ID: 1091487050

View in Genome Browser
Species Human (GRCh38)
Location 12:899631-899653
Sequence CTTGAATTCAACTGGGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091487044_1091487050 22 Left 1091487044 12:899586-899608 CCTAATCAAATTCTAATCCTAAT 0: 1
1: 1
2: 4
3: 19
4: 272
Right 1091487050 12:899631-899653 CTTGAATTCAACTGGGAACCGGG 0: 1
1: 0
2: 2
3: 5
4: 129
1091487045_1091487050 5 Left 1091487045 12:899603-899625 CCTAATTTTGACATACTTTTTGA 0: 1
1: 0
2: 4
3: 53
4: 438
Right 1091487050 12:899631-899653 CTTGAATTCAACTGGGAACCGGG 0: 1
1: 0
2: 2
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091487050 Original CRISPR CTTGAATTCAACTGGGAACC GGG Intronic
903509911 1:23867528-23867550 TTCTAATTCAACTGTGAACCTGG - Intronic
903867862 1:26411649-26411671 CCTCAATTCAACTGCGAGCCCGG - Intronic
906894104 1:49752589-49752611 CTTGAACTCAGCTCTGAACCAGG - Intronic
907979177 1:59463987-59464009 CTTGAATTCAGCTCTGCACCAGG + Intronic
916533864 1:165684621-165684643 CTTGAATTCAAGAGGAAACTAGG + Intronic
918435609 1:184509431-184509453 CTTGAAGTGTACTGGGATCCTGG - Intronic
919389490 1:196964475-196964497 GTAGAATTCAGCTGAGAACCTGG + Intergenic
923301627 1:232646233-232646255 CTTTCATTAAACTGGGAGCCAGG + Intergenic
1062839006 10:655185-655207 CTTGTAGTCAACTGGGAAGGGGG + Intronic
1063850869 10:10188515-10188537 TTTAAATTCAACTGGCAACTTGG - Intergenic
1068442456 10:57076026-57076048 CTTGATTACAAATGGGAAACTGG - Intergenic
1071555687 10:86599765-86599787 CTTGAATTTCTCTGGGAAACTGG - Intergenic
1071672257 10:87619474-87619496 CCTGGACTCAAGTGGGAACCTGG - Intergenic
1072014859 10:91336756-91336778 CTTGAAGTTAACCAGGAACCTGG + Intergenic
1072912309 10:99514130-99514152 CTTGGGTTCAAGTGGGAGCCTGG - Intergenic
1074188416 10:111115995-111116017 TTTGAATCTAACTGGGCACCCGG + Intergenic
1078017953 11:7631381-7631403 GTTGAATTCTACTGGGTATCGGG - Intronic
1079749164 11:24173875-24173897 CTGGAATTCACCGGGGAACTTGG + Intergenic
1080075289 11:28140734-28140756 CTTGTATTCAACTGTGAAGGGGG - Intronic
1082783559 11:57304205-57304227 CTTTAATCCCAGTGGGAACCTGG - Intronic
1083222978 11:61265379-61265401 CTTGAATTCTAGTGGGAAGTTGG - Intronic
1083531816 11:63430320-63430342 CTTGAACTCAGCTCTGAACCAGG + Intergenic
1086599819 11:88619156-88619178 CTTTAATTCATCAGGGAAACTGG + Intronic
1086701095 11:89901098-89901120 TGTGACCTCAACTGGGAACCAGG + Intergenic
1086705072 11:89943429-89943451 TGTGACCTCAACTGGGAACCAGG - Intergenic
1089760519 11:120719521-120719543 CTTCAAAACAACTGGGAAGCTGG - Intronic
1090873389 11:130767536-130767558 CTTGCATTCAACTGTGAAGGGGG + Intergenic
1091487050 12:899631-899653 CTTGAATTCAACTGGGAACCGGG + Intronic
1092969163 12:13675018-13675040 CTTGTATTCAACTGGGAATCTGG + Intronic
1093191991 12:16085464-16085486 TCTGAATTCAACTGGGAAAAAGG + Intergenic
1093370783 12:18362473-18362495 TTTGAATTCACCTGGGATACAGG + Intronic
1094058404 12:26288527-26288549 CTTAAATCTAACTGGGTACCAGG + Intronic
1108535224 13:51370007-51370029 GATGAATTCAGCTGGGATCCTGG - Intronic
1109897190 13:68708666-68708688 CTTGAATTCAACTGTGAAGGGGG + Intergenic
1111483056 13:88857664-88857686 CTGGAATCAAACTGGGAACACGG - Intergenic
1112817489 13:103290198-103290220 CATGAATGTACCTGGGAACCTGG + Intergenic
1115162015 14:30407076-30407098 GTAGAATTCAACTGTGAATCTGG + Intergenic
1119044004 14:71301477-71301499 CTTCAGTTCTACTGGGAATCTGG + Intergenic
1121252536 14:92510720-92510742 GTTGGGGTCAACTGGGAACCAGG - Intergenic
1121359204 14:93240826-93240848 CTTGAACTCCACTGGGACGCTGG - Exonic
1123884225 15:24708464-24708486 CTTGAATTCAGCTCTGGACCCGG - Intergenic
1126563406 15:50069907-50069929 CTTGAACCCAACTGTGTACCAGG - Intronic
1128329919 15:66748967-66748989 ATTGAATTAGACTGGGCACCGGG - Intronic
1130828810 15:87578555-87578577 GCTGAATTCAGGTGGGAACCAGG - Intergenic
1131657768 15:94479350-94479372 CTTGAATCCAAGTGGGCTCCTGG - Exonic
1134678228 16:16105311-16105333 CTAGAATTCAAATGGGGAGCTGG - Intronic
1135915416 16:26601373-26601395 CTTGATTTTAAATGGGAACTAGG + Intergenic
1136554196 16:30998049-30998071 CTTGAATTCCCCTGGGAAAGAGG - Intronic
1138212210 16:55173180-55173202 CCTGAAGTCAACTGGGAGGCAGG - Intergenic
1138718675 16:59053321-59053343 CTACCATTCAACTGGGAAACTGG + Intergenic
1141420556 16:83912582-83912604 CTTGCAGTCAACTGGGCAGCTGG - Intronic
1149203870 17:54220432-54220454 CTTTAATTCATCTGAGAACCTGG + Intergenic
1149954084 17:61026150-61026172 TTTAAATACAACTGGGAAACTGG - Intronic
1152302673 17:79504475-79504497 CTTGACTTCAACTAGGGAACTGG - Intronic
1157020409 18:43774601-43774623 CTTGTATTCAACTGTGAAGGGGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1160367885 18:78344242-78344264 CTTGAATTCAATTGGAGGCCTGG + Intergenic
1164446181 19:28319315-28319337 TTTGTATTCAAGTGGGAGCCAGG + Intergenic
1168280723 19:55304117-55304139 CTTAAATCCCACTGGGGACCTGG - Intronic
926648172 2:15312588-15312610 CTTAAATTCAGCTGGTACCCTGG + Intronic
928417622 2:31109395-31109417 CCTGAATTCATCTGAGAACAAGG - Intronic
933534187 2:83551894-83551916 CTTGTATTCAACTGTGAAGGGGG + Intergenic
935858671 2:107303175-107303197 CCTGATTTCACCTGGGAATCTGG + Intergenic
937166226 2:119820484-119820506 CTTGAATCCACATGGGAATCAGG - Intronic
938538905 2:132269182-132269204 CTTGCATCCAAGTGGGGACCCGG + Intergenic
941006251 2:160250165-160250187 CTACAATCCAACTTGGAACCTGG + Intronic
941715210 2:168756365-168756387 TTTAAATTCAACTGGGAAATGGG - Intronic
942154109 2:173109234-173109256 CTTGAATTTATCTGGGCACTAGG + Intronic
943577480 2:189648024-189648046 CTGGAATTCAACTGTTTACCAGG + Intergenic
947016390 2:225625120-225625142 TTTGAATTAAACTGTTAACCTGG + Intronic
948567673 2:238897052-238897074 CTTGAAAGCAAATGGGAATCAGG - Intronic
1169521829 20:6382181-6382203 CTTCAATTCAACTGGGCAGTTGG - Intergenic
1169884957 20:10388940-10388962 CTTGTATTCAACTGTGAAGGGGG + Intergenic
1171867815 20:30501093-30501115 CTTGCATCCAAGTGGGGACCCGG + Intergenic
1174077136 20:47945666-47945688 CTTGGACTTAACTGGGACCCTGG + Intergenic
1177198356 21:17926796-17926818 CTTGAATACAGTTGGGAATCAGG + Intronic
1177600501 21:23304491-23304513 CTAGCACTCAACTGGAAACCGGG + Intergenic
949590540 3:5489872-5489894 CCTGACTTCAACTAGGAACAGGG + Intergenic
950479157 3:13234039-13234061 TTTAAATTCCACTGGGATCCCGG - Intergenic
951352611 3:21624826-21624848 CTTGGCTTCAACTTGGAAACAGG - Intronic
952506482 3:34011012-34011034 CCAGATTTCAACTGGGAATCTGG - Intergenic
952595105 3:35007918-35007940 TTTGAATTCAGCTGGGATTCAGG + Intergenic
954641776 3:52104752-52104774 CTCAAATTCCACTGGGAAACTGG - Intronic
956559212 3:70555129-70555151 CTTGCACTCAACTGGGAGCCCGG - Intergenic
959931764 3:111992808-111992830 CTTGAATTGTACTTTGAACCAGG - Exonic
961996661 3:131252482-131252504 TTTGAATTCTACTTGGAACAGGG + Intronic
963957742 3:151274029-151274051 CTTGAACTAAACTGAGAAACTGG + Intronic
964705708 3:159616427-159616449 CTTGCATCCAACTGGGAAAGAGG + Intronic
965897085 3:173591700-173591722 CTTTAATTAAGCAGGGAACCAGG + Intronic
967629843 3:191732690-191732712 CTTGAACTCAGCTCTGAACCAGG + Intergenic
968750650 4:2387202-2387224 CTGGCAGTCCACTGGGAACCCGG + Intronic
971673344 4:29593163-29593185 CTTGAACTCAACTCTGGACCAGG - Intergenic
971768644 4:30867599-30867621 CGTGGATTCAACTGAGAGCCTGG + Intronic
971846313 4:31923501-31923523 CATGAAGTCAGCTGGGAAACTGG - Intergenic
972476122 4:39451519-39451541 CTTGTATTCAACTAACAACCTGG + Exonic
973144379 4:46805928-46805950 CTTAAAATCACCTGGGATCCAGG + Intronic
976705958 4:88019299-88019321 TTTGAATGCAACTGAGAAACTGG - Intronic
978011602 4:103692030-103692052 CTTTAATTCCTCTAGGAACCTGG + Intronic
980966018 4:139521881-139521903 CTTGAACCCAACTTGAAACCTGG + Intronic
981353089 4:143754662-143754684 CTTGAATTCAGCTCTGAATCAGG + Intergenic
983507440 4:168570055-168570077 TTGTAATTCAACAGGGAACCGGG + Intronic
984554874 4:181201743-181201765 CTTGGCTTCAACTGGGAGCTTGG - Intergenic
988038274 5:25856115-25856137 CTTGAATTCAATTGGATACTAGG - Intergenic
989756666 5:44963340-44963362 CTTGACTGCAACTGGGAAAGAGG + Intergenic
990569936 5:57067915-57067937 CTTGTATTCAACTGTGAAGGGGG + Intergenic
996622271 5:125521606-125521628 CTGGATTTCAACTGAGATCCTGG + Intergenic
1003408333 6:5841189-5841211 CTTGAGCTCCACTGGGATCCAGG + Intergenic
1005694193 6:28336031-28336053 CCTGAAATCTTCTGGGAACCTGG + Intronic
1006038288 6:31231705-31231727 CATGAATTGAAATGGGAACTTGG + Intergenic
1006391274 6:33760317-33760339 CATGCATTCAACATGGAACCTGG - Intergenic
1008419215 6:51277347-51277369 CTTGCATTCATCTGAGAAGCAGG + Intergenic
1011123293 6:83978505-83978527 CTTTATATCAACTGGGAACTTGG + Intergenic
1011787522 6:90863565-90863587 CTTGAATACAGGTGGGAAACTGG + Intergenic
1012595891 6:101038730-101038752 CTGGAGTTAAACTGGGTACCAGG - Intergenic
1015421224 6:133011511-133011533 CTTTCATTCAAGTGGGAACAGGG + Intergenic
1017457140 6:154611659-154611681 CTTAAAAACTACTGGGAACCCGG + Intergenic
1018625917 6:165778528-165778550 CTTGCATGCATCTGGGCACCAGG - Intronic
1036990555 8:13588234-13588256 CTTCTAATCAACTGGGCACCAGG - Intergenic
1038362957 8:26901347-26901369 GTTGAATTCATATAGGAACCAGG - Intergenic
1039272263 8:35895299-35895321 CATGCATGCAAATGGGAACCAGG - Intergenic
1042520790 8:69709174-69709196 CTAGAATTAGACTGGGAACAAGG + Intronic
1042774341 8:72413366-72413388 CTTGCATTCTACTAGGTACCAGG + Intergenic
1045057029 8:98377986-98378008 CTTGAAGTCAACTGGGCACCTGG - Intergenic
1045808027 8:106188478-106188500 CCTGACTACAACTGTGAACCTGG + Intergenic
1046098498 8:109587796-109587818 CCAGAATTCTACTGGGAGCCAGG - Intronic
1052930916 9:34054734-34054756 TTAGATTTCAACTGTGAACCAGG - Intergenic
1056350559 9:85744605-85744627 CCTGCATTCAACTGTGAAGCGGG - Intergenic
1059940009 9:119349570-119349592 GTTAAATAGAACTGGGAACCCGG + Intronic
1062297980 9:135844073-135844095 CTTGAATTCAGCTCTGGACCAGG + Intronic
1187638512 X:21261065-21261087 CTGGAATTCAAGTGGGAGACTGG - Intergenic
1187675358 X:21710999-21711021 CTTGAATTCTACCGGGACCCGGG - Intronic
1190246254 X:48692449-48692471 CTTGATTTGAACTGGGAACTGGG - Intergenic
1191146763 X:57174169-57174191 GTAGAATTCAACTGTGAATCTGG + Intergenic
1196975067 X:121150311-121150333 CTTGAATTCAACAGAGTTCCAGG - Intergenic
1197509817 X:127356598-127356620 CTTGTATTCAAATGTGAACAGGG + Intergenic
1199810666 X:151345462-151345484 CTTGGTTTCCACTGGTAACCTGG + Intergenic
1199986423 X:152955345-152955367 CTTGAAACCCACTGGGAAACAGG + Intronic