ID: 1091490921

View in Genome Browser
Species Human (GRCh38)
Location 12:931959-931981
Sequence CTAAAGACAAAGATGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091490918_1091490921 13 Left 1091490918 12:931923-931945 CCCTGCTCAGATGAGATGAATAC 0: 1
1: 0
2: 0
3: 13
4: 203
Right 1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 264
1091490914_1091490921 21 Left 1091490914 12:931915-931937 CCCCCTTGCCCTGCTCAGATGAG 0: 1
1: 0
2: 3
3: 29
4: 341
Right 1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 264
1091490915_1091490921 20 Left 1091490915 12:931916-931938 CCCCTTGCCCTGCTCAGATGAGA 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 264
1091490919_1091490921 12 Left 1091490919 12:931924-931946 CCTGCTCAGATGAGATGAATACT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 264
1091490916_1091490921 19 Left 1091490916 12:931917-931939 CCCTTGCCCTGCTCAGATGAGAT 0: 1
1: 0
2: 0
3: 14
4: 202
Right 1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 264
1091490917_1091490921 18 Left 1091490917 12:931918-931940 CCTTGCCCTGCTCAGATGAGATG 0: 1
1: 0
2: 0
3: 36
4: 282
Right 1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091490921 Original CRISPR CTAAAGACAAAGATGGAGTT TGG Intronic
900764167 1:4492876-4492898 ATAAAGACATAGGAGGAGTTAGG + Intergenic
901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG + Intronic
902121189 1:14167424-14167446 CTAAATACAAGGATGGAGGCAGG + Intergenic
903830932 1:26174086-26174108 CAAAAGACAAAGCTGGAGACGGG + Intergenic
903991687 1:27275633-27275655 ATAAAGAAAAAGATGGAGCGGGG + Intronic
904474362 1:30755428-30755450 ATAGAGACAAACCTGGAGTTTGG - Intronic
904761971 1:32811835-32811857 CTGCAGGCAAAGATGCAGTTAGG - Intronic
906485643 1:46232725-46232747 CTAAAGACCAACATGGAGGAGGG - Intergenic
908402117 1:63781084-63781106 CTAAAGACAAAGCAGAGGTTGGG + Intronic
910680605 1:89860396-89860418 CTAAGGAGAAAGATGAAGGTGGG - Intronic
912411028 1:109480813-109480835 CTAAAGACAAATATGGAACTGGG - Exonic
912558861 1:110535891-110535913 TTGAAGACAGAGATGTAGTTGGG + Intergenic
917105955 1:171492394-171492416 AGAAAGAAAAAGAAGGAGTTGGG + Intronic
918061092 1:181062004-181062026 TTAAAGACAAAGATAGAATTCGG + Intergenic
918426201 1:184412436-184412458 ATAAAGACAAAAATGGTGTATGG + Intronic
918628344 1:186684432-186684454 CTAAAGAGAGGGCTGGAGTTGGG - Intergenic
918743216 1:188163600-188163622 CTCAGGACAAGGATGGAGTATGG - Intergenic
922090979 1:222394808-222394830 ATAGAGACAGAGATGGAGTTCGG - Intergenic
922614521 1:226953853-226953875 CTAAAGAGACTCATGGAGTTTGG + Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
1063804513 10:9623149-9623171 CTAAAGAGAAAGATTTGGTTAGG + Intergenic
1064101203 10:12465866-12465888 CTAAAGAGAAAGAGAGAGTATGG - Intronic
1064198896 10:13268049-13268071 ATTATGGCAAAGATGGAGTTTGG - Intergenic
1068266875 10:54661603-54661625 CTAAGAAGAAAGATGAAGTTGGG + Intronic
1069289350 10:66758326-66758348 CAAAAGACAAAAATGGAATGAGG + Intronic
1069364202 10:67679530-67679552 CTAGAGACCAAGATAGAATTTGG - Intronic
1069448205 10:68494108-68494130 ATTAAGAAATAGATGGAGTTGGG - Intronic
1070721386 10:78759635-78759657 CTCAATACAAAGAAGGAGCTTGG - Intergenic
1071136483 10:82459926-82459948 CAAAAGACAAAGAATCAGTTTGG + Intronic
1072431177 10:95372094-95372116 ATAAAGACAAACATGGAGACTGG + Intronic
1072958116 10:99904735-99904757 CCAAAGTCAAACAAGGAGTTGGG - Intronic
1075137469 10:119796987-119797009 CTAATGACAATAATGGATTTGGG + Intronic
1075143461 10:119862367-119862389 CTAAGGACACACATGGAGTCTGG - Intronic
1076072349 10:127500426-127500448 CTAATGACCAAGATGGTATTAGG - Intergenic
1076077506 10:127547106-127547128 CTAAAAACAAAGATTGAATAAGG - Intergenic
1078336137 11:10464770-10464792 CCACAGACAAAGAGGGAGCTGGG - Intronic
1078386606 11:10898507-10898529 CTAAAGTCACACATGGAGTCAGG + Intergenic
1078483280 11:11699112-11699134 CTAAAGAAAAAGATACATTTTGG - Intergenic
1078562298 11:12383658-12383680 CTACAGAAAAAGATGTACTTTGG - Intronic
1078863895 11:15278823-15278845 CTAAAGAATAAAATGGAGTTGGG + Intergenic
1079228765 11:18631170-18631192 TTAAAAACAAAGAGAGAGTTGGG - Intronic
1079313438 11:19387328-19387350 CTAAAGAAAAGGAGGTAGTTAGG + Intronic
1085704157 11:78770987-78771009 GCAAAGACAATGATGGAGGTAGG - Exonic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086527643 11:87747320-87747342 CTAAAAAGAAACTTGGAGTTAGG - Intergenic
1086767613 11:90717737-90717759 CTAGAAACAAAGGTGGAGGTGGG - Intergenic
1086952284 11:92903576-92903598 ATAAACACACAGATGGAGATGGG + Intergenic
1087762297 11:102113513-102113535 CTACATACAAAGATATAGTTGGG + Intronic
1088094485 11:106082490-106082512 CTAAAGACAGAGTTGGCTTTTGG + Intronic
1088187244 11:107184549-107184571 CTACAGACAAATATGGAGATTGG + Intergenic
1091470592 12:723090-723112 TTAAAGACACAGATGAATTTAGG - Intergenic
1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG + Intronic
1093474956 12:19544490-19544512 CATAAGACAAAGCTGGAGATAGG + Intronic
1093962526 12:25290773-25290795 CTAGAAACAAAGATGCAATTTGG - Intergenic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1094792061 12:33926984-33927006 ATAAGGACAAAGATGTAGGTGGG + Intergenic
1096532682 12:52251754-52251776 CTAAAAGGAAAGATGGAGTGGGG - Intronic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1097362608 12:58674556-58674578 CTAAACATAGAGAGGGAGTTGGG - Intronic
1098159694 12:67638175-67638197 TTAAAGACAAACATGGGTTTGGG + Intergenic
1098381239 12:69871900-69871922 CTAAAGACATACATGGATTGAGG - Intronic
1098463409 12:70759361-70759383 CTAAAGACTAATATGGAATAAGG + Intronic
1098567649 12:71953869-71953891 ATACAGAGAAAGATGGAGTATGG + Intronic
1104400645 12:128473215-128473237 GTAAGGACAAAGATGGAGGCTGG - Intronic
1104479120 12:129091787-129091809 CTCCAGACCAGGATGGAGTTGGG - Intronic
1105286367 13:19007978-19008000 CAAAGGGCCAAGATGGAGTTAGG - Intergenic
1105443259 13:20432517-20432539 CAAAATACAAAGTTGGAATTTGG + Intronic
1106332751 13:28754520-28754542 CTAAGGGCAAAGATGAAGCTGGG + Intergenic
1107575297 13:41712647-41712669 CTAAACATAAAGATGATGTTTGG + Intronic
1111302595 13:86365221-86365243 CTTAATAAAAAGATGAAGTTTGG + Intergenic
1112269153 13:97952411-97952433 ATAATTACAAAAATGGAGTTTGG + Intergenic
1112889558 13:104212917-104212939 GTAGAGACACAGAAGGAGTTGGG + Intergenic
1113298254 13:108986323-108986345 ATAAAGACTAAGATGTAGTCTGG + Intronic
1114902315 14:27078638-27078660 TTCAAGACAAAGATGGCATTAGG + Intergenic
1116020591 14:39455475-39455497 ATATAGAAAAAGATGGTGTTGGG - Intergenic
1116626312 14:47268688-47268710 TTAGAAACAAAGATGCAGTTTGG + Intronic
1118008369 14:61585643-61585665 TTAAAGAAAAAGATGTAGGTAGG + Intronic
1118086874 14:62427758-62427780 ATAAAGACAAAGTTGGGGGTGGG + Intergenic
1118924780 14:70182214-70182236 CTAAGGACAAAGATGATGTCAGG + Intronic
1119159501 14:72441411-72441433 CCAAAGAAAAAAATGGAATTAGG + Intronic
1119751567 14:77082038-77082060 CAAAAGACAAAGATAGAAATGGG - Intergenic
1121463281 14:94098341-94098363 GTGAAGACAGAGATGGAGATGGG - Intronic
1123148182 14:106154302-106154324 CTAATGACAATGATGCTGTTTGG + Intergenic
1202847166 14_GL000009v2_random:189178-189200 TGAAAGACAAAGACAGAGTTTGG - Intergenic
1202916628 14_GL000194v1_random:179740-179762 TGAAAGACAAAGACAGAGTTTGG - Intergenic
1202876147 14_KI270722v1_random:3321-3343 TGAAAGACAAAGACAGAGTTTGG + Intergenic
1124788493 15:32704173-32704195 CTAATGATAAAGCTTGAGTTTGG - Intergenic
1129913058 15:79244077-79244099 CTATTGACAGAGACGGAGTTAGG + Intergenic
1130006384 15:80103001-80103023 CTAAAGTCATGGATGGAGGTGGG - Intronic
1131424596 15:92335211-92335233 CTAAGGACTAAGGTGGAGTGTGG + Intergenic
1133689824 16:8202559-8202581 GTGAAGACAAAGACGGAGATTGG - Intergenic
1135274373 16:21098902-21098924 AGAGAGAGAAAGATGGAGTTGGG - Intronic
1136682026 16:31973331-31973353 CTGATGACAATGATGGTGTTTGG - Intergenic
1136782334 16:32914833-32914855 CTGATGACAATGATGGTGTTTGG - Intergenic
1136887455 16:33939018-33939040 CTGATGACAATGATGGTGTTTGG + Intergenic
1140296829 16:73717095-73717117 TGAAAGACAGAGATGTAGTTGGG + Intergenic
1140347146 16:74224780-74224802 CTAAAGACTTAGAAGGAGTGGGG + Intergenic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1142037305 16:87869875-87869897 CTGAGGCCAAGGATGGAGTTTGG + Intergenic
1142382717 16:89742685-89742707 CTAAAGACAAATATGTGGCTTGG - Intronic
1203084998 16_KI270728v1_random:1178820-1178842 CTGATGACAATGATGGTGTTTGG - Intergenic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1147173692 17:38637486-38637508 CTAAAAACAAAGAAGGAACTGGG + Intergenic
1147490514 17:40861759-40861781 CTAAAGATAAAAATGGAATAAGG + Intronic
1148235318 17:45964798-45964820 AGAAAGAAAAAGATGGAGTGGGG - Intronic
1150342090 17:64376597-64376619 GTAAAGACAGAGATGGTGTTTGG - Intronic
1152062812 17:78091417-78091439 CTAAAGAGAGAGATGCGGTTAGG - Intronic
1153576950 18:6532056-6532078 CTGAAGACGAAGGTGGAGATTGG - Intronic
1153660278 18:7319917-7319939 CTACAGACAGCGATGGAGCTTGG - Intergenic
1153937400 18:9941303-9941325 CTAACAACCCAGATGGAGTTGGG - Intronic
1155000498 18:21681468-21681490 CTACAGACCTACATGGAGTTTGG - Intronic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1156965900 18:43091726-43091748 CCAAAGACAAAGATGACCTTTGG + Intronic
1157507219 18:48236624-48236646 CTAAAGCAAAAGATTGAGGTGGG + Intronic
1158322793 18:56281790-56281812 AGAAAGACTAAGATGCAGTTTGG + Intergenic
1158756094 18:60327380-60327402 CAAAAGACAAAAAAGGAGGTAGG - Intergenic
1158956352 18:62543425-62543447 CTTAAAGCAAAGCTGGAGTTTGG - Intronic
1159089217 18:63828303-63828325 CAGAAGACAAAGAGGGAGTGAGG - Intergenic
1159599388 18:70414149-70414171 CTCAAGACCCTGATGGAGTTTGG - Intergenic
1159678025 18:71310486-71310508 CTCAAGACATTGGTGGAGTTAGG + Intergenic
1159733006 18:72055192-72055214 CTGAAGTCAAAGGTGGAATTAGG - Intergenic
1159815592 18:73070642-73070664 TTATAGACAAAGATGGACTAAGG - Intergenic
1163962540 19:20710590-20710612 TTAAAGCCAGAGAAGGAGTTTGG - Intronic
1164824573 19:31275200-31275222 CTAAAGATAAAGCTGCAGTGTGG + Exonic
1165383164 19:35495191-35495213 CTAAAGAATAAGATGGAAGTTGG + Intronic
1165418640 19:35711278-35711300 CTCAAGACAAGGAAGGAGTGCGG - Intronic
1166091379 19:40511599-40511621 TTAAGGAAAAAGAGGGAGTTCGG + Intronic
1166536282 19:43576864-43576886 TTGAAGACCAAGACGGAGTTGGG - Intronic
1167753902 19:51398717-51398739 TTAAAGCCAGAGAAGGAGTTTGG - Intergenic
1202674513 1_KI270710v1_random:29492-29514 TGAAAGACAAAGACAGAGTTTGG - Intergenic
927381986 2:22489800-22489822 TTAAAGTCAAAGATGGAGAAGGG + Intergenic
928329872 2:30349451-30349473 ATAAAGACAGAAATGGAATTTGG - Intergenic
929218247 2:39437602-39437624 CTAACGACAAAGTTGGACCTTGG + Intergenic
929534606 2:42773153-42773175 TTATAGAGAAATATGGAGTTAGG - Intronic
930313952 2:49774627-49774649 CTAAGGTCAAAGATGGGGTGAGG + Intergenic
931666957 2:64616402-64616424 CCAAAGACCAAGAAAGAGTTTGG + Intergenic
931784861 2:65609469-65609491 CTAGAAACAAAGAAGGAGGTGGG - Intergenic
932897513 2:75656273-75656295 CTAAAGAAAAACATGTAATTTGG + Exonic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
935287068 2:101574453-101574475 CCAAAGGGAAAGATAGAGTTGGG - Intergenic
935443429 2:103130949-103130971 GTAAAGACAAAGAGGGAGAGTGG + Intergenic
938170346 2:129070219-129070241 CTCTAGCCAAAGATGGAGTGAGG + Intergenic
939367431 2:141251142-141251164 ATAAATAGGAAGATGGAGTTTGG + Intronic
939994177 2:148904931-148904953 CCAAAGACAAAGCTTCAGTTTGG + Intronic
941415987 2:165222229-165222251 TTAAAGAGAAAAATGTAGTTAGG - Intergenic
941994008 2:171584589-171584611 GTAAAGACAGAAATGGAGTTAGG - Intergenic
945536995 2:211029298-211029320 TTAAAAACAAATATGGAGTATGG + Intergenic
945893764 2:215459202-215459224 CTAAAGGCAAAGATCTACTTAGG - Intergenic
945991138 2:216396257-216396279 ATAAGGTCAAAGATGTAGTTGGG + Intergenic
948357071 2:237387128-237387150 CCAAAAGCAAAGATGGAGTGAGG - Intronic
948999397 2:241603676-241603698 CAAAAGAGAAAGATTGTGTTAGG - Intronic
1169063821 20:2681359-2681381 TTAAAAACAAAGATGGATATTGG + Intergenic
1171117003 20:22533700-22533722 CTAAAGGTTAAGATGAAGTTGGG - Intergenic
1173480258 20:43393026-43393048 GTACAGACAAAGATGGGGATGGG + Intergenic
1174982933 20:55418050-55418072 CTTAAGAGAAGTATGGAGTTGGG + Intergenic
1175259753 20:57667097-57667119 CCAAAGACACAGCTGGAGGTGGG - Intronic
1175482581 20:59321911-59321933 GTTAAGAAAAAGATGGAGTAAGG - Intronic
1176635983 21:9194387-9194409 TGAAAGACAAAGACAGAGTTTGG - Intergenic
1176637425 21:9260693-9260715 TGAAAGACAAAGACAGAGTTTGG + Intergenic
1177087111 21:16719305-16719327 ATATACACAAAAATGGAGTTTGG + Intergenic
1180421462 22:12868190-12868212 TGAAAGACAAAGACAGAGTTTGG + Intergenic
1182955709 22:34423953-34423975 CTAGAGACAAAGAGGGATATTGG - Intergenic
1183354764 22:37352177-37352199 CGAAAGAAAACGATTGAGTTGGG - Intergenic
950805384 3:15598699-15598721 ATAAAGAGAAAGATGTAGTTGGG - Intronic
952161327 3:30696379-30696401 CACAAGATAAAGCTGGAGTTAGG + Intergenic
953464164 3:43105215-43105237 CTAAACACACACATGGAGTCAGG + Intronic
953663994 3:44912566-44912588 CTATAGACAAAAATGGGGGTGGG - Intronic
953953304 3:47209704-47209726 CTAATGAAAATAATGGAGTTAGG - Intergenic
955160065 3:56456502-56456524 TTAAAGAGCAAGATGGAATTTGG - Intronic
957029111 3:75219929-75219951 ATAAAGATAAAGATGGCATTTGG + Intergenic
957217124 3:77335122-77335144 GTAAAGACAAAGGTTAAGTTTGG + Intronic
959017164 3:101147897-101147919 CTAGAGAAAATAATGGAGTTGGG + Intergenic
959455605 3:106557182-106557204 ATAAAGAGAAAAATGGAGATTGG + Intergenic
959957935 3:112260344-112260366 CTAAAGAAAAAAATGGACATAGG - Intronic
961523752 3:127483637-127483659 CTAAGGAGAAAAATGGAGCTGGG - Intergenic
961599007 3:128044268-128044290 CTTTAGGCAAAGATGGATTTAGG - Intergenic
962763300 3:138538191-138538213 CCAAAGACAAAGATGGAAGGTGG + Intronic
963221317 3:142816084-142816106 AGAAAGACAAGGATGGAGTGGGG + Intronic
963597422 3:147346051-147346073 CTTAACATAAAGATGGAGATGGG + Intergenic
963847961 3:150179057-150179079 CTAAAGACAAAGTAGAAGTCAGG - Intergenic
964333841 3:155633953-155633975 TTAAAAAAAAAGATGGAGTCAGG - Intronic
964704579 3:159604215-159604237 GAAAAGACAAAGATGGATGTTGG - Intronic
965089006 3:164139178-164139200 CTAATGAGAAAGATGAAGTATGG + Intergenic
966220047 3:177542449-177542471 CTAAAGCCAAATAGAGAGTTTGG - Intergenic
966983990 3:185163321-185163343 GAAAAGAACAAGATGGAGTTGGG - Intergenic
967280967 3:187823179-187823201 CTACAGACAAAGAGAAAGTTTGG + Intergenic
967854420 3:194105848-194105870 TCAAAGACAATGCTGGAGTTGGG - Intergenic
1202749470 3_GL000221v1_random:144327-144349 TGAAAGACAAAGACAGAGTTTGG - Intergenic
970568991 4:17361081-17361103 GTAAAGACAGAGGTGGAGATTGG - Intergenic
970754667 4:19411035-19411057 CAAAAGACAAAGTAGGACTTAGG - Intergenic
975957023 4:79853358-79853380 GTAAAGAAAAAGTTGGAGGTAGG - Intergenic
976044216 4:80926204-80926226 CTCAAGAAAAATATGAAGTTTGG + Intronic
976487906 4:85629761-85629783 TCAAAGACAAAGATAGAATTTGG - Intronic
976880612 4:89920252-89920274 CAAAACACAATCATGGAGTTGGG + Intronic
976966984 4:91055567-91055589 CAAAAGACAAACAGGGAATTTGG - Intronic
978944378 4:114477594-114477616 TTAAACACAAAAATGGAGATGGG - Intergenic
980348192 4:131652095-131652117 CTAAGGACTAAGAAGGAGTGGGG + Intergenic
981852872 4:149251711-149251733 CTAAAGAGAAACATGGCATTAGG - Intergenic
984876865 4:184376621-184376643 GTGAAGACAGAGGTGGAGTTTGG + Intergenic
1202752318 4_GL000008v2_random:19110-19132 TGAAAGACAAAGACAGAGTTTGG + Intergenic
987500753 5:18706821-18706843 CTAAACACAAAGACTGAGTTTGG + Intergenic
988818791 5:34860637-34860659 CTAAAGAGAAAAATGGACTCTGG - Intronic
989165670 5:38431568-38431590 ATAAGAACAAAGGTGGAGTTGGG - Intronic
989490247 5:42043056-42043078 CCAAAGAGAAAGAGAGAGTTGGG + Intergenic
991279562 5:64896654-64896676 GTAGAGAAAAAGATGGAATTAGG + Intronic
992952361 5:81872873-81872895 CTAAAGAGAAAGATAGAGAGAGG - Intergenic
993347631 5:86804854-86804876 ATAAAGACCAAGTTGGAGGTAGG - Intergenic
995264326 5:110139851-110139873 CCAAGAACACAGATGGAGTTCGG + Intergenic
995766885 5:115628205-115628227 CTGAAGACAAAGATACAGATTGG + Intronic
997868998 5:137490323-137490345 CTAAAGCCAAATCTGGAGCTTGG + Intronic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
998399371 5:141840454-141840476 ATAAAAATAGAGATGGAGTTGGG + Intergenic
1000919456 5:167120981-167121003 CTAAAGTCAAAGATCTAGTTAGG + Intergenic
1001378079 5:171281930-171281952 CCAAGGAAAAAGATGAAGTTGGG - Intronic
1001602173 5:172936027-172936049 CTAAAGATAAATATGGCATTGGG + Intronic
1002040475 5:176510199-176510221 TCAAAGAGAAGGATGGAGTTAGG + Intergenic
1004088553 6:12475444-12475466 AGAAAAACAAAGGTGGAGTTTGG - Intergenic
1004319981 6:14624840-14624862 AAAAAGACAAAGATGGAGGTGGG - Intergenic
1004594589 6:17087040-17087062 CTAAAGACAAAGGTGTGGGTGGG - Intergenic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1007782870 6:44264290-44264312 CTCCAGACCCAGATGGAGTTTGG - Intronic
1007831414 6:44641624-44641646 CAATAGACAAAGCTGGAGTTTGG - Intergenic
1010108439 6:72195493-72195515 CTAAATATAGAGATGGTGTTAGG + Intronic
1010682615 6:78814279-78814301 CAAAAGGCAAATATGGAGTGTGG + Intergenic
1013030431 6:106327214-106327236 CTAAAAAATAAGATGGATTTAGG + Intergenic
1016142007 6:140624615-140624637 CTGATGAGAAAAATGGAGTTAGG - Intergenic
1016346833 6:143122885-143122907 TTAAAGAAAAACATGGAGTCAGG - Intronic
1016406564 6:143737696-143737718 ATAAACACAAAAATGCAGTTTGG - Intronic
1016805184 6:148205423-148205445 CTAAATACAAAAAGGGACTTGGG - Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1018923888 6:168193724-168193746 TTGAAGAGAAAGGTGGAGTTGGG + Intergenic
1020656872 7:10939074-10939096 CTAAAGAAAGAAATGGAATTTGG + Intronic
1020705350 7:11537289-11537311 CTAAAGTCAATGATATAGTTTGG + Intronic
1023986389 7:45099595-45099617 GTGAAGACAACGATGGAGTTTGG + Intergenic
1024600730 7:50978661-50978683 CTCAAGTAAAAGAAGGAGTTGGG - Intergenic
1025909042 7:65812690-65812712 CAAAAAACAAAACTGGAGTTTGG - Intergenic
1026525751 7:71151997-71152019 CACAAGATAAAAATGGAGTTCGG + Intronic
1027008885 7:74724513-74724535 CTAAACACAAATTTTGAGTTAGG + Intronic
1027596901 7:80185138-80185160 GTAAAGAAAAAAATGGGGTTGGG - Intronic
1028514947 7:91667688-91667710 CTAAAGACAAAAATGGTCTCAGG - Intergenic
1028889631 7:95972399-95972421 CCAAAGACAAAGCCTGAGTTAGG + Intronic
1029833884 7:103289315-103289337 TGAAAGAAAAAGATGGACTTGGG + Intergenic
1030042777 7:105466978-105467000 CCAGAGACACACATGGAGTTTGG + Intronic
1031077636 7:117228128-117228150 CAAAAGAGAGAGATGGAGTAAGG - Intronic
1031761701 7:125720824-125720846 CTAAAGTCACAGTTGCAGTTGGG + Intergenic
1031974925 7:128087546-128087568 CTAGAGACAAAGGTGGTGCTGGG + Intronic
1033524056 7:142192732-142192754 CTGAAGAGAAAGATGGCGATGGG - Intronic
1033818453 7:145103913-145103935 CTAAAGACAGAGCAGGAGGTGGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1038091652 8:24261024-24261046 TTAAAGCCAAAGATAGGGTTTGG + Intergenic
1038163693 8:25064338-25064360 GCACAGCCAAAGATGGAGTTTGG + Intergenic
1041054579 8:53970650-53970672 GGAAAGACAAAGAAGGACTTAGG - Intronic
1041292762 8:56322179-56322201 GTAAAGATAAAGGTGGAATTGGG - Intergenic
1041521200 8:58757947-58757969 CAAAACACTGAGATGGAGTTTGG - Intergenic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1043196853 8:77305108-77305130 CAAAATACAAAACTGGAGTTGGG - Intergenic
1043310318 8:78851095-78851117 CTAATGCCAAAGATTCAGTTGGG - Intergenic
1044159324 8:88893584-88893606 CTCAAGACAAAGATAAACTTAGG + Intergenic
1044958322 8:97504839-97504861 ATAAAGACCCAGATGCAGTTAGG + Intergenic
1045987950 8:108271629-108271651 GCAAAGAGAAAGTTGGAGTTAGG + Intronic
1046120133 8:109835859-109835881 GTAATGAGAAAGATGGAGATAGG - Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1051346430 9:16154997-16155019 GTAAAGACAAAGATGGGAGTCGG - Intergenic
1051934192 9:22424600-22424622 CTAAAGCCAAAGATTCAGGTAGG + Intergenic
1052148273 9:25076981-25077003 TTAAAGAAAAGGAAGGAGTTTGG + Intergenic
1052189897 9:25647811-25647833 CCAAAGACAAAGATGAACATTGG - Intergenic
1055154047 9:73038934-73038956 CAAAAGACAGAGAAGGATTTTGG - Intronic
1055353629 9:75415023-75415045 CTCAAGAAAAGGATGGACTTTGG - Intergenic
1055767329 9:79678403-79678425 TTAAAAAAAAAGATGAAGTTAGG - Intronic
1055797037 9:79985894-79985916 AAAGAGAGAAAGATGGAGTTAGG + Intergenic
1203718111 Un_KI270742v1:174418-174440 TGAAAGACAAAGACAGAGTTTGG - Intergenic
1203652336 Un_KI270751v1:137966-137988 TGAAAGACAAAGACAGAGTTTGG - Intergenic
1186371803 X:8954569-8954591 CTAAAGACAAGGAAGGAGAGAGG + Intergenic
1186993904 X:15099416-15099438 CTAGAGACATGGATGGAGTTTGG - Intergenic
1187563045 X:20420301-20420323 TTAAAGACAAATATTGAGATTGG + Intergenic
1188356394 X:29196987-29197009 TAAAAGAAAAAGATGAAGTTGGG - Intronic
1189040787 X:37540758-37540780 TTAAAAACAGAAATGGAGTTGGG - Intronic
1189198112 X:39168499-39168521 CAGAAGAGAAAGGTGGAGTTAGG + Intergenic
1196190782 X:112792053-112792075 CTAAACACAAGGCTGGATTTAGG - Intronic
1197631401 X:128864458-128864480 CTAATGACCAACATGGACTTGGG - Intergenic
1199243070 X:145570898-145570920 GTAAGGACACAGATAGAGTTTGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic