ID: 1091487177

View in Genome Browser
Species Human (GRCh38)
Location 12:900651-900673
Sequence TACCTTGACCTGGAGCAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091487177_1091487180 14 Left 1091487177 12:900651-900673 CCTTTCTGCTCCAGGTCAAGGTA 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1091487180 12:900688-900710 ATCGTCCAAAAACAATAAAATGG 0: 1
1: 0
2: 2
3: 22
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091487177 Original CRISPR TACCTTGACCTGGAGCAGAA AGG (reversed) Exonic
900479611 1:2891722-2891744 TTCCCAGCCCTGGAGCAGAAAGG - Intergenic
902625318 1:17673093-17673115 AAGCCTGACCTGGAGCAGGAGGG + Intronic
902707705 1:18217131-18217153 CAACTTGACCTGGGGCAGACGGG - Intronic
904303677 1:29573086-29573108 TATCTGGACCCGGAGGAGAACGG - Intergenic
909267364 1:73577480-73577502 TACCTGGGCATGGAGCAGAGAGG - Intergenic
915347109 1:155203129-155203151 TTCCTTCACCTGGAGAAGGATGG + Exonic
922003439 1:221504079-221504101 TGCCTTGGCGTGAAGCAGAAGGG - Intergenic
1065892454 10:30132771-30132793 TGCCTGGACCTGGAGCAGACAGG - Intergenic
1067663336 10:48252665-48252687 TACCTCTCCCTGGGGCAGAAAGG + Intronic
1070175805 10:73968223-73968245 TGCCTTGACCTACATCAGAAGGG - Intergenic
1074270015 10:111944696-111944718 TGCATTTACCTGGGGCAGAATGG + Intergenic
1075393465 10:122110319-122110341 TACCCTGACTTGGAGCAGGAGGG + Intronic
1076010968 10:126987835-126987857 TACAGTGAGCTGTAGCAGAAGGG + Intronic
1076673089 10:132133799-132133821 TGCCATGAACTGCAGCAGAAGGG - Intronic
1078553567 11:12299094-12299116 TTCCTTGCCTTGGAACAGAATGG + Intronic
1078794827 11:14582066-14582088 TACCTTGATCTGCAGAAGAAAGG + Intronic
1080876147 11:36276134-36276156 TACCTTCATCTGGAGCAGGCAGG + Exonic
1083161521 11:60857383-60857405 TTCCCTGACCTGGAGGAGAGGGG - Intergenic
1085225517 11:74917054-74917076 TCTCTTCAGCTGGAGCAGAAAGG + Intronic
1085331485 11:75655575-75655597 GGCCTTGCCCTGGAGGAGAAGGG + Intronic
1085403218 11:76246735-76246757 GACCTGAAGCTGGAGCAGAAAGG + Intergenic
1089756151 11:120688930-120688952 TCCCAAGACCTGGTGCAGAAAGG - Intronic
1091487177 12:900651-900673 TACCTTGACCTGGAGCAGAAAGG - Exonic
1101858257 12:108462466-108462488 TCCCATGAGCTGGGGCAGAAAGG - Intergenic
1103194406 12:119029789-119029811 TCCCATTACCTGGAGGAGAAGGG - Intronic
1103283618 12:119781761-119781783 TGACTTGACCTTGACCAGAATGG + Intronic
1106623866 13:31398434-31398456 AACATTGCCCTGGAGCAGAGTGG - Intergenic
1107179200 13:37438427-37438449 TACCTTGTCCAGGAGCATACAGG + Intergenic
1109646445 13:65264429-65264451 TCCCTGGGCATGGAGCAGAAAGG - Intergenic
1110198031 13:72813296-72813318 TACTTTGAACTGGAAAAGAAAGG - Intronic
1111282696 13:86048223-86048245 TACCTGGACATGTAGTAGAATGG - Intergenic
1112153146 13:96786282-96786304 AACATGGAACTGGAGCAGAATGG - Intronic
1114455644 14:22851578-22851600 TTCCCTGACTTGGAGCAGGATGG + Intergenic
1115489319 14:33943891-33943913 TTGCTTGAGCTGAAGCAGAAAGG + Intronic
1115993967 14:39176102-39176124 TACCTCCACCAGGACCAGAAAGG - Exonic
1116222917 14:42111686-42111708 TACCTGGGCATGGAGCAGAAAGG + Intergenic
1118848770 14:69569068-69569090 TGTCATGACCTGGTGCAGAAAGG - Intergenic
1119747417 14:77054045-77054067 ATCATTGCCCTGGAGCAGAATGG - Intergenic
1119860854 14:77935002-77935024 AACCATGACCTTGAACAGAAAGG - Intronic
1119960761 14:78853845-78853867 GACTTTCACCTGGAGAAGAATGG - Intronic
1121635288 14:95449928-95449950 TACCTCGATCTGGGGCAGGAAGG + Exonic
1123182982 14:106487003-106487025 TGCCTTGTTCTGGGGCAGAACGG - Intergenic
1123851510 15:24361984-24362006 TACCTGGAGCTGGAGCAGCTGGG + Intergenic
1127327807 15:57912379-57912401 TGCTTTGGGCTGGAGCAGAATGG + Intergenic
1128377506 15:67088060-67088082 AACCTTGAGCTGGAGCGGAGAGG + Intronic
1130715446 15:86329324-86329346 TACCTGGACATGGGGCAGAGAGG - Intronic
1132290860 15:100703014-100703036 TACAGTGACCTGGGGCAAAATGG - Intergenic
1132885946 16:2181987-2182009 TACCTGGAGCTGGAGGAGGAAGG + Intronic
1134025200 16:10947788-10947810 TACCTTGACCTAGAGCAGTATGG + Intronic
1138600109 16:58049079-58049101 TCCCGTGAGCTGGAGGAGAATGG - Intergenic
1141560423 16:84864142-84864164 GACCCTGGCCCGGAGCAGAATGG + Intronic
1142262397 16:89049084-89049106 TCCTTTGACCTGGGGCACAAAGG + Intergenic
1142485506 17:245490-245512 TGCCCTGACTTGGAGCAGACGGG + Intronic
1148596730 17:48862354-48862376 TCCCATGAACTGGAGCAGGAAGG - Intronic
1149264600 17:54913802-54913824 TACCTCGACCTGGTTAAGAAAGG + Exonic
1151464347 17:74274908-74274930 AACCTTGACCTTGAGCAGGAAGG - Intronic
1153981544 18:10314821-10314843 TATTTTGACCTGGGGCAGTAGGG - Intergenic
1155783716 18:29873320-29873342 AACCTTTCCCTGGAGGAGAATGG - Intergenic
1157310185 18:46546894-46546916 AACCTGGCCCTGGAGCAGAAAGG - Exonic
1158672938 18:59493008-59493030 TACAGTGAACTGCAGCAGAAAGG - Intronic
1165652397 19:37502747-37502769 TTCCTTGCTCTGGAGCAGAAAGG - Intergenic
925206691 2:2013327-2013349 GATCTTGGCCTGGAGCTGAAGGG - Intronic
925579158 2:5392740-5392762 TGCATTGAACTGGAACAGAAAGG + Intergenic
926141509 2:10371101-10371123 TACCAGGGCCTGGAGCAGCAGGG + Intronic
926548180 2:14268428-14268450 TATCCTGAGGTGGAGCAGAAAGG + Intergenic
931243770 2:60476135-60476157 GACCTTGACCTGGATGAGGAGGG + Intronic
937439530 2:121904386-121904408 GACCCTGACCTTGAGCAGGAAGG + Intergenic
938208970 2:129448828-129448850 TACCTAGATGTGGTGCAGAAAGG - Intergenic
940490951 2:154359780-154359802 TAGCTTGAAATGGAGCAGATGGG + Intronic
946372830 2:219290916-219290938 TAGCTTGAGATGCAGCAGAAAGG + Intronic
947598071 2:231426516-231426538 TCCCAGGACCTGAAGCAGAAGGG + Intergenic
948761907 2:240197502-240197524 TAGCTTGACCTGGGGCTGCAGGG - Intergenic
1168756410 20:321496-321518 TATGTTGAGCTGGAGCTGAAGGG - Intergenic
1168958642 20:1852936-1852958 TATTTTGGCCTGGTGCAGAATGG - Intergenic
1171093323 20:22306686-22306708 TACCCTGAGCTGGAACAGAGGGG + Intergenic
1171257512 20:23701311-23701333 TACCTGGGCATGGAGCAGAGAGG - Intergenic
1172273683 20:33668360-33668382 TACCTTCTCCTGGCCCAGAAAGG - Exonic
1173892244 20:46521627-46521649 TATCTAGACCAGGAGCACAATGG - Intergenic
1174114089 20:48214906-48214928 CACATGGACCTGGGGCAGAATGG + Intergenic
1176160161 20:63643631-63643653 TGCCTTGGCCTGGAGCAGGAGGG - Intronic
949662984 3:6303474-6303496 TGCCTGGACATGGAGCAGAGAGG - Intergenic
951371862 3:21859199-21859221 CACCATCCCCTGGAGCAGAAAGG - Intronic
951923366 3:27880107-27880129 TACATTGACAAGGAGAAGAATGG - Intergenic
952573639 3:34747809-34747831 CACCTTGTCCTAGAGCATAAAGG + Intergenic
957470423 3:80652245-80652267 TACCTTGGACTGGAGCTGATAGG + Intergenic
959948264 3:112149893-112149915 TACCTGGAGGTTGAGCAGAAAGG + Intronic
961194406 3:124989679-124989701 TACTTCCACCTGGAGCAGAGAGG + Intronic
961842527 3:129728062-129728084 TGCTTTGACCTAAAGCAGAAGGG + Intronic
962131360 3:132681033-132681055 TACCTTTTCCTTGAGCAGATTGG - Intronic
964086762 3:152827979-152828001 CACTTTGGCCTGGAGGAGAAGGG - Intergenic
967550310 3:190786159-190786181 TACATTGACATGGAGGAAAAGGG - Intergenic
969154708 4:5200493-5200515 GTCCTGGACCTGGAGGAGAAGGG - Intronic
973001925 4:44961966-44961988 TGCCTGGACATGGAGCAGAGAGG + Intergenic
980786047 4:137556628-137556650 TAGGTGGAACTGGAGCAGAAGGG + Intergenic
982266238 4:153540983-153541005 TAACTTGTCCTAGAGCTGAAAGG + Intronic
983282198 4:165695072-165695094 TCCATTGACCTGGAGAAGAACGG - Intergenic
983474387 4:168196257-168196279 TACCTGGATGTGGAGCAGAGAGG - Intergenic
984727635 4:183036678-183036700 TACTTTGAACTGGAGGAGATTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
987427887 5:17794285-17794307 TACCTGGACTGGGAGAAGAAAGG + Intergenic
987539705 5:19238629-19238651 TACTTTGATCTGGATCAGAGTGG - Intergenic
988069362 5:26266974-26266996 TGCCTGGTCCTGGAGCAGAGAGG + Intergenic
988408068 5:30849987-30850009 TACCTTGACCTCAAACAGCATGG + Intergenic
988418975 5:30982468-30982490 GACCTTGAATTTGAGCAGAAAGG + Intergenic
989192665 5:38686419-38686441 TACCTCATCCTGGAGTAGAAAGG - Intergenic
990313594 5:54563667-54563689 TACCTGTACCTGGATCAGAAAGG - Intergenic
995874585 5:116777256-116777278 TATTTTGAACTGGAGGAGAATGG - Intergenic
999459574 5:151746320-151746342 TACCTTGGCCTTGAGTAGCAGGG - Exonic
999583576 5:153065816-153065838 CACTGTGACCTGGAGCAGCAGGG + Intergenic
999685109 5:154095815-154095837 TATCTTGAGCTGGAGAGGAAGGG - Intronic
1000447900 5:161346885-161346907 AACCATGGCTTGGAGCAGAAAGG + Intronic
1001400659 5:171444548-171444570 TACCTAGATCTGGCCCAGAAGGG + Intronic
1002180975 5:177431038-177431060 GACCTTGCCCCGGAGCAGAGGGG + Intronic
1002467572 5:179415270-179415292 TACCTTCATCTGGAGCATAGAGG - Intergenic
1006147706 6:31969227-31969249 TTCCCTGTCCTGGAGCAGGAAGG + Intronic
1009849723 6:69180309-69180331 TGCCTGGGCATGGAGCAGAAAGG + Intronic
1011402042 6:86973836-86973858 GGCTTTCACCTGGAGCAGAAAGG - Intronic
1011464052 6:87636906-87636928 GACCTTGACTAGGAGCAGCAAGG + Intronic
1011845805 6:91561793-91561815 TGCCTGGGCATGGAGCAGAAAGG - Intergenic
1012549394 6:100453753-100453775 CACCTGTACCTGGAGCAGATGGG + Exonic
1013255365 6:108379779-108379801 TGCCTGGACATGGAGCAGAGAGG + Intronic
1015472844 6:133625466-133625488 TTCCTTGACCTGGAACTTAAAGG - Intergenic
1018593239 6:165451278-165451300 TAGCTTGAACTGGAGCAGGGTGG - Intronic
1018868947 6:167767004-167767026 TTCCTTGAACTGGCTCAGAAAGG + Intergenic
1019152185 6:170014984-170015006 TACCTACACGTGGAGAAGAATGG + Intergenic
1021194415 7:17659339-17659361 TAACTTGGGCTGGAGAAGAAAGG - Intergenic
1021351833 7:19603028-19603050 TGCCTGGCCATGGAGCAGAAAGG + Intergenic
1021894875 7:25223953-25223975 TCCCTTGCCCTGGAGAAGATAGG + Intergenic
1023315075 7:38928136-38928158 GACCAGGAGCTGGAGCAGAACGG - Intronic
1023497683 7:40815608-40815630 TGCCTGGGCATGGAGCAGAAAGG + Intronic
1024279271 7:47706108-47706130 ACCCTTGACATGGAGCAGGAGGG + Intronic
1024895651 7:54259044-54259066 TACCTTAACCAGGAGGAGAAAGG - Intergenic
1026271839 7:68843567-68843589 TACCTTGACCTGAAGATGACTGG + Intergenic
1030082783 7:105791811-105791833 TAGCTTGACCTGTTGCAGAAAGG - Intronic
1033850306 7:145487257-145487279 AACATTGACTTGGTGCAGAAAGG + Intergenic
1035093811 7:156335654-156335676 CAGCTTGAGCTGGAGCAGGAAGG + Intergenic
1039555280 8:38470748-38470770 AAGCTTGACCAGGAGCTGAAAGG - Intergenic
1041823238 8:62063258-62063280 CACCCTGGCCTGGGGCAGAAGGG + Intergenic
1042364529 8:67921241-67921263 TACCTAGGCCTGGGGCAGATAGG + Intergenic
1043171477 8:76972245-76972267 TGCCTGGGCATGGAGCAGAAAGG - Intergenic
1043345357 8:79291716-79291738 TACCATGGCCTGGCTCAGAATGG + Intergenic
1043632205 8:82349809-82349831 TACCTTGACCTGGCCTAGATTGG - Intergenic
1046666426 8:117008734-117008756 AAGCATGACCTGAAGCAGAAGGG - Intronic
1047306327 8:123655802-123655824 TGCATTGAGCTGGAACAGAATGG + Intergenic
1050687674 9:8190344-8190366 TGCCTGGGCATGGAGCAGAAAGG - Intergenic
1052260151 9:26505661-26505683 ACCCATGACCTAGAGCAGAAAGG - Intergenic
1057727501 9:97578576-97578598 GACCTTGACCTGGGGCTGAAAGG - Intronic
1058465750 9:105225501-105225523 TCCCTTGACTAGGAGCAGAGGGG + Intergenic
1062726041 9:138074105-138074127 TCCCGTGCCCTGGAGCAGAGGGG + Intronic
1185827025 X:3261303-3261325 TACCTTCACATGGAGGAGAGAGG - Intergenic
1187334767 X:18372557-18372579 TACCTCCACCTGGATTAGAAGGG + Intergenic
1188368306 X:29337048-29337070 TACTTTGACTTGGAGGAGACTGG - Intronic
1188433114 X:30129412-30129434 TGCAGTGACCTGGAGGAGAATGG + Intergenic
1189628073 X:42920907-42920929 CACTTTAACCTGGAGCAGCAAGG - Intergenic
1190679076 X:52809272-52809294 TACCTTGAGCTGGAAAAGAAAGG - Intergenic
1190733039 X:53236954-53236976 TACCTTGCTCCGGAGCAGAGGGG + Intronic
1192149070 X:68700614-68700636 GACCTCAGCCTGGAGCAGAAAGG - Intronic
1192672380 X:73159207-73159229 TCCCTTGTATTGGAGCAGAAAGG + Intergenic
1192762060 X:74104340-74104362 TACCTTGGCGTGGAGCAGAGGGG - Intergenic
1194263396 X:91726634-91726656 TAACATGACGTGGAGCAGTAGGG - Intergenic
1194923503 X:99796091-99796113 TGCCTGGGCATGGAGCAGAAAGG + Intergenic
1195056250 X:101148148-101148170 TACCCTTACCTGTAGCAAAAAGG - Exonic
1195734763 X:108000911-108000933 TGCCTGGACATGGAGCAGAGAGG - Intergenic
1195771140 X:108352838-108352860 TACCTTGTCCAGAAGCAGCATGG - Intronic
1197031731 X:121824222-121824244 TACCTGGTCATGGAGCAGAGAGG - Intergenic
1197861393 X:130974579-130974601 TCACTTGACCGGGAGCTGAAGGG + Intergenic