83937681 ACAGGCACACACCACCATGCTGG + Intronic
1013263736 6:108472942-108472964 ACAGGCACGCACCACCATGCCGG + Intronic
1014170183 6:118269885-118269907 ATAGGTGCACACCACCATGCTGG - Intronic
1015155070 6:130084969-130084991 ATAGGCACATGCCACCATGCTGG + Intronic
1015423674 6:133039638-133039660 ACCGGCACACGCCACCATGCCGG - Intergenic
1015540126 6:134305429-134305451 ATAAACACACACCACCACGCTGG - Intronic
1015895272 6:138010920-138010942 ATAGGCACTCACTACCATGCTGG - Intergenic
1016407366 6:143744624-143744646 AAGGACAGAGGCCACCATGCAGG + Intronic
1016665334 6:146632845-146632867 ATGGACCCTGACCACAATGCTGG - Intronic
1016889146 6:148988430-148988452 ACAGGCACACGCCACCATGCTGG - Intronic
1017238363 6:152140694-152140716 ATGGGCAAACACTACCATGATGG + Intronic
1017363424 6:153603912-153603934 ACAGACATGCACCACCATGCCGG - Intergenic
1017699860 6:157058404-157058426 ACAGGTACACACCACCATGCTGG + Intronic
1018390010 6:163335113-163335135 GTGGACACAGACCCACATGCAGG + Intergenic
1018397532 6:163390129-163390151 ACAGGCACCCACCACCATGCTGG - Intergenic
1019503376 7:1376886-1376908 ACAGGCACCCACCACCATGCCGG - Intergenic
1019663448 7:2239149-2239171 AAGGATGCACACCACCATGCTGG + Intronic
1020041426 7:5005718-5005740 ACAGTCACACACCACCACGCTGG - Intronic
1020074655 7:5249850-5249872 ACAGGCACGCACCACCATGCTGG + Intergenic
1020682889 7:11258626-11258648 ATGGAAACACACCAGCACGAGGG + Intergenic
1020846120 7:13285935-13285957 ACAGGCACCCACCACCATGCCGG - Intergenic
1021652828 7:22848110-22848132 ACAGGCACCCACCACCATGCTGG + Intergenic
1021734982 7:23634293-23634315 ACAGGCACACACCACCATGCTGG - Intronic
1021741246 7:23687783-23687805 ACAGGCATACACCACCATGCTGG + Intronic
1022439880 7:30424624-30424646 TTGGACACCCCCCACCATGGTGG - Exonic
1022465629 7:30651694-30651716 ACAGGCACGCACCACCATGCTGG - Intergenic
1023062156 7:36338437-36338459 ACAGACATACACCACCATGCTGG + Intronic
1023175422 7:37431193-37431215 ATAGACATGCACCACCATGCCGG - Intronic
1023382290 7:39621791-39621813 ATGGACACATATCACCATATTGG + Intergenic
1023558719 7:41450109-41450131 ACAGGCACACACCACCATGCAGG - Intergenic
1024445371 7:49471787-49471809 ACAGGCACACACCACTATGCTGG + Intergenic
1025089145 7:56048135-56048157 ACAGGCACCCACCACCATGCCGG - Intronic
1025107569 7:56184917-56184939 ACAGGCACACACCATCATGCTGG - Intergenic
1025204448 7:56983954-56983976 ACAGGCACGCACCACCATGCTGG - Intergenic
1025667489 7:63592980-63593002 ACAGGCACGCACCACCATGCTGG + Intergenic
1026169784 7:67943981-67944003 ACGGGCACACGCCACCATGCCGG + Intergenic
1026420876 7:70235791-70235813 ACGGGCACCCACCACCATGCCGG + Intronic
1026533208 7:71218250-71218272 ACAGGCACCCACCACCATGCCGG - Intronic
1027129956 7:75583728-75583750 ACAGGCATACACCACCATGCGGG + Intronic
1027353536 7:77335257-77335279 ACAGGCACACACCACCATGCCGG - Intronic
1028081455 7:86582903-86582925 ACAGGCACACACCACCATGCTGG - Intergenic
1028232035 7:88317146-88317168 ATAGGCGCCCACCACCATGCTGG - Intergenic
1028547116 7:92014485-92014507 ATAGGCACACACCACAATGCCGG - Intronic
1028577096 7:92364169-92364191 ACAGGCGCACACCACCATGCCGG - Intronic
1029230255 7:99061160-99061182 ATGGACACGAGCCACCATGCTGG + Intronic
1029267760 7:99355600-99355622 ATAGGCACCCGCCACCATGCTGG - Intronic
1029658981 7:101946400-101946422 ACAGACGCACACCACCACGCTGG - Intronic
1029894660 7:103970282-103970304 ACAGGCACATACCACCATGCCGG + Intronic
1030664481 7:112260122-112260144 ACAGGCGCACACCACCATGCCGG - Intronic
1031276393 7:119728997-119729019 ACAGGCACCCACCACCATGCCGG + Intergenic
1031535465 7:122928537-122928559 ATGGATACACACTTGCATGCAGG + Intergenic
1031782801 7:125991256-125991278 ACAGGCGCACACCACCATGCCGG + Intergenic
1032028423 7:128462105-128462127 ACAGGCACCCACCACCATGCTGG + Intergenic
1032243352 7:130184632-130184654 ACAGGCACACGCCACCATGCTGG + Intronic
1032703284 7:134400415-134400437 ACAGGCACGCACCACCATGCTGG - Intergenic
1032710354 7:134455723-134455745 ACAGGCACCCACCACCATGCCGG + Intronic
1032991520 7:137399766-137399788 ACAGGCACACACCACCACGCTGG - Intronic
1033056485 7:138059604-138059626 ACAGGCACACACCACCATGCTGG - Intronic
1033116087 7:138626702-138626724 ACAGGCACACACCACCATGCTGG - Intronic
1033670068 7:143483516-143483538 ACAGGCACGCACCACCATGCTGG + Intergenic
1035289795 7:157830485-157830507 AGGCACACACATCACCACGCGGG + Intronic
1038967127 8:32587059-32587081 ACAGGCACACACCACCACGCTGG - Intronic
1039481742 8:37878855-37878877 ATAGGCGCACACCACCATGCCGG - Intronic
1040023153 8:42758499-42758521 ACGGGCACCCACCACCACGCCGG + Intronic
1041058327 8:54010955-54010977 ACAGGCACACACCACCACGCTGG + Intronic
1041225334 8:55692003-55692025 ATGACCACACACCACTGTGCAGG - Intergenic
1042526905 8:69773193-69773215 ATGCACACACAGCTGCATGCAGG + Intronic
1042587038 8:70351725-70351747 ATAGGCACACACCACCACCCCGG + Intronic
1043437131 8:80245685-80245707 ACAGGCACACACCACCATGCCGG - Intergenic
1043570230 8:81594776-81594798 ATACCCACACACCCCCATGCTGG + Intergenic
1044499317 8:92932867-92932889 AAGGACACAAACCACCTTGAAGG - Intronic
1044951108 8:97436286-97436308 ACAGGTACACACCACCATGCCGG + Intergenic
1045142370 8:99300945-99300967 ACAGGCACACGCCACCATGCCGG - Intronic
1045569678 8:103355999-103356021 ACAGGCACATACCACCATGCTGG - Intergenic
1045803497 8:106128753-106128775 ATAGGCACATGCCACCATGCTGG - Intergenic
1046337989 8:112814639-112814661 ACAAGCACACACCACCATGCTGG - Intronic
1047274348 8:123394485-123394507 ACAGACATACACCACCACGCTGG - Intronic
1047938662 8:129806556-129806578 ATGGGTACACACCACCACACCGG + Intergenic
1050031501 9:1391131-1391153 ACAGGCACACATCACCATGCTGG - Intergenic
1051220584 9:14844365-14844387 ACAGGCACGCACCACCATGCCGG + Intronic
1052367737 9:27632084-27632106 ACAGGCACCCACCACCATGCCGG + Intergenic
1052760394 9:32584510-32584532 ATGGGCATACACCACCACGCTGG - Intergenic
1052961906 9:34305743-34305765 ACAGGTACACACCACCATGCTGG + Intronic
1053242968 9:36511570-36511592 ACAGGCACACGCCACCATGCCGG + Intergenic
1055553537 9:77452994-77453016 AGGTACACACACCACCCGGCTGG - Intronic
1056195028 9:84220521-84220543 ACAGGCACCCACCACCATGCCGG - Intergenic
1056551721 9:87658410-87658432 GTACACACACCCCACCATGCAGG - Intronic
1057015191 9:91645017-91645039 ATGGACTCTAACCGCCATGCCGG + Intronic
1057374007 9:94501982-94502004 ACAGGCACACACTACCATGCTGG + Intergenic
1057428403 9:94972795-94972817 ACAGACACGTACCACCATGCAGG - Intronic
1057784042 9:98073424-98073446 ACAGACACACACCAACACGCCGG + Intronic
1058417885 9:104806805-104806827 ATGGGCATACACCTCCATGAAGG - Intronic
1058498334 9:105584676-105584698 ACAGGCACACGCCACCATGCTGG - Intronic
1058675713 9:107398444-107398466 ACAGACACACACCACCATGCCGG - Intergenic
1058677521 9:107413049-107413071 ACAGGCACGCACCACCATGCCGG - Intergenic
1059197409 9:112383213-112383235 ACAGGCGCACACCACCATGCCGG + Intronic
1059212592 9:112527793-112527815 ACAGGCACGCACCACCATGCCGG - Intronic
1059787070 9:117597556-117597578 ACAGACACTCACCACCATGTCGG + Intergenic
1060624416 9:125097289-125097311 ACAGGCACACACCACCATGCTGG - Intronic
1061629740 9:131864678-131864700 GTGGACACACATCACCGTGCGGG - Intronic
1061823269 9:133240275-133240297 ACAGACACCCACCACCACGCGGG - Intergenic
1062192461 9:135255027-135255049 ATGGCCACACCCCACACTGCAGG + Intergenic
1062200503 9:135300392-135300414 TTGGGCACTCAGCACCATGCTGG + Intergenic
1062263637 9:135676455-135676477 GGGGCCACACACCCCCATGCCGG + Intergenic
1062423270 9:136494204-136494226 ATGGACACACAGCAGCAAGGGGG - Intergenic
1203486528 Un_GL000224v1:60950-60972 ACAGGCACCCACCACCATGCTGG + Intergenic
1203499149 Un_KI270741v1:2849-2871 ACAGGCACCCACCACCATGCTGG + Intergenic
1185483062 X:462774-462796 ATGCACACACACAGACATGCAGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1185880898 X:3740012-3740034 ACAGGCACACGCCACCATGCTGG - Intergenic
1186309863 X:8306056-8306078 ACACACACACCCCACCATGCAGG - Intergenic
1186554651 X:10545102-10545124 ACAGGCACATACCACCATGCTGG + Intronic
1186873596 X:13796066-13796088 ACAGGCACGCACCACCATGCTGG + Intronic
1187153623 X:16704078-16704100 ACGGGCATGCACCACCATGCTGG + Intronic
1187339625 X:18409521-18409543 ACAGGCACACACCACCATGCTGG + Intergenic
1187344937 X:18454696-18454718 ATAGGCGCACACTACCATGCTGG + Intronic
1187354922 X:18559348-18559370 ATAGGCACGCGCCACCATGCCGG + Intronic
1187714843 X:22092512-22092534 ATGGGCATGCACCACCATGCCGG + Intronic
1189797351 X:44657745-44657767 ACAGGCACCCACCACCATGCTGG - Intergenic
1190222081 X:48518360-48518382 ACAGGCACGCACCACCATGCTGG + Intronic
1190294455 X:49017082-49017104 ACAGGCACACACCACCATACCGG + Intergenic
1191597319 X:62959885-62959907 ATGCACACACACAAGCATGATGG - Intergenic
1195584089 X:106543702-106543724 ACAGGCACACACCATCATGCCGG + Intergenic
1195712048 X:107780769-107780791 ACAGACACATGCCACCATGCAGG + Intronic
1195873021 X:109506031-109506053 ACAGACACACACTACCATGACGG + Intergenic
1196361065 X:114859297-114859319 ACAGACACATACCACCCTGCAGG - Intronic
1196858975 X:120009602-120009624 ACAGGCACACGCCACCATGCTGG - Intergenic
1197221071 X:123914587-123914609 ACAGGCACCCACCACCATGCCGG + Intergenic
1198390279 X:136167345-136167367 ACAGACACACGCCACCACGCCGG + Intronic
1198440953 X:136662796-136662818 ACAGGCACACACCACCATGCTGG - Intergenic
1198505273 X:137295095-137295117 ACAGGCGCACACCACCATGCCGG + Intergenic
1199114255 X:143971559-143971581 ACAGGCACACACCACTATGCAGG + Intergenic
1201168078 Y:11229539-11229561 ATAGACATGCACCATCATGCTGG + Intergenic
1202047391 Y:20748632-20748654 ACAGGCACACACCACCATGCTGG - Intergenic