ID: 1091490691

View in Genome Browser
Species Human (GRCh38)
Location 12:930015-930037
Sequence AGTGCAGAAGTCCCCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091490686_1091490691 12 Left 1091490686 12:929980-930002 CCTCACCCACAGCAGACTTTCAG 0: 1
1: 0
2: 3
3: 31
4: 297
Right 1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 168
1091490683_1091490691 24 Left 1091490683 12:929968-929990 CCTACCTTACCTCCTCACCCACA 0: 1
1: 0
2: 4
3: 53
4: 566
Right 1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 168
1091490688_1091490691 7 Left 1091490688 12:929985-930007 CCCACAGCAGACTTTCAGCAGGA 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 168
1091490682_1091490691 27 Left 1091490682 12:929965-929987 CCACCTACCTTACCTCCTCACCC 0: 1
1: 0
2: 7
3: 66
4: 730
Right 1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 168
1091490689_1091490691 6 Left 1091490689 12:929986-930008 CCACAGCAGACTTTCAGCAGGAG 0: 1
1: 0
2: 2
3: 18
4: 236
Right 1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 168
1091490685_1091490691 15 Left 1091490685 12:929977-929999 CCTCCTCACCCACAGCAGACTTT 0: 1
1: 0
2: 2
3: 45
4: 347
Right 1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 168
1091490684_1091490691 20 Left 1091490684 12:929972-929994 CCTTACCTCCTCACCCACAGCAG 0: 1
1: 0
2: 4
3: 58
4: 502
Right 1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091490691 Original CRISPR AGTGCAGAAGTCCCCACTGC TGG Intronic