ID: 1091489058

View in Genome Browser
Species Human (GRCh38)
Location 12:917119-917141
Sequence ACTGTGTGTGCTCATTTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091489058_1091489062 17 Left 1091489058 12:917119-917141 CCACGGAAATGAGCACACACAGT 0: 1
1: 0
2: 1
3: 15
4: 129
Right 1091489062 12:917159-917181 CCTTCCCAACCCTTTCTGCCAGG 0: 1
1: 0
2: 3
3: 46
4: 375
1091489058_1091489063 18 Left 1091489058 12:917119-917141 CCACGGAAATGAGCACACACAGT 0: 1
1: 0
2: 1
3: 15
4: 129
Right 1091489063 12:917160-917182 CTTCCCAACCCTTTCTGCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091489058 Original CRISPR ACTGTGTGTGCTCATTTCCG TGG (reversed) Intronic
902489837 1:16773207-16773229 ACTGGGTGTGTTCATTTCCCGGG + Intronic
904422196 1:30401449-30401471 ACTGTGTGTGCACAATTCTTGGG - Intergenic
905490628 1:38340747-38340769 ACTGCCTGTGCTCATTCCCAGGG - Intergenic
905710153 1:40095338-40095360 TCTGTGTACGCTCATTTCCTAGG + Intronic
906214888 1:44032988-44033010 TATGTGTGTGCTCAATTCCTGGG + Intergenic
907660042 1:56383546-56383568 TCTGTCTGTACTCATTTCCTTGG + Intergenic
908763358 1:67532360-67532382 ACTCTGTGTGTTAATTTCCTAGG - Intergenic
909166507 1:72233127-72233149 ATTGTGTGTTTTCATTTCCTTGG - Intronic
910179506 1:84465921-84465943 ACAGTGTGTAATCATTTCCATGG - Intergenic
912250627 1:108008746-108008768 ATTATGTATGCTCATTTCAGGGG - Intergenic
918311647 1:183289518-183289540 ACTGTGTGTGCTCAGATATGTGG + Intronic
918432395 1:184475361-184475383 TTTGTGTGTGTTCATTTCAGAGG - Intronic
919464715 1:197914176-197914198 ACTGCGTGTGCTCAATTGTGAGG + Intronic
920102449 1:203525812-203525834 CCTGTGTGGGCCCATTTCTGAGG - Intergenic
921277416 1:213533542-213533564 TCTGTGTGTTCTCATTTACCAGG - Intergenic
923530603 1:234809321-234809343 ACTGGGTGTGTTCATTTCCCGGG - Intergenic
924586653 1:245366685-245366707 AGTGTGTCTTCTCATTTCTGTGG + Intronic
924721814 1:246630176-246630198 GCAGTGTTTGCTCATTTCAGTGG - Intronic
924897843 1:248361754-248361776 ACTTTGTGTGGTCATTTTTGTGG + Exonic
1063103508 10:2972455-2972477 GCTGTGTGAACTCATCTCCGCGG - Intergenic
1063374300 10:5544836-5544858 AGTGTGTGTGCACATGTACGTGG - Intergenic
1066447003 10:35492411-35492433 ACTGACTGTGCTGATTTCAGAGG - Intronic
1068343960 10:55747047-55747069 ACTCTGTTTGCTCACTTCTGTGG + Intergenic
1072806659 10:98427645-98427667 ACTGTGTGTGCTGACTCCTGAGG - Intronic
1073853067 10:107643654-107643676 ACTGGGTGTGATCATTTTCTTGG + Intergenic
1074194790 10:111174015-111174037 TCTTTGTGTGTTCATTTCCCTGG + Intergenic
1076550226 10:131273267-131273289 ACTGTGTGTGGTCACTGCTGGGG - Intronic
1077183863 11:1227912-1227934 CCTCTGTGTGCTCAGTTCCACGG + Intronic
1083440232 11:62671482-62671504 ACCCTGTGTCCTCAATTCCGGGG - Exonic
1085172323 11:74459838-74459860 ACTGGGTGTTCTCCTTTCCCAGG + Intronic
1085576796 11:77612375-77612397 ACTGTGTGTCTTCATTGCCAAGG - Intronic
1086533188 11:87811135-87811157 GCTGCGTGTGCTCAGTTCCCAGG - Intergenic
1087308927 11:96517520-96517542 GCTGTGTGGCCTCATTTCTGGGG + Intergenic
1090179278 11:124680524-124680546 GCTGTGTGTGCCCGTTTTCGGGG + Intronic
1090979698 11:131708626-131708648 ACTGTGTGTAATCATTCCCTTGG - Intronic
1091010137 11:131993592-131993614 ACAGTGTGTGCAGATTTCCTAGG + Intronic
1091149997 11:133319329-133319351 GCTGTGTGTGGTCAGTTCAGAGG - Intronic
1091489058 12:917119-917141 ACTGTGTGTGCTCATTTCCGTGG - Intronic
1093890196 12:24510846-24510868 ACTGTGGGTACTCATATCCTGGG - Intergenic
1096220703 12:49826966-49826988 ACCGTGTGTATTCCTTTCCGGGG - Intronic
1100243495 12:92733294-92733316 TCTGTGTGTGCTCAGCTCTGGGG - Intronic
1100574556 12:95877887-95877909 ACTGTGTGTTATCATTTTGGTGG - Intronic
1102406201 12:112676328-112676350 AGGCTGTGTGCTCATTTCTGAGG + Intronic
1103389177 12:120558345-120558367 ATTGTGTGTTCTCATTTGGGTGG + Intronic
1105581770 13:21704745-21704767 AGTGTGTGTGCACATTTACGTGG + Intergenic
1113522454 13:110950496-110950518 ACTGTGTGGGCTGACTTCCTGGG + Intergenic
1117307783 14:54493305-54493327 ACCGTGTGTGCGCACTTCCCAGG - Intergenic
1117818354 14:59621504-59621526 AGTGTGTGTGCTCATAGCTGTGG - Intronic
1119871512 14:78022036-78022058 ACTGAGTCTGCTAATTTCCAAGG + Intergenic
1120715005 14:87831351-87831373 ACATTGTGTGCTCATTTTCTAGG + Intergenic
1121766737 14:96494273-96494295 ACTGTGTGTGCTCCCGTCTGAGG + Intergenic
1123994007 15:25705713-25705735 ACTGCATTTGCTCATTTCTGTGG + Intronic
1126365181 15:47886733-47886755 ACTGTGTGTGCTCAATTCCCAGG + Intergenic
1126956022 15:53934796-53934818 ACTGTGTCTGCTCATTGTAGAGG + Intergenic
1128946511 15:71826424-71826446 ACTGTATGTGCTGAATTCCTGGG - Exonic
1132648720 16:1010803-1010825 ACTGTGTGTCCACATGGCCGTGG + Intergenic
1132930857 16:2458622-2458644 GCTATGTGTGTTCATGTCCGCGG + Exonic
1135678602 16:24438332-24438354 TCTCTCTGTGCTCATTTCCAAGG - Intergenic
1143592543 17:7894279-7894301 ACTGTGTGTGATCCTGTCAGTGG + Intronic
1146282663 17:31555122-31555144 ACTGTGTGACCTCACTTCCCAGG + Intergenic
1147003942 17:37386671-37386693 ACAGGGTGAGCTCATTTGCGTGG - Intronic
1152460025 17:80437638-80437660 TAAGTGTGTGCTCATTTCTGTGG + Exonic
1154096269 18:11418133-11418155 CCTTTGAGTGCTCATTGCCGTGG + Intergenic
1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG + Intronic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1165150970 19:33759905-33759927 GCAGTGTTTGCTGATTTCCGTGG - Intronic
1165825221 19:38701938-38701960 AATGTGTGTGCTGAGTTCCAAGG + Intronic
926742634 2:16125353-16125375 ACCATGTGTGCTTATTTCCCAGG - Intergenic
928674049 2:33633071-33633093 ACTGTGTCTGTTCAATTCTGTGG - Intergenic
931285191 2:60826168-60826190 GCAGTGTGTGCTGATTTCCCTGG + Intergenic
932853518 2:75210678-75210700 CCTGTGTGTGCTCATGCCAGTGG + Intergenic
933558699 2:83864692-83864714 ACTGAGTGTGCTCAATTTTGGGG - Intergenic
936405308 2:112197548-112197570 ACTAGGTGTGTTCATTTCCTAGG - Intergenic
936491983 2:112979795-112979817 TCTGTGTTTGCTCATTTACTAGG + Intronic
937499457 2:122462412-122462434 ACTGTGCATGCTCATCTCCCAGG + Intergenic
937590070 2:123602184-123602206 AATGTTTGTCCTCATTTCCCAGG - Intergenic
938386906 2:130873075-130873097 CCTGTGTGTGCCCATTCCCCTGG - Intronic
940996631 2:160156922-160156944 ACTGGGTATGTTCATTTCCTTGG + Intronic
941640049 2:167977718-167977740 ACTTTGTGTGCACATTTCTGGGG + Intronic
942628568 2:177930699-177930721 TCTGTGTTTGGCCATTTCCGTGG - Intronic
942663471 2:178290771-178290793 ACTAGGGGTGCTCATTTCCATGG + Intronic
1169863120 20:10172509-10172531 ACAGCCTGTGCTCATTTCCGCGG + Intergenic
1170484575 20:16803545-16803567 ACTTTGTGGGGTCATTTCAGGGG + Intergenic
1175797475 20:61781011-61781033 TCTGTGCATGCACATTTCCGGGG - Intronic
1176514985 21:7777408-7777430 ACTGAGTGTGCTCAAGTCCTGGG - Intergenic
1178649040 21:34407467-34407489 ACTGAGTGTGCTCAAGTCCTGGG - Intronic
1179052286 21:37898021-37898043 GCTGTGTGTGCTCACTACTGTGG + Intronic
1181983506 22:26783066-26783088 ACTCTGTGTGCTCCTTCCCATGG - Intergenic
1182416477 22:30224515-30224537 ACCGGGTGTGCTCATGTCCCTGG - Intergenic
959978339 3:112486967-112486989 ACTTTGTGTCCTCATCTCTGTGG - Intronic
962141476 3:132795087-132795109 ACAGTGGATGCTCCTTTCCGGGG + Intergenic
969172031 4:5371883-5371905 ACTGTGTAAGCTCATTTCCCAGG + Intronic
969580145 4:8059975-8059997 CCTGTGTGTCCTCATTTCTCTGG + Intronic
969628868 4:8323668-8323690 ACTGTGTCTGCCAATTTCCATGG - Intergenic
974381700 4:61148794-61148816 GTGGTGTTTGCTCATTTCCGTGG - Intergenic
976275242 4:83270098-83270120 TCTGTGTGTGCTGCTTTCTGTGG + Intronic
982411202 4:155079562-155079584 ACTGTGTCTGATTATTTCCCAGG + Intergenic
986279435 5:6311456-6311478 ACTGTGTGTATTCATTTCCTAGG - Intergenic
986708944 5:10473608-10473630 AATAAGTGTGCTCATTTCCTAGG - Intergenic
988621915 5:32831882-32831904 CCTGTGTGTTCTCATATCCTGGG + Intergenic
989105833 5:37862152-37862174 ACTGTGGGTGCCCCTTTCCTGGG + Intergenic
989486863 5:42000887-42000909 AATGTGTGTTCTTATTTCTGGGG + Intergenic
991951185 5:71948098-71948120 CCTGGGTGTGCTCCTTTCCCTGG + Intergenic
992385912 5:76284612-76284634 AGTGTGTGCTCTCATTTCCTGGG - Intronic
994798263 5:104334501-104334523 CCTTTGTGTGTTCATTTCAGTGG + Intergenic
998831653 5:146166097-146166119 GCTGGGTGTGCTCATTGCCTGGG - Intronic
1004013645 6:11712444-11712466 ATAATGTGTGCTCATTTCCATGG - Intronic
1008678846 6:53850749-53850771 AGTGTGTGTGCTTATTACCTTGG + Intronic
1011353131 6:86445091-86445113 ACTGCGTGTGCTCACTTCCCAGG - Intergenic
1011371213 6:86638681-86638703 ATTGTGTGTACTCATTGCTGTGG - Intergenic
1014601004 6:123412080-123412102 ATAGTGTTTGCTGATTTCCGTGG - Intronic
1015359870 6:132327784-132327806 ACTGCGTGTGCTCATTTACCTGG + Intronic
1016351990 6:143178180-143178202 ACTGTGTGTGCTCAGATTCTGGG + Intronic
1018455890 6:163951848-163951870 ACTGTGCGTGCTCCTTTCCCAGG - Intergenic
1024457320 7:49624136-49624158 TCTGTGTGTGCTCATTCCTGAGG - Intergenic
1024606286 7:51025077-51025099 ACTGTGTGTGCGCATTTCAATGG - Intronic
1031244625 7:119293725-119293747 ATTGTGTTTGTTCATTTCAGTGG - Intergenic
1033151290 7:138916965-138916987 GCTGGTTGTGCTCACTTCCGTGG + Exonic
1034367770 7:150566792-150566814 ACAGTGTGTCCTTATTTCCAGGG - Intergenic
1035739593 8:1916148-1916170 CCTGCGTGTGCACCTTTCCGTGG - Intronic
1035889450 8:3327673-3327695 TCTGTATGTGCTCATTTCTTCGG - Intronic
1037141955 8:15531047-15531069 ACTGTGTGTGCTCACCTGCTAGG + Intronic
1039846609 8:41330056-41330078 ACTGTGTGTGCTCTGTTGTGTGG + Intergenic
1041636037 8:60145930-60145952 GCTGTGTCTGCTGATTTCTGGGG + Intergenic
1043078838 8:75738632-75738654 ACAGTGAGTGGTCATTTCAGAGG + Intergenic
1047387430 8:124423012-124423034 ATTTTGTGTGCTAATTTCAGAGG - Intergenic
1047678167 8:127225659-127225681 CCTGTTTGTGCTCATTTCTCAGG + Intergenic
1049514257 8:143045073-143045095 GCTGGCTGTGCTCACTTCCGAGG - Intronic
1051659247 9:19410044-19410066 ACTTTGCGTGGTCATTTCTGTGG + Intronic
1051997283 9:23233208-23233230 ACTGCATGTGCTCACTTCCCAGG + Intergenic
1052669582 9:31538859-31538881 ACACTGTGTGCTCAATTCCCAGG + Intergenic
1053553644 9:39110464-39110486 ACTCTGTGTCCTCAATTCCCAGG - Intronic
1053817755 9:41930611-41930633 ACTCTGTGTCCTCAATTCCCAGG - Intronic
1054108006 9:61074280-61074302 ACTCTGTGTCCTCAATTCCCAGG - Intergenic
1054612851 9:67256845-67256867 ACTCTGTGTCCTCAATTCCCAGG + Intergenic
1056536091 9:87529022-87529044 ACTGTGTGTGCTCACCTCCCAGG + Intronic
1057757263 9:97848354-97848376 ATTGTGGGTGTTCATTTCTGGGG - Intergenic
1061653735 9:132071364-132071386 CGTGTGTGTGCTCATTTATGGGG - Intronic
1061653742 9:132071436-132071458 CGTGTGTGTGCTCATTTATGAGG - Intronic
1186436557 X:9547760-9547782 ACTGAGTGTGCTCATTGCTATGG + Intronic
1188695353 X:33183632-33183654 ACCCTGTGTTCTCATTTCTGTGG + Intronic
1192804548 X:74497282-74497304 ACTGGCTGTGCCCATTTCTGGGG + Intronic
1194122248 X:89975691-89975713 AGTGTGCGTGGTCATTTCAGAGG - Intergenic
1200109267 X:153731671-153731693 ACTGTCTGTGCTGAATTCTGGGG + Intronic
1200475107 Y:3633126-3633148 AGTGTGCGTGGTCATTTCAGAGG - Intergenic
1201922840 Y:19253257-19253279 ACTGTGTGTGCTAAATTCCAAGG - Intergenic