ID: 1091495483

View in Genome Browser
Species Human (GRCh38)
Location 12:968742-968764
Sequence TGCCCAGCAAAGATCTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 3, 2: 12, 3: 67, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091495480_1091495483 10 Left 1091495480 12:968709-968731 CCACAAAGCAGCATATGCATAGG 0: 1
1: 0
2: 2
3: 8
4: 136
Right 1091495483 12:968742-968764 TGCCCAGCAAAGATCTGAGAAGG 0: 1
1: 3
2: 12
3: 67
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091495483 Original CRISPR TGCCCAGCAAAGATCTGAGA AGG Intronic
902221969 1:14972063-14972085 TTCCCAGGAAAGGTCAGAGATGG + Intronic
903789908 1:25885814-25885836 TGCTCAGCAGAGATCTGTGCTGG + Exonic
904547025 1:31283021-31283043 TACTTAGAAAAGATCTGAGAAGG + Intronic
906697653 1:47834439-47834461 TGCTCAGGAAAGACCTGAGAAGG + Intronic
907230133 1:52989892-52989914 TGCTCAGGAAAGACCTGAGAAGG + Intronic
907442811 1:54489141-54489163 TGCCCATCAAATATCGGGGAGGG + Intergenic
908017310 1:59856881-59856903 TGCCCAGAAAAGACATGAGAGGG - Intronic
908491244 1:64646299-64646321 TGCACGGCACAGAGCTGAGATGG - Intronic
908556364 1:65260588-65260610 TGGCCAGAAAAGAGGTGAGAAGG - Intronic
909364054 1:74799037-74799059 TGCCTAGTAGAGCTCTGAGAAGG - Intergenic
910521790 1:88130793-88130815 TCCTGAGCAAAGATGTGAGATGG + Intergenic
912419702 1:109534824-109534846 TCCCCAGCAAGGTTCTGAGAAGG - Intergenic
914232187 1:145773634-145773656 TGCTCAGAAAAGACCTGAGAAGG - Intronic
914354070 1:146866773-146866795 TGCTCAGGAAAGACCTGAGAAGG + Intergenic
916238761 1:162617535-162617557 TGTCCAGAAAAGACCTGAAAAGG - Intergenic
916338217 1:163697365-163697387 TGCCCAGAAATGATCTGATTTGG + Intergenic
920903955 1:210141829-210141851 TGCCCAGAAAAAACTTGAGAAGG - Intronic
921050632 1:211508904-211508926 TGCCCAGGAAAGTTATGAGTGGG - Intergenic
921228657 1:213046459-213046481 TGCTCAGGAAAGACTTGAGAAGG - Intergenic
922348689 1:224718275-224718297 TGCCATGCAAATATCTGAGGAGG + Intronic
922664077 1:227454048-227454070 TTCTCAGGAAAGATCTGTGAGGG - Intergenic
922970500 1:229732513-229732535 TTCCTAGGAAAGAACTGAGAAGG + Intergenic
922983223 1:229846503-229846525 TGCTGAGCAAACACCTGAGAAGG + Intergenic
923852954 1:237817059-237817081 TGCCCACCCAAGATCTGATCTGG - Intronic
923968326 1:239169716-239169738 TACCCAAGAAAGACCTGAGATGG + Intergenic
924310185 1:242732793-242732815 TGTCCAGCAAAGAGAGGAGATGG + Intergenic
924677644 1:246196170-246196192 TGCCCAGAATACATCTGATATGG + Intronic
1064032749 10:11893672-11893694 TGGCCAGCAAAGATGAGACAGGG + Intergenic
1064299330 10:14108924-14108946 TGACCTACAAAGATCTGGGAAGG - Intronic
1065058369 10:21871270-21871292 TACTCAGGAAAGTTCTGAGAAGG + Intronic
1065071360 10:22027553-22027575 TGCCCAGGAAATTGCTGAGATGG - Intergenic
1065650415 10:27883094-27883116 TGCTCAGAAAAGATCTCAGAAGG + Intronic
1066674171 10:37871302-37871324 TGCTCAGAAAAGACCTGAGAAGG - Intergenic
1067749396 10:48960133-48960155 TGCTCAGCATAGTTCAGAGAGGG + Intronic
1068493459 10:57754401-57754423 TGATCAGAAAACATCTGAGAAGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068716831 10:60198187-60198209 TGGCCAGCAAAGCTCTGTGGTGG - Intronic
1068907901 10:62347122-62347144 TTCCCAGAAAAGATCCGAGAAGG + Intergenic
1070424653 10:76273661-76273683 TGCCCAGAAATGTTCTGAAATGG + Intronic
1071600585 10:86956933-86956955 TGCCCAGCAGTGAGCAGAGACGG - Intronic
1071743154 10:88385600-88385622 TGCCAAGCAAAGAGCCCAGATGG + Intronic
1072514835 10:96170090-96170112 TGCTTAGAAAAGATGTGAGAAGG - Intronic
1073042190 10:100615240-100615262 TGCCCAGCCAGGAGCTGTGATGG + Intergenic
1073502319 10:103951501-103951523 TGCCTTGGAAAGGTCTGAGAGGG - Intergenic
1073518081 10:104097021-104097043 TGCTCAGGAAAGACCTAAGAAGG - Intergenic
1074444838 10:113513108-113513130 TGCTCAGGAAAGACCTGAGGAGG - Intergenic
1074448495 10:113539899-113539921 CTCGCAGCAAAGATCTGAGTGGG + Intergenic
1076441813 10:130485505-130485527 GGCCCCGCAAAGGTGTGAGATGG + Intergenic
1077779326 11:5308294-5308316 TGCCTTGCATAGATGTGAGATGG - Intronic
1079578446 11:22031666-22031688 TTCCCAGCAAAGACCTGATAAGG - Intergenic
1081047463 11:38294757-38294779 TGCCCAGGAAAGATCTTAGAGGG + Intergenic
1081539978 11:44027283-44027305 TACCCATGAAAGATCTAAGAAGG - Intergenic
1081968709 11:47184721-47184743 TGCCCAGAAAGGACCTGACAGGG + Intronic
1083783154 11:64928442-64928464 TGCCCAGCAGAGACCTGGGGAGG + Intronic
1083852443 11:65376255-65376277 TGCCCAGCCCAGATCTGCGCGGG + Exonic
1085296737 11:75435643-75435665 GGCCCAGCAGAGATCAGCGATGG - Exonic
1088249114 11:107847527-107847549 TGCCTGGCACAGATCTGAAATGG - Intronic
1088683074 11:112261040-112261062 TTCCCAGGAAAGACCTGAGGAGG + Intronic
1088795265 11:113262039-113262061 TCTCCTGCACAGATCTGAGAAGG + Intronic
1090169958 11:124592573-124592595 TACTCAGAAAAGACCTGAGAAGG - Intergenic
1090302050 11:125650999-125651021 TGCTTAGGAAAGAGCTGAGAAGG - Intronic
1090304601 11:125680353-125680375 TGCCAAGGAAAGATGGGAGATGG - Intronic
1090356550 11:126144318-126144340 GGCCCAGGAATGATCTGGGAGGG + Intergenic
1091028223 11:132160732-132160754 TGCCCAGCTGAGAGCTGAGGAGG + Intronic
1091495483 12:968742-968764 TGCCCAGCAAAGATCTGAGAAGG + Intronic
1091774571 12:3175993-3176015 TGCCCATCCAAGCTCTCAGAGGG + Intronic
1091914512 12:4260423-4260445 TGCCCAAGAAAGACCTGAGAAGG - Intergenic
1092037547 12:5350392-5350414 TGCCCAGAAAAGACTTGAGAAGG + Intergenic
1093113013 12:15175495-15175517 TGCCCAGTAAAGACCTGAGACGG - Intronic
1093117071 12:15223870-15223892 TGCCCAGCAAACATATGTCATGG - Intronic
1095763946 12:45873421-45873443 TGCTCAGCTAACATCAGAGAAGG - Intronic
1096846302 12:54408941-54408963 TGCCCAGCTGAAATCTGTGAGGG + Exonic
1098189628 12:67934609-67934631 TTCTCAGAAAATATCTGAGAAGG + Intergenic
1098428618 12:70394326-70394348 TGCCCAGCCTAGAGCAGAGATGG - Intronic
1099165329 12:79299524-79299546 TGACCTGCAAAGTGCTGAGAAGG + Exonic
1099653706 12:85461920-85461942 TGCCCAGCCAATATCTTACATGG + Intergenic
1099673062 12:85719042-85719064 CACCCAGGAAATATCTGAGAAGG - Intergenic
1099750975 12:86772200-86772222 TATCCAGGAAAGATCTGTGAAGG + Intronic
1101476569 12:105055095-105055117 TGCCCAGAAAAGACCTCAGAAGG + Intronic
1101883934 12:108645286-108645308 TGCCCAGCCAAGCTCAGAGTAGG - Exonic
1101954407 12:109200640-109200662 TTCCCAGCAAATATATGAGATGG + Intronic
1102574948 12:113850302-113850324 TACCCAGGAAAGCTCTGAGCAGG + Intronic
1102578004 12:113869191-113869213 TTCCCAGAAAAGACCTGAGATGG + Intronic
1102941190 12:116943665-116943687 TGCCCAGGAAAGACCAGAGAAGG - Intronic
1103839301 12:123849790-123849812 AGCCCTGCCAAGATCTGAGGAGG - Intronic
1104846712 12:131850695-131850717 TGCCCAGATAATATCTGAGATGG - Intronic
1104997060 12:132664656-132664678 TGCCCAGGAAGGATCTGGAAGGG + Intronic
1105402189 13:20105518-20105540 TCACCAGCAAAGTTCTCAGAAGG - Intergenic
1105576237 13:21654973-21654995 TCTCCATCAAAGGTCTGAGAGGG + Intergenic
1105822396 13:24091227-24091249 TGCCCAAGCAAGATCTTAGAAGG - Intronic
1106181622 13:27374294-27374316 TGCCCAGCAAAGTCCTGACTTGG + Intergenic
1106322513 13:28655234-28655256 TGCCCAGAACAGTTGTGAGAGGG - Intergenic
1106485593 13:30169546-30169568 TGCTCAGAAAAGACCTAAGAAGG + Intergenic
1106641323 13:31587213-31587235 TGCCCAGCAAAGCTGTGAGGGGG + Intergenic
1106790191 13:33147297-33147319 TACCCAGGAAAGACCTGAGCTGG + Intronic
1106974432 13:35190341-35190363 GGCCCAGGGAAGACCTGAGAAGG + Intronic
1107508203 13:41056819-41056841 TGGTCAGAAAAGATCTGAGAAGG + Intronic
1109255910 13:60081861-60081883 GGCCCAGAAAAGATCTGAAGGGG + Intronic
1112797919 13:103077427-103077449 TGCCCACCAAATAGCTAAGATGG - Intergenic
1113962188 13:114132343-114132365 TCCCCAGCAAGGATCTGCGGAGG + Intronic
1114190209 14:20435202-20435224 TGCCCAGCAGACATGCGAGAGGG - Intronic
1114669922 14:24404786-24404808 TGCCAAGCAAATCTCTGAGTGGG + Intronic
1115174721 14:30548931-30548953 GGCTCAGCAAAGACCAGAGAAGG - Intergenic
1115564867 14:34616526-34616548 TGCCCAGCTAATTTTTGAGATGG + Intronic
1115910350 14:38249749-38249771 TACCCAGGAAAGATCTGAGAAGG + Intergenic
1118943153 14:70357347-70357369 TGCCCAAGAAAGACCTGAGAAGG + Intronic
1120353417 14:83394350-83394372 TGCTCAGGAAAGACCTGAAAAGG + Intergenic
1120441607 14:84547933-84547955 TGACCAGCAATGAGCTGAGAGGG - Intergenic
1120977770 14:90264653-90264675 TCCCTAGCAGAGATCTGTGATGG - Intronic
1121228034 14:92336038-92336060 GGCCCAGCAAAGAGAAGAGATGG - Intronic
1121694346 14:95900591-95900613 TCCCCAGCACAGACCTAAGAAGG - Intergenic
1124135117 15:27028473-27028495 TTCCCATCAGAGATCTGAGCAGG + Intronic
1124403108 15:29367626-29367648 TGCCCAGGAAAGCCCTGAGAAGG + Intronic
1124618283 15:31258392-31258414 TGGCCAACAAACATATGAGAAGG + Intergenic
1124716294 15:32065615-32065637 TGCTCAGGAAAAATCTGAGAAGG + Intronic
1124800260 15:32825825-32825847 TGCCGAGCAAAGATAAGAGACGG - Intronic
1124921143 15:34027956-34027978 TGCGCAGAAAAGATCTGAGAAGG + Intronic
1126035564 15:44542187-44542209 CACCCAGCATAGTTCTGAGATGG + Intronic
1126406200 15:48325190-48325212 TGCCCTCCAAAGATGAGAGAGGG + Intergenic
1127065392 15:55232015-55232037 TGCCCAGGAAAGATCTAAAAAGG + Intronic
1127579930 15:60328981-60329003 TGGACCGCCAAGATCTGAGATGG + Intergenic
1127971917 15:63968471-63968493 TGTCCAGCAGAGAGCTGAGTTGG - Intronic
1128534053 15:68477017-68477039 TGCTATGCAAATATCTGAGACGG - Intergenic
1128551135 15:68598710-68598732 TGCCCAGCAAAGAGATGGGAAGG - Intronic
1129316283 15:74746997-74747019 TGCCCGGCATGGATGTGAGAGGG - Intergenic
1129334695 15:74844974-74844996 TGCCCAGCACAGACCTGGCAGGG - Exonic
1129509285 15:76108732-76108754 TACCCAGGAAAGATCAAAGATGG - Intronic
1130210937 15:81920668-81920690 AGCTCAGAAAAGACCTGAGAGGG + Intergenic
1130431722 15:83855176-83855198 TGCCCAGAAACAACCTGAGAAGG - Intronic
1131715025 15:95099744-95099766 TGCTCAGGAAAGACCTGAGAAGG + Intergenic
1131718481 15:95140458-95140480 TGCTCAAGAAATATCTGAGAAGG - Intergenic
1132268011 15:100494806-100494828 TGCTCAGGAAAGACCTGGGAAGG - Intronic
1133128873 16:3664194-3664216 CACCCAGCACAGAGCTGAGAAGG + Exonic
1133995993 16:10748662-10748684 TGCTCAGTAAAGGTCTGTGATGG + Intronic
1134902246 16:17949093-17949115 CTTCCAGCAAAAATCTGAGAAGG + Intergenic
1135177401 16:20242824-20242846 TGCCCAGGAAAGACCTGAACAGG + Intergenic
1135908165 16:26533080-26533102 TACTCAGAAAAGATTTGAGAAGG + Intergenic
1137066424 16:35850122-35850144 TGTCCAGGAAAGAACAGAGATGG - Intergenic
1137416544 16:48287255-48287277 TATCCAGGAAAGACCTGAGAAGG - Intronic
1139048526 16:63094234-63094256 TGCCCACCAAAAATTTAAGAAGG - Intergenic
1139361139 16:66401008-66401030 TGCCCAGCACTGACCTGTGATGG - Exonic
1139979949 16:70848764-70848786 TGCTCAGGAAAGACCTGAGAAGG - Intronic
1140924605 16:79570309-79570331 AGGCCAGCAAAGAGCTGAGGAGG - Intergenic
1141885626 16:86890259-86890281 TGCCCAGCCAACAGGTGAGATGG + Intergenic
1143221342 17:5264647-5264669 TGCCCAGGAAAGACCCGAGAAGG - Intergenic
1143221380 17:5265077-5265099 TGCCCAAGAAAGCCCTGAGAAGG + Intergenic
1143446421 17:7012772-7012794 TCCCCGGCAAGGATCGGAGAGGG + Intronic
1144242216 17:13323688-13323710 TGCTCAGGAAAGAACTGAGAAGG - Intergenic
1147282787 17:39376499-39376521 TACTCAGGAAAGACCTGAGAAGG + Intronic
1148195195 17:45708157-45708179 TGCCCAGGAAAGACCTGAGGGGG - Intergenic
1148867770 17:50637881-50637903 TCCCCAGCAAACAGCTGAAATGG - Intronic
1149306437 17:55351327-55351349 TGCCCAGGAAAGATCTGAGAAGG + Intergenic
1149686912 17:58541108-58541130 TGGTCAGCAAAGAGCAGAGAAGG - Intergenic
1150657298 17:67047835-67047857 TGCTCAGGAAAGACCTGAGAAGG + Intronic
1151026522 17:70683913-70683935 AGCCCAGCAATGAGCTGAGCTGG + Intergenic
1152331021 17:79673095-79673117 TGGACAGAAAAGATCTGAGAAGG + Intergenic
1152496664 17:80677628-80677650 TGCCCAGCAAACGCCTGAAAAGG - Intronic
1153112915 18:1614689-1614711 TGCTCAGAAAAAAGCTGAGAAGG + Intergenic
1153470022 18:5433755-5433777 TGCACAGTAAAATTCTGAGATGG - Intronic
1154000162 18:10475922-10475944 TCCCCAGGACAGCTCTGAGAAGG + Intronic
1155090977 18:22510904-22510926 TGACCAGGAAAGCACTGAGAAGG - Intergenic
1155417643 18:25617128-25617150 TAACCAGAAAAGATCTTAGAGGG + Intergenic
1155772176 18:29715437-29715459 TGCCCAGGAAATATCAGAGGTGG + Intergenic
1155907341 18:31467960-31467982 TGCCAAAGAAAGATCAGAGAGGG + Intronic
1156838754 18:41586541-41586563 TGCCCAGCAAATCACTGAAAAGG + Intergenic
1156853536 18:41755663-41755685 TGCCCAGCAAAGAGGGGAGGAGG - Intergenic
1160139312 18:76306793-76306815 TGCCTAGCAAAGGTCGGAAAGGG - Intergenic
1161895870 19:7079951-7079973 TGCTCAGAGAAGATCTGAGAAGG - Intronic
1162173849 19:8814581-8814603 TGCCCAGAAAATACCTGAGAAGG + Intronic
1162292400 19:9789967-9789989 TGCCCAAGAAAGCTCTGAGATGG - Intronic
1163023119 19:14494394-14494416 AGCCCAGCAAAGATCAGGCAAGG - Intronic
1164898156 19:31895613-31895635 CACCCAGCCAAGATCTGGGAAGG + Intergenic
1165722945 19:38092661-38092683 TGCCCAGCATAGAGCTGGGACGG - Intronic
1168675782 19:58277189-58277211 GGCCCAGCAAAAAGCAGAGACGG + Intronic
925437554 2:3853540-3853562 TGCCCAGGAAAGACCTGAGAAGG - Intergenic
926035768 2:9634469-9634491 TGACAAGCAAACATCTGAGTGGG + Intergenic
926564210 2:14452265-14452287 TGCCCAGCAGAGCTATGGGAGGG - Intergenic
927172452 2:20381517-20381539 TGCTCAGAAAAGACCTGATAAGG - Intergenic
927494081 2:23540841-23540863 TGCCCAGAAAAGATGTAAGCAGG - Intronic
928318246 2:30262728-30262750 TGCCCACCAAAGATTGGAGAGGG + Intronic
928477724 2:31647621-31647643 TGGCCAGCAGAGATGAGAGAGGG - Intergenic
928920407 2:36520961-36520983 TACCTAGCAAAGCTCTAAGAGGG - Intronic
929786081 2:44993127-44993149 TGCCCAGGTAAGACCTGAGAAGG - Intergenic
930099532 2:47592171-47592193 TGCCCAGAAAAGAGATGAGAGGG + Intergenic
931157098 2:59647237-59647259 TGCCCAGGAAATACTTGAGAAGG + Intergenic
931825271 2:65994029-65994051 TCCCAAGCAAAGACATGAGATGG - Intergenic
933649385 2:84837811-84837833 TGCCCAGGAAAGACCTGAGAAGG - Intronic
933783094 2:85815242-85815264 TGCCCAGCACAGAGTTTAGAGGG - Intergenic
935730189 2:106058947-106058969 GGCCCTGCACAGAGCTGAGAAGG + Intergenic
936405974 2:112203155-112203177 TGCCCAAGAAAGACCTGAAAGGG + Intergenic
936777751 2:115994547-115994569 TGCCTAGCAGAGCTGTGAGAAGG + Intergenic
936832805 2:116669559-116669581 TACCCAGGAAAGATTTGATAAGG - Intergenic
938048828 2:128148637-128148659 TGCCCAGGGAAAATCTTAGAAGG - Intronic
940961369 2:159790093-159790115 TGCTCAGCAAATGTCTGATATGG - Intronic
941255091 2:163219388-163219410 TGCCCAGGTAACACCTGAGAAGG + Intergenic
943338424 2:186646775-186646797 TGCCCTTCAAGGATTTGAGATGG - Exonic
944037683 2:195315385-195315407 TGCCCTGCAAAGGGCTGAGCTGG - Intergenic
945106331 2:206319101-206319123 TGCCTGGGAAAGACCTGAGAGGG + Intergenic
948579521 2:238974941-238974963 TGCCCAGGAAAGACCTGATGGGG + Intergenic
948722888 2:239912502-239912524 TGCCCAGGAAAGACCCCAGAAGG - Intronic
1168816690 20:742688-742710 TTTCCTGCAAAGAACTGAGAAGG - Intergenic
1170396705 20:15933577-15933599 TGCCTGGCAAAGCTCTAAGAGGG + Intronic
1170540631 20:17384168-17384190 AACACAGCAAAAATCTGAGAGGG + Intronic
1170609371 20:17899866-17899888 TGCTCAGCAGAGATCTGGGCTGG + Intergenic
1172712204 20:36934163-36934185 TTTCCAGGAAAGATCTGAGGTGG + Intronic
1173172260 20:40736881-40736903 GGCCCAGCACACATCTGTGATGG - Intergenic
1174131639 20:48348585-48348607 TGCTCAGGAAAGAACCGAGAGGG - Intergenic
1176901021 21:14442189-14442211 TGCCTAGCAAATATCACAGATGG - Intergenic
1178393260 21:32216676-32216698 TGCCCAAGAAAGACCTGAGAAGG + Intergenic
1178715832 21:34963551-34963573 TGCCCAGCAACCATGGGAGAAGG + Intronic
1179505898 21:41840120-41840142 TGCAAAGCAAAAACCTGAGAAGG + Intronic
1180756634 22:18166688-18166710 TGCCCAAGTAAGACCTGAGAGGG - Intronic
1181075131 22:20370744-20370766 TGCCCAAGTAAGACCTGAGAGGG + Intronic
1182778834 22:32851271-32851293 TGGTCAGCAGAGAGCTGAGAGGG + Intronic
1183474567 22:38028917-38028939 TGCCCATCAATGAGCTGTGATGG - Intronic
1184325805 22:43783393-43783415 TGCTCAGGAAAGACCTGAGAAGG + Intronic
1185103024 22:48851768-48851790 TGAGGACCAAAGATCTGAGATGG - Intergenic
1185233285 22:49695341-49695363 TGCCCAGCAAAGCTCTCAGCTGG - Intergenic
949287295 3:2421632-2421654 TGCCCAGTGAAGATGTGAAAAGG - Intronic
950244585 3:11404547-11404569 TGCTCAGGGAAGATCTGAGAAGG - Intronic
952818779 3:37468155-37468177 TGCCCAGCAAACACCTGGGGAGG + Intronic
953288758 3:41640501-41640523 TTCCTAGCAAAGAACTGAGGAGG + Intronic
953382720 3:42486367-42486389 TGCCCAGCAAGGAGCTTAGCAGG + Intergenic
953403347 3:42646346-42646368 TGCCAAGCATAGAACTGTGAAGG + Exonic
955919455 3:63940159-63940181 TGCCCAGAAAGGACCTGAGAAGG + Intronic
956079186 3:65539470-65539492 TGCCAAGCAACCATCTGAAATGG + Intronic
956943445 3:74192180-74192202 TGCCCAGCAAAGTACTGAGAAGG - Intergenic
959262342 3:104098307-104098329 TGCCCAGAACAGATGTGAAAAGG + Intergenic
960109597 3:113832919-113832941 TGCTCAGAAAAGACCTAAGAAGG - Intronic
961048829 3:123729098-123729120 TGCCCAGGAAAGATGTAAGAAGG + Intronic
962535338 3:136324484-136324506 CGATCAGAAAAGATCTGAGAGGG - Intronic
963285448 3:143430603-143430625 TGCTGAGCCCAGATCTGAGAGGG + Intronic
963583247 3:147153675-147153697 TGCCTAGGAAATATCTGAGAAGG + Intergenic
964018825 3:151982014-151982036 TGCACATCATAGATCTGATAAGG - Intergenic
967044490 3:185724174-185724196 TGCCCGGCTAAGATCTGAAGAGG + Intronic
967266878 3:187699062-187699084 TGCCCTGAGAAGCTCTGAGAGGG + Intronic
967848292 3:194062133-194062155 TGCCCTGCATAGATCAAAGATGG + Intergenic
969172875 4:5377983-5378005 TGCCCACCAAGGATTTGAGATGG + Intronic
972155026 4:36149998-36150020 TTCACACCAAAGATCTTAGATGG + Intronic
973565125 4:52178024-52178046 TGCCCAGGAAAGATCTGAGATGG + Intergenic
974211605 4:58783880-58783902 TGGTTAGCAAGGATCTGAGAAGG - Intergenic
975873671 4:78810288-78810310 CGCCCAGGAAAGAACTGAGAAGG - Intronic
976373328 4:84315463-84315485 TGTCCAGTGAATATCTGAGAAGG - Intergenic
976960476 4:90965362-90965384 TGCCCAAGAAAGACCTGACAAGG + Intronic
977604585 4:98970221-98970243 TGCCCAGAATAGAGCTGAAATGG + Intergenic
978083737 4:104624345-104624367 TGCCCAGTTATGATCTGAAAAGG + Intergenic
978167744 4:105629225-105629247 TGCTCAGCAAAGCTCTGAATTGG + Intronic
979205233 4:118031160-118031182 TGCCCAGCAGAGAGGTAAGAAGG - Intergenic
980028852 4:127801158-127801180 TGCCGAGAGAAGATCTGTGATGG + Exonic
980804854 4:137798941-137798963 TGCTCAGGAAAGACCTGAGAAGG - Intergenic
982031411 4:151304785-151304807 TGCTCAGAAAAGACCTGAGAAGG + Intronic
982598381 4:157414247-157414269 TGGGAAGCAGAGATCTGAGATGG + Intergenic
983045630 4:162983565-162983587 TTCTCAGGAAAGACCTGAGAAGG - Intergenic
984789261 4:183599995-183600017 TGCTCAAGAAAGACCTGAGAAGG - Intergenic
984816879 4:183847211-183847233 TGCTCAGAATAGACCTGAGATGG - Intergenic
986615281 5:9610537-9610559 TGCTGAGGAAAGACCTGAGAAGG + Intergenic
987097027 5:14559198-14559220 TCCCCAGCAGAGATCAAAGATGG + Intergenic
988051831 5:26041435-26041457 TGCCCAGCCAAGGACTGAGAGGG + Intergenic
988320320 5:29686413-29686435 TGCCCAGCAGAGACATGAGGTGG - Intergenic
992347497 5:75894841-75894863 TGCCCAGGAGAGACTTGAGAAGG + Intergenic
992818312 5:80467306-80467328 TGCCCAGGAAAGACCTGGGAAGG + Intronic
993690542 5:90995007-90995029 TGTTCAGGAAAGACCTGAGAAGG - Intronic
995044646 5:107632030-107632052 TGCCCAGCACATGGCTGAGAGGG + Intronic
995074987 5:107972065-107972087 TGCCCAGCAAATGTGTGTGAAGG + Intronic
995461690 5:112410433-112410455 TGTCCAGCTGAGAACTGAGAAGG + Intronic
996152405 5:120055971-120055993 TACTGTGCAAAGATCTGAGATGG + Intergenic
996755738 5:126933043-126933065 TGCCCAGTAAACATCTAAGTGGG - Intronic
997707538 5:135972057-135972079 TGCTCAGGAAAGACATGAGAAGG - Intergenic
999205469 5:149844987-149845009 ACTCCAGCAAAGACCTGAGATGG + Intronic
999612970 5:153390731-153390753 TGTTCAGCCAAGACCTGAGAAGG - Intergenic
999976848 5:156920582-156920604 TGCCCCGCAAAGAGCAGATATGG + Intronic
1001174680 5:169456987-169457009 TGTCCAGGAAAGACATGAGAAGG - Intergenic
1001882445 5:175256238-175256260 TGCTCTGCAGAGTTCTGAGATGG + Intergenic
1001917337 5:175572708-175572730 TGCCAATCAAATATCTGATAAGG + Intergenic
1003037170 6:2652384-2652406 TGCCTACAAAATATCTGAGAAGG + Intergenic
1004134561 6:12954214-12954236 TGTGCAGCAAAGAGCTGAGCTGG + Intronic
1004741369 6:18464409-18464431 TGCCCAGCAATGATCTGAATTGG - Intronic
1005507786 6:26485001-26485023 TGCTCTGGAAAGACCTGAGAAGG + Intergenic
1006582113 6:35083168-35083190 TGCTGATCAAAGATCTGCGAGGG + Exonic
1006890020 6:37419000-37419022 TGCCCGGGAGAGATCTGAGAAGG - Intergenic
1007146789 6:39642801-39642823 TGCCCAGAAAAGACCTGAGAAGG + Intronic
1007563424 6:42829618-42829640 TGGCCAGAAATGAGCTGAGAGGG - Exonic
1008391675 6:50959315-50959337 AGCCCTGCATAGATATGAGAAGG + Intergenic
1008707715 6:54182917-54182939 TGCAGAGGAAATATCTGAGATGG + Intronic
1009644431 6:66378972-66378994 TGCCTAGAAAAGAACTCAGAAGG + Intergenic
1010301526 6:74265964-74265986 TTTCCAGGAAAGGTCTGAGAGGG - Intergenic
1010509981 6:76706484-76706506 TGCCAAACATAGATCTGATAAGG - Intergenic
1013871640 6:114769343-114769365 TGCCCTGGAAAGACCTGTGAAGG + Intergenic
1014154644 6:118096419-118096441 TTCCCAACAAAGATTTGAGATGG - Intronic
1014374245 6:120652530-120652552 TGCTCAGCAAATATTTGAAAGGG - Intergenic
1015277105 6:131394759-131394781 TGCCCAGGAAAGAATTGAGAAGG - Intergenic
1015852402 6:137588200-137588222 AACCCAGCAAACACCTGAGATGG + Intergenic
1015886590 6:137924335-137924357 CGCCCAGGACAGATCTGAGGGGG + Intergenic
1016709092 6:147148788-147148810 TACCCAGGAAGGATCTGAGAAGG - Intergenic
1016997988 6:149974508-149974530 TGCCCAGGAAGCACCTGAGAAGG + Intergenic
1017000286 6:149991712-149991734 TGCCCAGGAAGCACCTGAGAAGG - Intergenic
1017010513 6:150060211-150060233 TGCCCAGGAAGCACCTGAGAAGG - Intergenic
1017290720 6:152732926-152732948 TGCCCAGGAAGGCTGTGAGAAGG - Intergenic
1017466964 6:154703414-154703436 AGCCGAGCAAGGATCTGGGAGGG - Intergenic
1017525777 6:155240419-155240441 TGCTCAGCAGGGATCTCAGAGGG - Intronic
1017562400 6:155642929-155642951 TACTCAGGAAAGATCTGAGAAGG - Intergenic
1017932479 6:158970465-158970487 TGCCCAGAAAAGAGCTAAGAAGG - Intergenic
1019922467 7:4171780-4171802 TGCCCACCACAGACCAGAGATGG - Intronic
1021475774 7:21058990-21059012 TGCTCAGGAAAGACCTTAGAAGG - Intergenic
1022425669 7:30266623-30266645 TGCTTAGGAAAGACCTGAGAAGG - Intergenic
1026669615 7:72377869-72377891 TGCCCAGGAAGGACCTGAGGAGG - Intronic
1028635242 7:92981355-92981377 TGCCCAGGAAAGAACTGAGAAGG - Intergenic
1028767601 7:94577570-94577592 TGCTCAGGAAAGACCTAAGAAGG - Intergenic
1028782173 7:94749819-94749841 TGCTCAGAAAAGACCTGAGAAGG + Intergenic
1029235404 7:99112165-99112187 TGCTCAGAAAAGACCTAAGAGGG + Intronic
1031468546 7:122143568-122143590 TCTCCAGCAAGGATCGGAGATGG - Intronic
1032225917 7:130031716-130031738 TGCCCAGCAAAGACCTGAAAAGG + Intronic
1032598455 7:133267117-133267139 TTCCCAAAAAAGATGTGAGATGG - Intronic
1032692470 7:134302728-134302750 TGATCACCAAAAATCTGAGAGGG - Intronic
1032788388 7:135220401-135220423 TGCCCAGAAAAGAACTAAGAAGG + Intergenic
1032805532 7:135350325-135350347 TACCCAGCAAAGACATCAGATGG - Intergenic
1033019071 7:137703402-137703424 TGCTCAGGAAAAATCTGAGAAGG + Intronic
1033715620 7:143998844-143998866 TGCTCAGAAAAGGCCTGAGAAGG + Intergenic
1037875970 8:22548667-22548689 TGCCCAGGGTAGATCTCAGAGGG + Intronic
1038349432 8:26762777-26762799 TCCACAGCAGAGCTCTGAGATGG - Intronic
1038389980 8:27188034-27188056 AGCTGAGCAAAGATCTGAGGAGG - Intergenic
1038989537 8:32852956-32852978 GGCTCAGAAAATATCTGAGAAGG - Intergenic
1039023293 8:33230610-33230632 TGCCTGGCAGAGCTCTGAGAGGG + Intergenic
1039610923 8:38918831-38918853 CTCCAAGCTAAGATCTGAGATGG - Intronic
1040325411 8:46339115-46339137 AGCCCAGGAAAATTCTGAGATGG - Intergenic
1040738171 8:50536787-50536809 TGCCCGGCACAGATTTGAGTCGG + Exonic
1043780297 8:84325692-84325714 TGCCCAGTTAGTATCTGAGATGG + Intronic
1044619936 8:94179520-94179542 TGCCTGGGAAAGACCTGAGAAGG + Intronic
1045178593 8:99755135-99755157 TGCTCAGGGAAGACCTGAGAAGG + Intronic
1045830090 8:106448277-106448299 TGCACAGCAAACATATCAGAAGG - Intronic
1048566594 8:135606206-135606228 TGCCCAGAAAAGACCTGAGAGGG - Intronic
1048628924 8:136219016-136219038 TCCCCAGCAAAGGCCTGGGAGGG - Intergenic
1049404148 8:142444224-142444246 GGGCCAGCAAAGGTCAGAGAAGG - Intergenic
1050399714 9:5239528-5239550 TGCTCAGACAAGATCTCAGAAGG + Intergenic
1050945427 9:11511129-11511151 TGCCTAGTGAAGATGTGAGAAGG + Intergenic
1053585948 9:39458931-39458953 TGCTCTGGAAAGATGTGAGAAGG + Intergenic
1054580359 9:66906291-66906313 TGCTCTGGAAAGATGTGAGAAGG - Intronic
1054838392 9:69706001-69706023 TGCTCAGGAAATACCTGAGAAGG - Intergenic
1056148972 9:83765446-83765468 TGCCTAGCAGAGCTATGAGAAGG + Intronic
1056471931 9:86913789-86913811 TTCCTACCAAAGATCTGGGATGG - Intergenic
1056883019 9:90415014-90415036 TGCTAAGCCAAGATCTGGGAAGG - Intergenic
1057148948 9:92778903-92778925 TGCTCAGGAAAGACATGAGAAGG + Intergenic
1058326660 9:103706887-103706909 TTGCCAGCAAAGCTCTAAGATGG - Intergenic
1059117049 9:111609202-111609224 TCCCCAACAACGATGTGAGAAGG - Intergenic
1059193144 9:112346012-112346034 TGCCCAGCTAATTTTTGAGACGG + Intergenic
1059460989 9:114429915-114429937 TGCCCAGCAGAGATGAGAGATGG - Intronic
1059553017 9:115249537-115249559 TGCAAACCAAAGATCTGACAAGG - Intronic
1061764975 9:132875826-132875848 TCCCCAGCAAACATCTGCGCTGG - Intronic
1061931850 9:133837147-133837169 TTCCCAGCAGACCTCTGAGAAGG - Intronic
1062746460 9:138215859-138215881 TGCCCAGCAGACATCTCAGCTGG + Intergenic
1187865985 X:23723819-23723841 TGTCCAGCAAAGAAATCAGATGG + Intronic
1188485210 X:30674885-30674907 TGACCAGCACAGAGCTGAGGGGG - Intronic
1189471102 X:41314964-41314986 AGCCAGTCAAAGATCTGAGATGG - Intergenic
1189555105 X:42135124-42135146 TGCTCAGAAAAAACCTGAGAAGG + Intergenic
1189638333 X:43037599-43037621 TGCTCAGGAAAGATCTGAGAAGG - Intergenic
1190574920 X:51825727-51825749 TGCTCAGGAAACACCTGAGAAGG - Intronic
1191781382 X:64871501-64871523 TGCAAAGGAAAGACCTGAGAAGG - Intergenic
1193317622 X:80082091-80082113 TGTCCAGGAAAGACCTGAGAAGG - Intergenic
1193787513 X:85777716-85777738 TTCCCACCTGAGATCTGAGATGG + Intergenic
1193982650 X:88202711-88202733 TGCCCAGGAAAGATCTGAGAAGG + Intergenic
1194900489 X:99503575-99503597 AGCACGGCAAAGAGCTGAGATGG - Intergenic
1195623298 X:106981097-106981119 TGCCCAGCATAGATATCAGTTGG - Intronic
1196113735 X:111975045-111975067 TGCCCAGAAAGCACCTGAGAAGG + Intronic
1196323553 X:114372773-114372795 TGCCCATGAAAGAACTGAGAAGG + Intergenic
1196363062 X:114889419-114889441 TGCTTAGGAAAGACCTGAGAGGG - Intronic
1197249733 X:124202437-124202459 TGCTCAGGAAAGAACTGAGAAGG + Intronic
1197621096 X:128749846-128749868 TGCTCAGGAAAGGCCTGAGAAGG + Intergenic
1197825042 X:130580284-130580306 TGCACAGCAGAGATCTCAGGAGG + Intergenic
1197825252 X:130582728-130582750 TGCACAGCAGAGATCTCAGGAGG - Intergenic
1199189292 X:144951618-144951640 TGCCTAGCAGAGCTATGAGAAGG - Intergenic
1200242109 X:154502211-154502233 TGCCCAGCAACTTTTTGAGACGG - Intergenic
1201538558 Y:15080451-15080473 AGCTCAGCAAACATCTGAGCTGG - Intergenic