ID: 1091503357

View in Genome Browser
Species Human (GRCh38)
Location 12:1041046-1041068
Sequence CTACATAAACAAAAGCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 2, 2: 24, 3: 84, 4: 489}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091503357 Original CRISPR CTACATAAACAAAAGCTGCT TGG (reversed) Intronic
900282411 1:1879274-1879296 CCTCATAAACAAAAGCCCCTGGG - Intronic
901096625 1:6686161-6686183 TCACATAAACAAAAGCTCTTTGG + Intronic
902661070 1:17904273-17904295 CTAAATAAACAAAAGGGGCCTGG + Intergenic
903990632 1:27266002-27266024 CCATATAAACAAAAGCTCTTTGG + Intronic
904220383 1:28962781-28962803 CTACATAAACAAAAAGTTATGGG - Intronic
906949788 1:50325224-50325246 TCACATAAACAAAAGCTCTTTGG + Intergenic
906973009 1:50537491-50537513 CCACATAAACAAAAGTTCTTTGG - Intronic
906978377 1:50600951-50600973 CCACATAAACAAAAGCTCTCTGG + Intronic
907630704 1:56079083-56079105 GTACATAAACAAAAGCACTTTGG + Intergenic
907814625 1:57906181-57906203 CTACATACACAATGGCTGCTGGG - Intronic
909675232 1:78231904-78231926 TCACATAAACAAAAGCTCTTTGG + Intergenic
910179908 1:84471199-84471221 CCACACAAACAAAAGCTCTTTGG + Intergenic
910420524 1:87057252-87057274 CCACATAAACCAAAGCTCTTTGG + Intronic
910558226 1:88560755-88560777 CTAAAGAAAAAAATGCTGCTGGG - Intergenic
910798886 1:91125545-91125567 CCACATAAACCAAAGCTCTTTGG - Intergenic
911860162 1:102937183-102937205 CCACATAGACAAAAGCTTTTTGG + Intronic
912775050 1:112501683-112501705 CCACATAAACAAAAGCTCTTTGG + Intronic
914442392 1:147718862-147718884 ATACATAAACATAGGCTTCTGGG - Intergenic
915967572 1:160324764-160324786 CCACATAAACAAAAACTCTTTGG + Intronic
916433180 1:164751956-164751978 CTATATAAACAGAAGCTATTTGG + Intronic
917986169 1:180321171-180321193 CTATAGTAACAAAAACTGCTTGG - Intronic
918330093 1:183451020-183451042 CCACATAAACAAAAGCTCTATGG + Intergenic
918884485 1:190173652-190173674 CTTCACAAACAAAAGCTCTTTGG - Intronic
919230820 1:194771691-194771713 CTACAAAAACAAAATTAGCTGGG - Intergenic
920320270 1:205116365-205116387 CTACATAAACAAAAACTCTCTGG + Intronic
920449577 1:206049107-206049129 CTACATAAACAATAGCGTTTTGG - Intronic
922263443 1:223962916-223962938 CTAAATATACAAAATCAGCTGGG + Intergenic
923125474 1:231030745-231030767 CCACATAAACCAAAGCTCTTTGG - Intronic
923125665 1:231032616-231032638 TCACATAAACAAAAGCTCTTTGG - Intronic
923892473 1:238231356-238231378 CCACATAAACAGAAGCTCTTTGG + Intergenic
924361907 1:243250168-243250190 TTACATAAATAAAAGATGCTGGG - Intronic
924932597 1:248744045-248744067 CCACATAAACAAAAGTTCTTTGG + Intronic
1063129391 10:3164608-3164630 CCACATAATCAAAAGCTGTTTGG - Intronic
1063370736 10:5521248-5521270 CCACATAAACACAAGCTCTTTGG + Intergenic
1063383187 10:5599608-5599630 CCATATAAACAAGAGCTCCTCGG + Intergenic
1063732883 10:8719799-8719821 CTTCAAAGACAAAGGCTGCTAGG + Intergenic
1063790350 10:9438036-9438058 TTCCATAAACAAAAGCTCCTTGG + Intergenic
1064912051 10:20413182-20413204 CTAAAAAAACAAAATCAGCTGGG - Intergenic
1066525584 10:36275520-36275542 CTACAATAACAAAAGCAGCATGG + Intergenic
1067108332 10:43380488-43380510 CTACATAAAAAAAATTAGCTGGG - Intergenic
1067314942 10:45152164-45152186 CAACAACAACAAAAGCTGCAAGG - Intergenic
1068314993 10:55329404-55329426 CCACATAAACAGAAGCTCTTTGG + Intronic
1068640570 10:59400940-59400962 CTATTTAAACAAATGGTGCTGGG - Intergenic
1068830782 10:61492177-61492199 CTACATAAATAAAAGCTCCTTGG - Intergenic
1068869866 10:61931192-61931214 CTACATAAACAAAAGCTCCTTGG - Intronic
1069508846 10:69025203-69025225 GTACATAAACAAAAGATCTTTGG - Intergenic
1070053917 10:72915901-72915923 ATACATAAATATTAGCTGCTAGG + Intronic
1070190160 10:74104898-74104920 CTACATAATCAAAAGCTTCCAGG - Intronic
1070225617 10:74501805-74501827 CCACAGAAACAAAAGCAGATTGG + Intronic
1070618699 10:77989542-77989564 CTGAATAAACAAATGCTGCCGGG + Intronic
1070691050 10:78525900-78525922 CTACATAAGCAAAAGCTCTTTGG - Intergenic
1070951591 10:80435635-80435657 CTACAAAAATAAAATCTGTTGGG - Exonic
1071112655 10:82178011-82178033 CCACATAAGCAAAAGCTCTTTGG - Intronic
1071191020 10:83101026-83101048 CTACAAAAATAAACCCTGCTGGG - Intergenic
1071511923 10:86267476-86267498 CTTCCTGAACAAAAGCTCCTGGG - Intronic
1072964417 10:99959300-99959322 CCACATAAACAAAAGCTCTTTGG + Intronic
1073145128 10:101275622-101275644 CTAAAAATACAAAAGTTGCTGGG + Intergenic
1073234736 10:102004425-102004447 CTCCCTTGACAAAAGCTGCTGGG - Intronic
1073907476 10:108299581-108299603 CCACATAAACAAGAGCTCTTTGG + Intergenic
1075630379 10:123997044-123997066 CCACTGAAACAAAAGCTGTTTGG - Intergenic
1076789768 10:132770618-132770640 CCACATAGACAAAAGCTCCAGGG - Intronic
1078043495 11:7891296-7891318 CTTCATAAACAAAAACTCTTTGG - Intergenic
1078673315 11:13384888-13384910 CTACATAAGCAAAAGTTCTTTGG + Intronic
1079016303 11:16871817-16871839 GTGCATCAACAAAGGCTGCTTGG + Intronic
1079049797 11:17144179-17144201 GTATATAAACAAAAGCAGATAGG - Intronic
1079423334 11:20315909-20315931 CTAAATAAACACAAACTCCTAGG - Intergenic
1079817154 11:25076177-25076199 GAACAAAAACAAAAGCAGCTGGG - Intronic
1080213489 11:29815342-29815364 CTAGACAAACAAAAGCTGAGGGG - Intergenic
1080797387 11:35577763-35577785 CCACATAAACAAAAGCTTTTTGG + Intergenic
1081559926 11:44204402-44204424 CTATATAAACAAAATCTCTTTGG + Intronic
1081987262 11:47315000-47315022 TCACATAAACAAAAGCTCTTTGG + Intronic
1083585742 11:63857708-63857730 TCATATAAACAAAAGCTTCTGGG + Intronic
1083702395 11:64488116-64488138 ATACAAAAACAAAATCAGCTGGG - Intergenic
1083984047 11:66198987-66199009 CTACATACACAAAAGCTATTTGG + Intronic
1085078055 11:73609662-73609684 CTACAAAAACAAAAACTCATTGG - Intergenic
1086172945 11:83857197-83857219 CTACATGAACCAAAACTGCATGG - Intronic
1086524188 11:87705284-87705306 CTATAATAACAAAAGCAGCTTGG - Intergenic
1087010340 11:93508110-93508132 CTATACAAACAAAAGCTCTTAGG + Intronic
1087051175 11:93887866-93887888 ATACAAAAACAAAATCAGCTGGG - Intergenic
1087776190 11:102259084-102259106 CTAAAAATACAAAAACTGCTGGG - Intergenic
1087919499 11:103849985-103850007 CTTCATAAACAGAAGCAGCAAGG - Intergenic
1087935056 11:104023995-104024017 CTGCCTAAAGAAAAGCTGTTGGG - Intronic
1088341208 11:108769788-108769810 CCACAGAAACAAAAGCTCTTTGG - Intronic
1089371970 11:117967479-117967501 TTACAAAAACAAAAACAGCTGGG + Intergenic
1089711290 11:120316753-120316775 CTCCACAAAGAAAAGGTGCTTGG - Intronic
1090368773 11:126230846-126230868 CTATCAAAACAAGAGCTGCTGGG + Intronic
1091503357 12:1041046-1041068 CTACATAAACAAAAGCTGCTTGG - Intronic
1091515198 12:1172951-1172973 CACCATACACTAAAGCTGCTGGG - Intronic
1091640485 12:2233100-2233122 CCATATAAACACAAGCTGATAGG - Intronic
1091817301 12:3448337-3448359 CCACATAAACAAAAGCTCTTTGG - Intronic
1091941822 12:4492080-4492102 CTACATAAAGAAAAGCTCATTGG - Intronic
1092094804 12:5832662-5832684 CTTCACAAAAAAAAGCTGCATGG + Intronic
1092214376 12:6670621-6670643 CCACATAAACAAAAACTCTTTGG + Intronic
1092267179 12:6990575-6990597 CCACATTAACAAAAGTTGTTTGG - Intronic
1092354768 12:7785471-7785493 CTATAAAAACACAAGCAGCTAGG - Intergenic
1092842185 12:12553165-12553187 CTATATAAACAAAAGATTTTTGG + Intronic
1093531310 12:20167462-20167484 CTAAATAAACAAAAGCCTTTGGG - Intergenic
1093950264 12:25157682-25157704 CCACATAAACATAAGCTCCTTGG + Intronic
1094575799 12:31684437-31684459 ATACATAAACAAAAACTCTTTGG + Intronic
1095375190 12:41518952-41518974 ATAAATAAATAAAAGGTGCTTGG + Intronic
1095578172 12:43763579-43763601 CAACATAAACAAAAGCCCTTTGG + Intronic
1095793036 12:46188008-46188030 GGACATGAATAAAAGCTGCTGGG + Intronic
1095868769 12:47002829-47002851 CCACGTAAACAAAAGCTCTTTGG + Intergenic
1096269037 12:50149065-50149087 CCACATAAACAAAAACTCTTTGG + Intronic
1096269706 12:50155220-50155242 CCACATAAACAAAAGCTCCTTGG + Intronic
1096832391 12:54324577-54324599 CTACATAAACCAAGGCTGCCAGG - Intronic
1097299255 12:58000547-58000569 CCAGATAAACAAAAGCTGAGGGG - Intergenic
1097426348 12:59449189-59449211 CTACAACAACAAAATTTGCTAGG + Intergenic
1097730712 12:63125054-63125076 CTACATTAACAATAGCTTTTTGG + Intergenic
1098251014 12:68569673-68569695 CTATATAAACACAAGCTCTTTGG + Intergenic
1098710670 12:73755979-73756001 TTACATAAACAAAAGCTCTTTGG + Intergenic
1099217771 12:79874603-79874625 CTGCAGAAACAAAAGCTCATTGG + Intronic
1099831485 12:87848771-87848793 CTACAGAAACAATAGTTTCTTGG + Intergenic
1100146417 12:91682982-91683004 CTGCAGTAACAAAAACTGCTTGG - Intergenic
1100746371 12:97650709-97650731 CCACATAAACAAAAGCTCTTTGG - Intergenic
1100793029 12:98151621-98151643 CCCCATAAACAAAAGCTCTTTGG + Intergenic
1102837587 12:116079842-116079864 CCACATAAACAAAAGCATCCTGG + Intronic
1103279701 12:119747077-119747099 CTACATAAACAAGAGCTCTTTGG - Intronic
1104027807 12:125041463-125041485 CCACAGAAACAAAAGCTCTTGGG + Intergenic
1104385330 12:128346283-128346305 CTACATTAACCAAAACTGCATGG - Intronic
1104409295 12:128544408-128544430 CTACATTATCAGAAGATGCTCGG + Intronic
1105321866 13:19332363-19332385 CCACTTAAACAAAAGCTCTTTGG + Intergenic
1105485490 13:20826773-20826795 CTATATAAAGAAAAGCTCTTTGG + Intronic
1105757370 13:23480428-23480450 CTAAACAAACAAAAGCTGAGAGG - Intergenic
1105876881 13:24563486-24563508 CCACTTAAACAAAAGCTCTTTGG - Intergenic
1106211452 13:27651691-27651713 CCACATAAACAAAAGCTCTTTGG + Intronic
1106211664 13:27653620-27653642 CCACATAAACAAAAGCTCTTTGG - Intronic
1106400713 13:29427669-29427691 CTACTTAATTAAAATCTGCTTGG + Intronic
1106709732 13:32316858-32316880 CTACATAAACAAAAGCACTCCGG - Intronic
1106864249 13:33946426-33946448 CCACATTAACAAAAGCTCTTGGG - Intronic
1106929623 13:34650402-34650424 CTACAAAAACAAAATTAGCTGGG - Intergenic
1108225232 13:48282742-48282764 CTACATAAACAAAAGCTATATGG + Intergenic
1108234375 13:48387801-48387823 CCACACAAACAAAAGCTTTTGGG + Intronic
1108318764 13:49265730-49265752 CCACATAAATAAAAGCTTTTTGG + Intronic
1109125205 13:58508621-58508643 CTACATAAATATAAGGTGATAGG + Intergenic
1109629155 13:65021225-65021247 CTACATAAACCAAAGCAGCATGG - Intergenic
1109639197 13:65164884-65164906 ATACAAAAACAAAATCAGCTGGG + Intergenic
1110453730 13:75666644-75666666 CCACATAAACAAAAGCTCTTGGG + Intronic
1111157602 13:84349012-84349034 CTACTGAAACAAAAGCTGAAAGG + Intergenic
1111392297 13:87612305-87612327 CTGCATAAACTAAAGCTCTTTGG - Intergenic
1111851754 13:93584560-93584582 CCACATAAAGAAAAGCTCTTGGG + Intronic
1112131486 13:96529098-96529120 CTACATAAACAAAATATTTTGGG + Intronic
1112185607 13:97125312-97125334 GTACAGAAACAAAAGCTACTTGG + Intergenic
1112371099 13:98794297-98794319 CTACAGAAAAAAAAGGTTCTGGG - Exonic
1113344093 13:109457022-109457044 CTACATGAACAAAAGCTTTGTGG - Intergenic
1113724012 13:112584248-112584270 CTACATAAACAAAAGCTTTTTGG - Intronic
1114508485 14:23236692-23236714 TTACATAAACAAAAGCTCTTTGG + Intronic
1114723250 14:24905759-24905781 CTACCTAAACAAAACCTTCCAGG + Intronic
1115232482 14:31176484-31176506 CTATATGAACAAAAGCTCTTTGG + Intronic
1116044576 14:39728819-39728841 CCTCTTAAACAAAAGGTGCTGGG - Intergenic
1116251191 14:42484334-42484356 TTACATAAACAAAAGTTGATAGG + Intergenic
1116493195 14:45530120-45530142 CTACAGAAACCAAAACAGCTTGG + Intergenic
1116508274 14:45712816-45712838 CTATATAAGCAAAAGCACCTTGG - Intergenic
1118167431 14:63351038-63351060 CAACATAAACAAAAGCTCTTGGG - Intergenic
1118549216 14:66931052-66931074 CCAGATAAACAAAAGCTGAGGGG - Intronic
1118810874 14:69272381-69272403 ATACATAAATAAAAAGTGCTAGG + Intronic
1120744042 14:88137770-88137792 CTACATAAACCTCAGCTGCAAGG + Intergenic
1121572209 14:94954858-94954880 CCACATAAACAAAAGCTCTTTGG - Intergenic
1124388923 15:29235668-29235690 CTAGATAAAGAAGAGCGGCTGGG + Intronic
1124846411 15:33295582-33295604 CCACATAAACAAAAGCTCTTTGG - Intergenic
1124886410 15:33690770-33690792 CCACATAAACTAAAGCTTTTGGG - Intronic
1124973118 15:34509784-34509806 CTACATAAACCAAAGCTCCTTGG + Intergenic
1125371189 15:38978938-38978960 CTACAGTAACAAAAGCAGCATGG - Intergenic
1125609179 15:40959260-40959282 CGACATAAACAAAAGCTCTTGGG - Intergenic
1125917937 15:43506095-43506117 ATTCATAAAGAAAAGATGCTGGG - Intronic
1126152010 15:45531848-45531870 CTACATAAAAAATAACAGCTTGG - Intergenic
1126184042 15:45813271-45813293 CCAGATAAACAAAAGCTGAGGGG + Intergenic
1126269008 15:46790842-46790864 TTACCTAAACATAAGCTGTTAGG + Intergenic
1127168386 15:56271981-56272003 CTACAAAAACAAAATTAGCTGGG + Intronic
1127181112 15:56419067-56419089 ATATATATATAAAAGCTGCTTGG - Intronic
1127284702 15:57522167-57522189 CAAGGTTAACAAAAGCTGCTGGG - Intronic
1127874124 15:63098073-63098095 CCATATAAACAAAAGCTCTTTGG - Intergenic
1127884557 15:63188238-63188260 CCACATGAAAAAAAGCTTCTTGG - Intergenic
1128588279 15:68871022-68871044 CTTCATAAATAAAAGCTCTTAGG + Intronic
1129110632 15:73335150-73335172 CAACATAAACAACAGAGGCTGGG - Intronic
1129415878 15:75379283-75379305 CCATATAAACAAAAGCTTTTTGG + Intronic
1130264253 15:82384901-82384923 CTATATACAGAAAAGCTCCTTGG - Intergenic
1130271307 15:82450393-82450415 CTACATAAACCAAAGCTCCTTGG - Intergenic
1130276763 15:82482731-82482753 CCACATACACAAAAGCTCCTTGG + Intergenic
1130463646 15:84177729-84177751 CTACATAAACCAAAGCTCCTTGG - Intronic
1130469127 15:84210095-84210117 CTACATACACAAAAGCTCCTTGG + Intergenic
1130474512 15:84252147-84252169 CTATATACAGAAAAGCTCCTTGG - Intergenic
1130476617 15:84324651-84324673 CTACATACACAAAAGCTCCTTGG + Intergenic
1130481927 15:84366195-84366217 CTATATACAGAAAAGCTCCTTGG - Intergenic
1130489027 15:84417054-84417076 CTACATAAACCAAAGCTCCTTGG + Intergenic
1130495148 15:84463479-84463501 CTACATACACAAAAGCTCCTTGG - Intergenic
1130500619 15:84495813-84495835 CTACATAAACCAAAGCTCCTTGG + Intergenic
1130508109 15:84565864-84565886 CTACATACACAAAAGCTCCTTGG + Intergenic
1130591420 15:85214706-85214728 CTACATACACAAAAGCTCCTTGG + Intergenic
1130634254 15:85601743-85601765 CTATATAAACAAAAGCTCTTTGG - Intronic
1130725431 15:86433916-86433938 TTACAGAAACAAAAGCTATTGGG + Intronic
1132075930 15:98819652-98819674 CCACATAAACGAAAGCTTATTGG - Intronic
1132187274 15:99811867-99811889 CTACATAAACCAAAGCTCCTTGG - Intergenic
1132428403 15:101740873-101740895 CTACATAAACCAAAGCTCCTTGG + Intronic
1132470322 16:98942-98964 CAACAAAAACAAAACCTGCAAGG + Intronic
1133751459 16:8729303-8729325 CAACAAAAACAAAAACAGCTAGG + Intronic
1134524628 16:14934124-14934146 CTACAAATACAAAAACAGCTGGG + Intronic
1134712217 16:16332611-16332633 CTACAAATACAAAAACAGCTGGG + Intergenic
1134954612 16:18376083-18376105 CTACAAATACAAAAACAGCTGGG - Intergenic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1135952104 16:26924205-26924227 ATAAAGAAATAAAAGCTGCTAGG + Intergenic
1136052716 16:27664105-27664127 CTACATAAAGAAGAGAGGCTGGG - Intronic
1138685952 16:58725958-58725980 CCACATAAATAAAAGCTCTTTGG - Intronic
1139201228 16:64979459-64979481 ATAAATAAATAAAAGATGCTTGG + Intronic
1139256014 16:65543575-65543597 TTAAATAAACTAAAGCTGTTAGG - Intergenic
1140040108 16:71401813-71401835 CCACATAAACAAAAGCTCTTTGG + Intergenic
1140791024 16:78391242-78391264 TTATGTAAACAATAGCTGCTAGG + Intronic
1141670686 16:85490250-85490272 ATAAATCAACAAGAGCTGCTAGG + Intergenic
1141752119 16:85965537-85965559 CCAAATAAATAAAAGCTGATTGG + Intergenic
1142269624 16:89082651-89082673 CGACATAAACAGAAGCTCTTGGG - Intergenic
1142835316 17:2581512-2581534 CTAAATATACAAAATCAGCTGGG + Intergenic
1143694848 17:8606108-8606130 CCAAATAAACAAAAGCTCTTTGG + Intronic
1144073264 17:11693649-11693671 CTACATAAACAAAAGCTCTTTGG + Intronic
1144185655 17:12792797-12792819 CTACTTAAACATACTCTGCTGGG + Intronic
1144592328 17:16535404-16535426 CTAAATAAACAAAACCTCATTGG + Intergenic
1144935930 17:18899063-18899085 CTAAATATACAAAAGTAGCTGGG - Intronic
1145078595 17:19875791-19875813 CTACATAAACCAAAGCTCTTTGG + Intergenic
1145178912 17:20727572-20727594 GTACAAAAATAAAAGATGCTTGG - Intergenic
1146230680 17:31105673-31105695 CTAAAAAAACAAAATCAGCTGGG - Intronic
1146613154 17:34326321-34326343 CTATAGAAACAAGAGCTCCTGGG + Intergenic
1146699272 17:34940725-34940747 TTACATAAACAAAAGCTTTTTGG - Intronic
1147939555 17:44036604-44036626 GTACAAAATGAAAAGCTGCTGGG + Intronic
1148141279 17:45330649-45330671 CTATAAAAACAAAAGCTCTTTGG - Intergenic
1148274243 17:46289336-46289358 CTACAAAAAAAAAAGTAGCTGGG - Intronic
1148571844 17:48676396-48676418 ATACATAAACAAGAGCTTTTTGG - Intergenic
1148964657 17:51424730-51424752 CTACATAAACAAGAGCTCTTTGG + Intergenic
1149052341 17:52321365-52321387 CCACATAAACAAAAACTTCTGGG + Intergenic
1149163036 17:53717808-53717830 CTACAGTAACAAAAGCAGCATGG - Intergenic
1149838568 17:59937160-59937182 GTACAAAAATAAAAGATGCTTGG - Intronic
1150045704 17:61911342-61911364 CCACATAAACAAAAGCTCTTTGG + Intronic
1150080649 17:62235511-62235533 GTACAAAAATAAAAGATGCTTGG + Intergenic
1150242305 17:63644596-63644618 CCACATAAGCAAAAGCTCTTTGG + Intronic
1150681388 17:67287407-67287429 ACTCATAAACAAAAGCTTCTTGG + Intergenic
1150906114 17:69339819-69339841 ATACACAAACAAAAGCTTCTTGG - Intergenic
1151050072 17:70967980-70968002 CAATATAAACAAATGCTGTTGGG + Intergenic
1153080722 18:1221482-1221504 CTACATAAACAAAAGCTCTATGG + Intergenic
1153282912 18:3430851-3430873 CCACATAAACAAAAGCTTTTTGG + Intronic
1153729409 18:7993665-7993687 CTAGACAAACAAAAACTGATGGG + Intronic
1154288872 18:13087160-13087182 CTGCTTTAACAAAAGCTGCTCGG - Exonic
1154990904 18:21597620-21597642 CTATATAAACAAAAGCTACTTGG + Intronic
1155014315 18:21817418-21817440 CTACATAAAGAATTCCTGCTAGG - Intronic
1155524531 18:26703051-26703073 CTACATAAATAAAAGCTGTTTGG + Intergenic
1155811008 18:30235132-30235154 CCAAATAAACAAAGCCTGCTGGG + Intergenic
1156013758 18:32524330-32524352 CCATATAAACAAAAGCTTTTGGG - Intergenic
1156479202 18:37425747-37425769 CTGCAGAAACTACAGCTGCTTGG + Intronic
1157457510 18:47847493-47847515 TCACATAAACAAAAGCTCTTTGG - Intronic
1157623634 18:49030591-49030613 CCACATAAACAAAAGTTTTTAGG - Intergenic
1157884764 18:51355990-51356012 CTAAATAAACAAAAGCTTCGAGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158526024 18:58214583-58214605 TTCCATAAACATTAGCTGCTCGG + Intronic
1158681323 18:59569793-59569815 CTACAAAAACAAAATTAGCTAGG - Intronic
1160261260 18:77296246-77296268 CTACATAAACCAAAACTCTTTGG - Intergenic
1160469986 18:79122196-79122218 CTATATAAATAAAATGTGCTTGG + Intronic
1160604655 18:80040815-80040837 CCACATAAACAAATGCTCTTTGG + Intronic
1161135820 19:2619157-2619179 GCATATAAACAAAAGCTCCTTGG + Intronic
1163066159 19:14797338-14797360 ATACAAAAACAAAATCAGCTGGG + Intronic
1163086366 19:14982764-14982786 CTATATAAAGAAAAGCTCTTTGG - Intronic
1163190159 19:15671551-15671573 CTACATAAAGTAAAACTACTCGG - Intergenic
1164591616 19:29510747-29510769 CTGCAAAAATAAACGCTGCTGGG - Intergenic
1164712896 19:30371281-30371303 TGACATAAACAAAGGCAGCTGGG + Intronic
1164713152 19:30373611-30373633 CTACAGAAAGAAAAATTGCTTGG + Intronic
1166115826 19:40653613-40653635 CCACACAAATAAAAGCTGTTTGG - Intergenic
1166748867 19:45155314-45155336 CTCAAAAAAAAAAAGCTGCTGGG + Intronic
1167747147 19:51358501-51358523 CAACAAAAACAAAAACAGCTGGG + Intronic
925353767 2:3222842-3222864 CTACACAAACAGAAGCTTCGTGG + Intronic
925685343 2:6466019-6466041 CCACATAAGCAAAATCTCCTTGG - Intergenic
925933937 2:8735079-8735101 GAACATGAACACAAGCTGCTGGG + Intronic
928162821 2:28944394-28944416 CCACATAAACAAAAACTTTTTGG + Intronic
928190193 2:29158203-29158225 CAACATAAAGAAAAACTGGTTGG - Intronic
928733356 2:34258459-34258481 GCACATAAGCAAAAGCTTCTTGG + Intergenic
929206095 2:39295416-39295438 CCCCATAAACAAAAGCTCTTTGG + Intronic
929361234 2:41093767-41093789 CTACAGTAACAAAAGCAGCATGG + Intergenic
930292740 2:49516216-49516238 CCAGAGAAACAACAGCTGCTAGG + Intergenic
930492301 2:52091409-52091431 CTAGAAAAACAAAAGCTGAGAGG - Intergenic
930796837 2:55402104-55402126 CCACATAAACAAAAGCTCTTTGG - Intronic
931279012 2:60771888-60771910 CCACATAAACAAAAGCTTTTTGG - Intronic
931496782 2:62816428-62816450 CCACATAAACAGAAGCTCTTTGG + Intronic
932064895 2:68544623-68544645 CTATATAAACAAAAGCTCTCTGG + Intronic
932067539 2:68582210-68582232 CCTCATAAACAAAAGCTTTTTGG + Intronic
932638937 2:73422032-73422054 CCAAATAAACAAAAGCTCTTTGG - Intronic
932901727 2:75709190-75709212 CTACTGAAACAAAAGCTCTTTGG + Intronic
933446888 2:82392203-82392225 TCACATAAACAAAAGTTCCTTGG + Intergenic
934063158 2:88315471-88315493 ATGCATAAACAAAAGCTCTTTGG - Intergenic
934756061 2:96825531-96825553 CTGCAAAAACAAAAGCACCTAGG - Intronic
935004648 2:99060559-99060581 CTACAGAAAAAAAACCTACTTGG - Intronic
935039377 2:99411300-99411322 CTACAACAACAAAAACTGTTTGG + Intronic
935201954 2:100864795-100864817 CCACATAAACAAAACCTCTTTGG - Intronic
935354467 2:102186304-102186326 CTACATAGACAAAAGCACTTTGG + Intergenic
935655178 2:105416086-105416108 CTACATAAACAAAAGCCCTTTGG - Intronic
936105363 2:109619331-109619353 CTACCTAAAAAAAAGCTGTATGG + Intergenic
936408078 2:112226291-112226313 CTAATTAAAAAAAAGCGGCTGGG + Intronic
937233281 2:120414748-120414770 CCACATAAACAAAAGCTCTTTGG - Intergenic
937723379 2:125129583-125129605 CTACAAAAACAAAAACAGCATGG + Intergenic
939612012 2:144322276-144322298 CCACATAAACAAAAGCTCTTGGG - Intronic
940090112 2:149905841-149905863 CTAAAGAAACAATAGCGGCTGGG + Intergenic
940493589 2:154396401-154396423 CCACATGAACAAAAGGTGTTTGG - Intronic
941148597 2:161885714-161885736 CTACATACACAAAAGTTCTTTGG - Intronic
943142083 2:183995566-183995588 CCACATAAAGAAAAGCTCATTGG + Intergenic
944106975 2:196089628-196089650 GTAGGTAAACAAAAGCTGCCAGG + Intergenic
944187494 2:196965578-196965600 CTACATGAACAAAAGCTCTTTGG - Intergenic
944611872 2:201418338-201418360 CTACAAAAATAAAAACAGCTGGG - Intronic
945343648 2:208686915-208686937 GTACATAAGCAAAAGCTCTTTGG - Intronic
945791921 2:214316004-214316026 CTTCATGAACAAAAGAAGCTAGG - Intronic
946799184 2:223392073-223392095 CTAAATATACAAAATCAGCTGGG - Intergenic
947283696 2:228485195-228485217 CTACATAAATAAAAACTATTTGG + Intergenic
947523001 2:230863000-230863022 CCACCTAAACAAAAGCTCTTGGG + Intergenic
947525875 2:230876480-230876502 CTCCAAAAAAAAAAGCAGCTTGG - Intronic
948291040 2:236825020-236825042 CTACATAAACAAAGGCCACCTGG - Intergenic
1169240504 20:3974871-3974893 CTACAAAAAAAAAATTTGCTGGG - Intronic
1170423736 20:16217881-16217903 CTGCATAAGCAAAATCTCCTTGG + Intergenic
1170990391 20:21296358-21296380 CCACTTAAACAAAAGCTCCTTGG - Intergenic
1171486281 20:25488841-25488863 CTACATCAACAAAAGCTCTTTGG + Intronic
1172365654 20:34347070-34347092 CTAAAAATACAAAAGTTGCTGGG + Intergenic
1172473653 20:35220550-35220572 CCACATAAACAAAAGTTATTTGG - Intergenic
1172965891 20:38834649-38834671 CCACATAAACAAAAGCTCTTTGG - Intronic
1173400366 20:42721147-42721169 CTTCATGAACAAAAGTTACTTGG + Intronic
1174005268 20:47405684-47405706 CCACATAAACCAAAGCTCTTTGG - Intergenic
1174691707 20:52512717-52512739 TTACAGTAACAAAAGCTTCTGGG + Intergenic
1174873778 20:54207000-54207022 CCACATAAACAAAAGTTCTTTGG + Intergenic
1175301041 20:57942893-57942915 CTACATAGACAAAAGCCCTTTGG - Intergenic
1175887539 20:62301013-62301035 TCACATAAACAAAAGCTCTTTGG - Intergenic
1176013731 20:62916471-62916493 CCACATAAACAAAAGCTCTTTGG - Intronic
1178960792 21:37063074-37063096 CTACATACACAAAAGGTCTTTGG + Exonic
1179276959 21:39900386-39900408 CAACATAAACAAAAGTTCTTTGG - Intronic
1179429627 21:41311143-41311165 CTTCAGAAACAAAAGCTCCTGGG - Intronic
1180863376 22:19100751-19100773 CCACATAAATAAAAGCTCTTTGG - Intronic
1182169928 22:28217725-28217747 CCACATAAACAAAAGTTTGTTGG - Intronic
1182982817 22:34687564-34687586 GTAAATAAATAAATGCTGCTAGG + Intergenic
1183089653 22:35512938-35512960 CTACTGAATCAAAAGCTGCGGGG - Intergenic
1183154186 22:36062306-36062328 CTACATGAACAAAAGCTCTTTGG + Intergenic
1183553496 22:38507061-38507083 ATACAGAAACAAAATGTGCTTGG + Intronic
1185238770 22:49729560-49729582 CCACATAAACAAAAGCTTGCTGG + Intergenic
949910923 3:8907389-8907411 CCACATAAACAAAGGCTCTTTGG + Intronic
950271251 3:11616963-11616985 CTACATAACCAGAAGCTCTTTGG - Intronic
950353782 3:12384892-12384914 CCACATAAACAAAATCTCTTTGG + Intronic
950896518 3:16456618-16456640 CCACATAAACAAAAGTTCTTAGG - Intronic
951027356 3:17844219-17844241 CTACAAATACAAAAGTAGCTGGG - Intronic
951550723 3:23872575-23872597 CCATATAATCAAAAGCTGCTGGG - Intronic
951554649 3:23909038-23909060 CCACATAAACAGAAGTTGTTTGG + Intronic
952259465 3:31726008-31726030 CTACATGAAGAAAACCTGCTTGG + Intronic
952874236 3:37929310-37929332 CAACAAAAACAAAAGCCGTTTGG + Intronic
952986803 3:38792885-38792907 CAACATAAACAAAAGTTATTTGG - Intronic
953374707 3:42418927-42418949 AGCCTTAAACAAAAGCTGCTCGG + Intergenic
953844598 3:46417532-46417554 CCACATAAACTAAAGCTGTATGG - Intergenic
954095515 3:48323678-48323700 CTTTTTAAACAAATGCTGCTAGG - Intronic
954163285 3:48737245-48737267 TTAAAAAAACAAAACCTGCTGGG + Intronic
954362975 3:50132199-50132221 CTACATATACAAAATTAGCTGGG - Intergenic
954944862 3:54413088-54413110 TTAGATAAACAAAAGCTGAGTGG - Intronic
955206851 3:56903811-56903833 CAACATAAACAAAAGCTCATTGG - Intronic
956301492 3:67776998-67777020 CTACAGAAACTAAAACTGCATGG - Intergenic
958778493 3:98513522-98513544 CTAAAAATACAAAAGTTGCTGGG + Intronic
959162060 3:102735862-102735884 CTACACAAACAATAGTGGCTGGG - Intergenic
959255550 3:104007414-104007436 ATACAAAAACAAAATCAGCTGGG - Intergenic
959530171 3:107427324-107427346 TTACATAAACAAAAGCTTTGTGG + Intergenic
959900838 3:111660629-111660651 CTACAGTAACCAAAGCAGCTTGG + Intronic
960022126 3:112966656-112966678 CTACATAAACACATACTGGTTGG + Intronic
960091098 3:113638823-113638845 CCACATAAACAAAAACTCTTTGG - Intergenic
960365251 3:116763119-116763141 CAACAAATACAAAAGTTGCTAGG + Intronic
960481967 3:118202771-118202793 CTATAAAAACAAAACATGCTGGG + Intergenic
960974661 3:123162431-123162453 CTACAGAAAATAAAGTTGCTGGG + Intronic
961302689 3:125932390-125932412 CAACAAAAAAAAAAGATGCTTGG + Intronic
962201909 3:133407084-133407106 ATAAATAAATAAATGCTGCTGGG + Intronic
962859289 3:139383700-139383722 TCACATAAACAAAAGCTCTTAGG - Intronic
963872691 3:150435316-150435338 CTAAATAAAATAAAACTGCTAGG - Intronic
965122365 3:164577613-164577635 CCACATAAACAGAAGCTCTTTGG + Intergenic
966444282 3:179984504-179984526 CCACATAAACAAAAGATCTTTGG + Intronic
966663916 3:182449206-182449228 CTACATAAATAAAACCTCTTTGG + Intergenic
966681078 3:182642732-182642754 CTACATAAGATAAAACTGCTTGG + Intergenic
966990198 3:185222004-185222026 CTACATAAACACAAGCTTTTTGG - Intronic
967128119 3:186444913-186444935 CCACATAAACAAAAACTTTTTGG + Intergenic
967500348 3:190190324-190190346 CTACATAAACAGAAGCACTTTGG + Intergenic
968764634 4:2461994-2462016 TTAAAAAAAAAAAAGCTGCTAGG + Intronic
969865254 4:10072049-10072071 ATACATAACCAAAAGCTCTTTGG + Intergenic
970188349 4:13485253-13485275 CCACATAAACATAAGCTCTTTGG + Intergenic
970774204 4:19653316-19653338 CAACATAAACAAAAGAGGTTAGG + Intergenic
971561442 4:28083886-28083908 CTATAAAAACAAAAGCAACTTGG + Intergenic
972352472 4:38248761-38248783 CTACAAAAACAAAATTAGCTGGG + Intergenic
973054554 4:45639670-45639692 ATACATAAACAGAAACTTCTAGG - Intergenic
973550882 4:52034981-52035003 CCACATAAACCAAAGCTCTTTGG + Intronic
973882859 4:55291287-55291309 CTACATAAACAATGACAGCTGGG - Intergenic
974119257 4:57619298-57619320 CCACATAAACAAAAGCTTTTTGG + Intergenic
974423564 4:61710280-61710302 TTACATAAAGAAAAGCTAATGGG + Intronic
975144334 4:70951165-70951187 CAACAAAAACAAAAACTGTTAGG + Intronic
975540890 4:75510686-75510708 CCACATAAACCAAAGCTCTTTGG - Intronic
976029527 4:80734840-80734862 CTACAGTAACAAAAGCAGCATGG - Intronic
976134061 4:81916271-81916293 CCATATAAACAAAAGCTTTTTGG - Intronic
976406761 4:84668145-84668167 CCAAATAAGCAAAAGCTGTTCGG + Intergenic
976525176 4:86078826-86078848 CTAAAAATACAAAAGCAGCTGGG + Intronic
976608409 4:87004323-87004345 GTACATATACAAAAGCTCTTTGG - Intronic
976976846 4:91176056-91176078 CTATCTAAACAAATGGTGCTGGG - Intronic
977101940 4:92827337-92827359 CCACATAAACAAAAACTCTTTGG + Intronic
977458014 4:97286817-97286839 CCACATAAATAAAAGCTCGTTGG - Intronic
977523888 4:98121270-98121292 CTACATTAACCAAAACAGCTTGG - Intronic
978168547 4:105639752-105639774 CTACAAAAATAAAAGCAGTTTGG - Intronic
978380236 4:108119815-108119837 CCATATAAACAAAAGCTCCCTGG - Intronic
979393303 4:120153805-120153827 CTACTTAAACAAAAGCTTCTTGG - Intergenic
979947931 4:126857723-126857745 CTACATAAACAAAAATTCCTTGG - Intergenic
980304923 4:131047238-131047260 AAACAAAAACAAAAGCTTCTTGG - Intergenic
981245285 4:142529634-142529656 ATCCATAAACAAAAGCTTTTTGG + Intronic
981448280 4:144866157-144866179 CTACAGTAACAAAAACAGCTTGG - Intergenic
981763452 4:148219892-148219914 TTACATAAATAAAAGCTCTTTGG + Intronic
981820050 4:148876017-148876039 CCACATAAATAAAAGCTCTTTGG - Intergenic
981846954 4:149180594-149180616 CTACAGTAACAAAAACAGCTTGG + Intergenic
982098893 4:151949352-151949374 CCACATAAACAAAACCTCTTTGG + Intergenic
983131247 4:164022653-164022675 CTCCATGCACAAAAGCTTCTGGG - Intronic
983918664 4:173320260-173320282 CTATATAAACAAAAGCAATTTGG - Intronic
984092477 4:175391289-175391311 CTACAGAAACCAAAGCAGCATGG + Intergenic
984147791 4:176085128-176085150 ATACATAAAAAAAATCTGCTAGG + Intronic
984373235 4:178893896-178893918 TTAATTAAACAAAAGATGCTGGG + Intergenic
984590677 4:181614154-181614176 CCACATAGACAAAAGCTCTTTGG + Intergenic
984958316 4:185068450-185068472 CTACATAAATCAATGCTGATTGG - Intergenic
985482604 5:125802-125824 CCAGATAAACAAAAGCTGGGGGG - Intergenic
985701235 5:1374306-1374328 CAAAACAAACAAAAACTGCTTGG + Intergenic
986425315 5:7625591-7625613 CTACATAAACAAAAGATAATAGG + Intronic
987130707 5:14857357-14857379 TTACATTAAGAAAAACTGCTGGG + Intronic
987320870 5:16768022-16768044 CCACATAAACAAAAGCTCTCGGG + Intronic
989514299 5:42323912-42323934 CCACATAAACAAAAGCTCTTTGG + Intergenic
989538792 5:42594760-42594782 TCACATAAACAAAAGCTCTTTGG - Intronic
990119386 5:52431047-52431069 CTACATAAACAAAAGCTTTTGGG - Intergenic
990389050 5:55299988-55300010 CCACATAAACAAAAACTATTTGG - Intronic
990452929 5:55953548-55953570 CTACTAAAACAAAATCAGCTAGG - Intronic
990552926 5:56902220-56902242 CCACATGAACAAAAGGTCCTTGG - Intergenic
991231419 5:64337172-64337194 CTACAAAAACAAAATCAGCCAGG - Intronic
991286539 5:64983159-64983181 CCATATAAACAAAAGCTCTTTGG - Intronic
992057259 5:73002897-73002919 CTATAAAAAGAAAACCTGCTAGG + Intronic
992910627 5:81393393-81393415 CTACATAAACAAAAGCTGCCTGG + Intronic
993793221 5:92233235-92233257 CTACAGAAACCAAAACAGCTTGG - Intergenic
993958484 5:94266862-94266884 CTACATAAACAAAAGTTCTCTGG + Intronic
995430409 5:112068375-112068397 CTACATAAACAAGAGCTTCTTGG - Intergenic
995628221 5:114102817-114102839 CTACAGTAACCAAAGCAGCTTGG - Intergenic
995781333 5:115778813-115778835 CCACAAAAACAAAAGCTCTTTGG - Intergenic
996868403 5:128156749-128156771 CCACATGAACAAAAACAGCTAGG - Intronic
997596560 5:135111078-135111100 CTAGATAAACACATGCTGATTGG - Intronic
997777081 5:136619790-136619812 CTGGATAAACAAAAGCTTTTTGG + Intergenic
997918686 5:137955925-137955947 TTACTTAAAAAAAAGCTGCCGGG - Intronic
997919296 5:137963512-137963534 CTATGTAAACAAAAGCTCTTTGG + Intronic
997970453 5:138397172-138397194 ATACAAAAACAAAATCAGCTGGG + Intronic
998613546 5:143715252-143715274 GCACATAAACTAAAGCTCCTTGG - Intergenic
998868634 5:146530572-146530594 TCACATAAACAAAAGCTCTTTGG - Intergenic
999699636 5:154216880-154216902 CTACAAAAGTAAAAGCTGCCAGG - Intronic
999915837 5:156258864-156258886 CCATATAAACAAAAGCTCTTTGG + Intronic
1001363623 5:171114112-171114134 TTACATAAATAAAAGCTTCCTGG + Intronic
1001637316 5:173220505-173220527 CCACCTAAACAAAAGCTCTTTGG + Intergenic
1002203394 5:177545502-177545524 CAACACAAACAAAAGCTCTTTGG + Intronic
1003104146 6:3201651-3201673 CCATATAAACAAAAGCTTCTTGG + Intergenic
1003269570 6:4595514-4595536 GTACAAAAACAAAAGTAGCTGGG - Intergenic
1003848860 6:10201466-10201488 TTCCATAAACAAAAGCTCTTGGG - Intronic
1004890137 6:20093136-20093158 ATTCATAAAAAGAAGCTGCTTGG + Intergenic
1007019143 6:38501938-38501960 CTGCATAAACAAAAGCTCTTTGG + Intronic
1007466236 6:42053228-42053250 ACACATATACAAAAGCTACTTGG - Intronic
1007960342 6:45953328-45953350 CAACATAGACAACAGGTGCTGGG + Intronic
1008036480 6:46750246-46750268 CCACATAAACAAAAGCTCTCTGG - Intronic
1008110233 6:47484119-47484141 CAAAATAAACAAAAGCTGGGAGG - Intronic
1008207800 6:48684727-48684749 CTACATTAACCAAAGCAGCATGG + Intergenic
1008774567 6:55021588-55021610 CTACAAATACAAAATCAGCTGGG - Intergenic
1009783101 6:68295637-68295659 CTACAGAAACAAAAACAGCATGG + Intergenic
1010741194 6:79507380-79507402 ATACATAAACAAAAGCTGGGGGG + Intronic
1012007426 6:93731116-93731138 CTACAGAAATAAAAGCTCTTTGG + Intergenic
1012317948 6:97803306-97803328 CTACATTAACAAAAGCTTTTTGG - Intergenic
1012750753 6:103160492-103160514 GTGCATAAACAAAAGCTCTTTGG - Intergenic
1012753750 6:103197237-103197259 CTACAAAATAAAAAGCTTCTGGG + Intergenic
1014072346 6:117197633-117197655 CTACATAAACAAAAACTCTTTGG + Intergenic
1014106221 6:117565003-117565025 CCACATAAACAGAAGCTTCTTGG - Intronic
1014125015 6:117767244-117767266 CTACAGTAACAAAAGCAGCATGG + Intergenic
1014470445 6:121807769-121807791 CCATATAAACAAAAGCTCTTGGG + Intergenic
1014599156 6:123387230-123387252 CTACGTAAATAAAAGCTGTTTGG - Intronic
1015029826 6:128581094-128581116 CTTTATAAACATAAACTGCTGGG + Intergenic
1016229525 6:141785867-141785889 ATACAGAAACAAAAGTAGCTGGG - Intergenic
1016311747 6:142740611-142740633 CAATAAAAACAAATGCTGCTGGG - Intergenic
1016399380 6:143661986-143662008 GTACATATACAAAATGTGCTTGG - Intronic
1016913238 6:149219906-149219928 CCACATAAACAAAAGTTCTTTGG - Intronic
1016924104 6:149324714-149324736 CTGACTAAACAAAAGTTGCTTGG - Intronic
1017084645 6:150702701-150702723 AAACATAAGCAAAAGCTGTTGGG + Intronic
1017810441 6:157980545-157980567 CTACACAGAAAGAAGCTGCTCGG + Intergenic
1018542525 6:164898003-164898025 CCACCAAAAGAAAAGCTGCTAGG + Intergenic
1018709670 6:166489089-166489111 CCACATAAACATAAGCTCTTTGG - Intronic
1020351153 7:7219575-7219597 CTACATAAATAAAAACTATTTGG + Intronic
1020477531 7:8615827-8615849 CTACATAAATGACAGCTGCATGG + Intronic
1020946065 7:14609155-14609177 CTACAGTAACAAAAACTGCATGG + Intronic
1021064850 7:16160544-16160566 CTACAGTAACAAAAGCAGCACGG - Intronic
1021212617 7:17873398-17873420 TCACATAAACAAAAGCTCTTTGG + Intronic
1021848050 7:24781614-24781636 CCACATAAACAAACGCTCTTTGG - Intergenic
1022061677 7:26802877-26802899 ATAAATAAATAAATGCTGCTTGG + Intronic
1022471428 7:30683834-30683856 CCACATAAACCTAAGCTGCTAGG + Intronic
1023206250 7:37753034-37753056 CTACGTAAACAAAAGGTATTAGG + Intronic
1024513494 7:50221659-50221681 GTGCATAAACACAAGTTGCTGGG + Intergenic
1026293918 7:69034626-69034648 CTAGATAAACAATAGCTATTAGG + Intergenic
1026469516 7:70682953-70682975 TTAAATAACCAGAAGCTGCTGGG + Intronic
1026495342 7:70897022-70897044 CTACAAAAACAAAATTAGCTGGG - Intergenic
1026704439 7:72677995-72678017 ATAGATAAATAAAAGGTGCTGGG - Intronic
1027489650 7:78807207-78807229 CTGCATAAACAAAAGCTCTTTGG - Intronic
1028352715 7:89868792-89868814 CCACATAAACAAAAGTTCTTTGG + Intergenic
1028453292 7:91010289-91010311 CTACAAAAAAAAAGCCTGCTTGG + Intronic
1028565959 7:92231410-92231432 CCACATAAACAAAAACTCTTGGG + Intronic
1028723609 7:94061601-94061623 CAACATAATCAAAATCTGTTTGG + Intergenic
1030194428 7:106838942-106838964 CCACATAAACCAAAGCTTTTGGG + Intergenic
1030212810 7:107013082-107013104 TCACATAAACAAAAGCTCTTTGG + Intergenic
1030612154 7:111701323-111701345 CTACAGTAACAAAAACAGCTTGG - Intergenic
1030953993 7:115827954-115827976 CTTCATAAACTAAAGCAGGTGGG - Intergenic
1031829570 7:126609765-126609787 CTAAATAAATAAAAGTTGATAGG + Intronic
1033108547 7:138554530-138554552 TTAGATGAACAAAAGCTGTTTGG + Intronic
1033143092 7:138845088-138845110 CCACAGAAACAAAAGCTCTTGGG - Intronic
1034333461 7:150304500-150304522 CTACATCAACACCTGCTGCTTGG + Intronic
1034529354 7:151685816-151685838 CCACAGAAATAAAAGCTCCTTGG + Intronic
1034664580 7:152805390-152805412 CTACATCAACACCTGCTGCTTGG - Intronic
1034711159 7:153192562-153192584 CTATTTAAAGAAAAGCTCCTTGG + Intergenic
1035908087 8:3535823-3535845 CTTCATATACAAAAACTGGTGGG - Intronic
1035994337 8:4529567-4529589 TTACATAAGCAAAAGCTCCTTGG + Intronic
1036414306 8:8532597-8532619 CCACATGAACAAAAGCTTTTTGG - Intergenic
1037141470 8:15525529-15525551 TCACATAAACAAAAGCTCTTTGG + Intronic
1037825439 8:22157943-22157965 CCACATAAACAAAAGCTCTTGGG + Intronic
1037831007 8:22189004-22189026 CAACAAAAACAAGAGTTGCTGGG - Intronic
1038519917 8:28222258-28222280 CTACAGTAACAAAAGCAGCATGG - Intergenic
1038584121 8:28774379-28774401 CCACATAAACAAAACCTCTTTGG + Intronic
1039696270 8:39915862-39915884 CTACTTAAAAAAAAGATTCTCGG + Intronic
1041102562 8:54411325-54411347 CCACATAAACAAAAGCATTTGGG + Intergenic
1041329801 8:56712590-56712612 GAGCATAAACAAAAGCTGTTGGG + Intergenic
1041635741 8:60141160-60141182 ATACTTTAACAAAAGCTGATTGG - Intergenic
1041694638 8:60722514-60722536 CAACATAAACCAAAGCTCTTTGG - Intronic
1042950192 8:74193162-74193184 CCACATAAACAAAAGTTCTTTGG - Intergenic
1043999669 8:86864607-86864629 CTAAATATACAAAATCAGCTGGG + Intergenic
1044047052 8:87449098-87449120 CTACTAAAATATAAGCTGCTTGG + Intronic
1044070094 8:87749432-87749454 TTACATAAACAAAAGTTGCCAGG + Intergenic
1044114750 8:88321720-88321742 CTACATAAACTAAAGCTTCTAGG + Intronic
1044144782 8:88698779-88698801 CTTCCAAAACAACAGCTGCTTGG + Intergenic
1044841495 8:96340672-96340694 GTACATAAACAAAAACTCTTTGG - Intergenic
1045117268 8:98996695-98996717 CCATATAAACAAAACCTGTTTGG - Intergenic
1045407034 8:101877096-101877118 CTACATATACAATAGCTGAGAGG - Intronic
1045454988 8:102368928-102368950 CCACATAAACAAAAGATTTTTGG - Intronic
1045474847 8:102544070-102544092 CTACATAACAAAAAGCTCTTTGG + Intergenic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1046280381 8:112021473-112021495 CTATATAAAAAAAGTCTGCTAGG - Intergenic
1046701763 8:117408427-117408449 CTCCATAAACAAGAGCAGCCAGG - Intergenic
1046734349 8:117761097-117761119 CTACAAAAAAAAAAGCTCTTTGG + Intergenic
1047376684 8:124305204-124305226 CTTCACAAACAAAAGTTACTTGG + Intergenic
1047717553 8:127609672-127609694 CAACAGAAACAGAAGCTGCATGG + Intergenic
1048953150 8:139512675-139512697 CTCCATGAGCAAGAGCTGCTTGG + Intergenic
1049704077 8:144031217-144031239 CCAGATAAACAAAAGCTGAGGGG - Intronic
1050543906 9:6693529-6693551 TTACATAAACAAAAGAGGCAGGG + Intergenic
1050971195 9:11877217-11877239 CTGCATAAATAAAAGCTCTTCGG + Intergenic
1051373959 9:16385506-16385528 CCACATAAACAAAAATTACTTGG + Intergenic
1051435720 9:17029070-17029092 TGACATAAACAAAAGCTCTTTGG - Intergenic
1052344645 9:27397044-27397066 CTACACAAAGAAAATTTGCTTGG - Intronic
1052759559 9:32576214-32576236 CCACATAAACAAAAGCTCTTTGG - Intergenic
1053407375 9:37889069-37889091 CCACATAAACAAAGGGTGTTTGG + Intronic
1053605923 9:39658498-39658520 CCACATGCACAAAAGCTCCTAGG + Intergenic
1053863841 9:42415122-42415144 CCACATGCACAAAAGCTCCTAGG + Intergenic
1054247622 9:62683918-62683940 CCACATGCACAAAAGCTCCTAGG - Intergenic
1054561738 9:66718443-66718465 CCACATGCACAAAAGCTCCTAGG - Intergenic
1054753462 9:68932340-68932362 CCACATAAATAAAAGCTCTTTGG - Intronic
1054962757 9:70987214-70987236 CCATATAAACAAAAACTGTTGGG + Intronic
1055707744 9:79025644-79025666 CCACATAAAGAAAAGCTCTTTGG - Intergenic
1055717677 9:79136018-79136040 CAATATACAAAAAAGCTGCTTGG + Intergenic
1055817721 9:80226829-80226851 CTACAATAACAAAAGCAGCATGG - Intergenic
1056671162 9:88628028-88628050 CCACATAAACAAAAGCCATTTGG - Intergenic
1058509144 9:105697011-105697033 CAACATAAACAAAACCTTTTGGG + Intronic
1058650988 9:107175714-107175736 TTACAGAAACAAAAGCAGCTAGG + Intergenic
1059303508 9:113334963-113334985 CTACATAAACAAAACCTCTTTGG + Intronic
1059371230 9:113839609-113839631 CCACATAAACAAAAGCTCTGTGG - Intergenic
1060651968 9:125335816-125335838 CACCATAAACAAAAGCTATTAGG + Intronic
1061508704 9:131047505-131047527 CCACATAAACAAAAGCACTTTGG - Intronic
1186508645 X:10114124-10114146 CAACACAAACAAAAGCTCTTTGG - Intronic
1187165019 X:16796902-16796924 CCACAAGAACAAAAGCTCCTTGG - Intronic
1187732171 X:22266368-22266390 CCACATAAACAAAAGCTCTTTGG - Intergenic
1188018405 X:25129801-25129823 CCCCATAAACAAAAGTTTCTGGG - Intergenic
1188312347 X:28632566-28632588 CCACATAAACAAAAGCTTTTTGG - Intronic
1188979749 X:36716412-36716434 CTACATATATAATACCTGCTCGG - Intergenic
1189060712 X:37750153-37750175 ATAAATAAACAAACACTGCTGGG + Intronic
1189447846 X:41097485-41097507 CCACATAAACAAAAGCTCTCTGG - Intronic
1189657766 X:43265081-43265103 CCAGATAAACAAAAGCTGAGGGG - Intergenic
1189710881 X:43810533-43810555 CCACAAAAACAAAAGCTACTTGG + Intronic
1189936616 X:46075937-46075959 CTACAGAAACAAAAACAGCATGG - Intergenic
1190410609 X:50133634-50133656 CCATATAAACAAAAGCTTCTGGG + Intergenic
1190603411 X:52115866-52115888 CTACAGTAACAAAAGCAGCATGG + Intergenic
1192107671 X:68331568-68331590 CTAAAAAAACAAAATCAGCTGGG + Intronic
1192170667 X:68852595-68852617 CTGAACAAACAAAAGCAGCTGGG - Intergenic
1192206681 X:69101048-69101070 TTAGTCAAACAAAAGCTGCTAGG + Intergenic
1192423162 X:71052049-71052071 CTACATAAACAAATTCTGTTAGG + Intergenic
1193062121 X:77218041-77218063 CAACAGATACAAAAGCTCCTAGG + Intergenic
1194441472 X:93939721-93939743 CTGCATAAAGAAAATCTGGTCGG + Intergenic
1194877353 X:99206548-99206570 CTAGAAAAACAAAAGCTGGGGGG - Intergenic
1195398123 X:104433128-104433150 CCACATAAACAGAAGCTTGTTGG + Intergenic
1195434085 X:104822636-104822658 CTACATTAACAAAAACAGCATGG - Intronic
1195729790 X:107954976-107954998 CTACAGTAACCAAAGCTGCATGG - Intergenic
1195905699 X:109842130-109842152 CTTCAAAATCAAAAGCTGCCTGG + Intergenic
1195927505 X:110040505-110040527 ACAGATAAAGAAAAGCTGCTGGG - Intronic
1196437699 X:115689818-115689840 TTAAAAAAACAAAAGCAGCTGGG - Intergenic
1197131836 X:123014573-123014595 CTACTTAATCAAAATCTCCTGGG + Intergenic
1198400593 X:136264578-136264600 ATACACACAAAAAAGCTGCTGGG - Intergenic
1198718071 X:139583787-139583809 CTACATAAACAAGAGTTCTTTGG + Intronic
1199676298 X:150192179-150192201 CCACATAAACAAAAGGTCTTTGG - Intergenic
1199822744 X:151465376-151465398 CCACATAAACAAAAGCTTTTCGG - Intergenic
1200842210 Y:7794067-7794089 CCACATAAACAAAAGTTCTTAGG - Intergenic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1201785672 Y:17775567-17775589 CTACAAATACAAAAGTAGCTGGG - Intergenic
1201815881 Y:18130421-18130443 CTACAAATACAAAAGTAGCTGGG + Intergenic
1202371546 Y:24200888-24200910 CTACATAAACCAAAGCTCCTTGG + Intergenic
1202376479 Y:24242720-24242742 CTATATACAGAAAAGCTCCTTGG + Intergenic
1202494301 Y:25427399-25427421 CTATATACAGAAAAGCTCCTTGG - Intergenic
1202499239 Y:25469228-25469250 CTACATAAACCAAAGCTCCTTGG - Intergenic