ID: 1091505532

View in Genome Browser
Species Human (GRCh38)
Location 12:1063798-1063820
Sequence CAGAATACCACCAAACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091505532 Original CRISPR CAGAATACCACCAAACAGCA AGG (reversed) Intronic
903047921 1:20578243-20578265 GACAATACCACAAACCAGCAAGG + Intergenic
906218236 1:44057081-44057103 CTGTAAACCACCAAACACCAGGG - Intergenic
907512724 1:54973705-54973727 CAGAATTCCAGGAACCAGCAGGG + Intergenic
909713942 1:78684279-78684301 CAGAATTCCACCAGACAGCTGGG + Intergenic
910837799 1:91533261-91533283 CAGAGTACCACCAAGCAAAAAGG + Intergenic
912973363 1:114304928-114304950 AAGAAAACCAACAAACAGAAAGG + Intergenic
918148188 1:181776207-181776229 CAGAATATGACCGAGCAGCATGG + Exonic
919186508 1:194158169-194158191 CTGAAAACCAACAAACAGAAAGG + Intergenic
920019017 1:202939816-202939838 CACAATAGCACCGAAAAGCATGG + Intergenic
920213837 1:204348362-204348384 GAGAATACGCCCAAACAGCAAGG + Intronic
921756044 1:218856754-218856776 CAGAATACCACAGAATAACAGGG - Intergenic
923887290 1:238173172-238173194 GAGAACAGCACCAAACAGGATGG - Intergenic
924578417 1:245301513-245301535 CAGAGTACCACTAAGCAGCCCGG - Intronic
1065856106 10:29831672-29831694 CACAATAACACCAAGGAGCATGG + Intergenic
1069238876 10:66113208-66113230 CAGAGTACCACTAATCATCATGG - Intronic
1069559510 10:69419640-69419662 CACAATTACACCAACCAGCAAGG - Intergenic
1069643920 10:69977800-69977822 AATAATAACAACAAACAGCAAGG + Intergenic
1070766881 10:79061811-79061833 CAGAATCCCACTGAACAGAATGG - Intergenic
1071452823 10:85815000-85815022 CAAAATACCAGCAAACTGAAAGG + Intronic
1071860409 10:89666641-89666663 TAGAAGACCACCAAAAAGCAAGG + Intergenic
1072045916 10:91654913-91654935 AAAAAAACCACCAAAAAGCATGG - Intergenic
1072307473 10:94121395-94121417 CAGAATGCTACCAAATAGCTAGG + Intronic
1072757033 10:98028476-98028498 AAGAATACCACCAACCGGGAAGG - Intronic
1073497860 10:103910723-103910745 TAGAATTTCAGCAAACAGCATGG - Intronic
1074203184 10:111257937-111257959 CAGAAAACCAACAAACAGGATGG - Intergenic
1074276899 10:112012025-112012047 CAGATAACCACCAAGCAGCGTGG + Intergenic
1075475799 10:122732406-122732428 TCAAATACCCCCAAACAGCATGG + Intergenic
1078756148 11:14212280-14212302 CAGAATATCCCCAAAAAGCAAGG - Intronic
1078811673 11:14774152-14774174 CAAAACACAACCAAACAGCCAGG - Intronic
1079959383 11:26904244-26904266 CAGAAGGCCACAAAACAGCTGGG - Intergenic
1081476540 11:43438438-43438460 AAGATTACCACCATACAGCCGGG - Intronic
1084348367 11:68573923-68573945 CAGAATATGACCATGCAGCATGG - Intronic
1086285862 11:85250120-85250142 AAGAAAACTACCATACAGCAAGG + Intronic
1087552287 11:99666625-99666647 CCGAACTCCACCAAAGAGCATGG - Intronic
1087753910 11:102035243-102035265 CAAAATAACACAAAAAAGCAGGG - Intergenic
1091505532 12:1063798-1063820 CAGAATACCACCAAACAGCAAGG - Intronic
1091821370 12:3477928-3477950 CAGAATACAACCTAAGAGAAAGG - Intronic
1091911089 12:4231172-4231194 AAGAATACCACCATAAAGCAGGG + Intergenic
1092491619 12:8950286-8950308 CAAAATACCACGAAGCAGTAAGG - Intronic
1093759997 12:22898795-22898817 CAGAATACAACATAACAGAAAGG - Intergenic
1094746054 12:33345689-33345711 CAAAATATCACCAAACAGTAGGG - Intergenic
1095187879 12:39222721-39222743 CAGAAAACCACCAACCAAAAAGG - Intergenic
1095549661 12:43418917-43418939 CAAAATACCTCCAAATAACAAGG - Intronic
1101386546 12:104263198-104263220 CAGAATACCACCAATCAGGTAGG + Intronic
1105268733 13:18849030-18849052 CAGGCTACAACCAAACAGAATGG - Intergenic
1105822747 13:24094440-24094462 CAGAATGCCAGCACACAGCAGGG + Intronic
1108595003 13:51942038-51942060 CAGAATTCTACCATACAGAATGG + Intronic
1109859746 13:68180968-68180990 CAGCATACCACCAAGCACCAGGG - Intergenic
1110669518 13:78160965-78160987 AAGAATACCACAAAACCACAGGG + Intergenic
1111325426 13:86688731-86688753 CAGAATACCATCAAAGATGATGG + Intergenic
1114723862 14:24912706-24912728 CAGAACAGCACCAGATAGCATGG - Intronic
1202830572 14_GL000009v2_random:24924-24946 CAGCCTACAACCAAACAGAATGG + Intergenic
1125148505 15:36502922-36502944 GAGAATAGTACCAGACAGCAGGG - Intergenic
1125272527 15:37955038-37955060 GAGAAGACCACAAAACAACAAGG + Intronic
1127899315 15:63329535-63329557 GAGAAAACCACCAGACAGAAGGG - Intronic
1129156974 15:73724260-73724282 CAGAAAACAACCAATGAGCAGGG - Intergenic
1132524360 16:407018-407040 CACATTACCCCCAAACAGGAAGG - Intronic
1135932759 16:26753068-26753090 CAGCAGACCAGCAAACAGCAAGG - Intergenic
1136986838 16:35114493-35114515 CTGCATAACACCAAACAGAATGG + Intergenic
1139324603 16:66142553-66142575 CAGAACACTATCCAACAGCATGG + Intergenic
1140279480 16:73541766-73541788 AAGAGAACCACCAAACAGGAGGG - Intergenic
1140577529 16:76188596-76188618 CAGAAAACTAACAAACAGCTGGG + Intergenic
1142308338 16:89298216-89298238 CAGATGACAACCAAACAGAACGG + Intronic
1142733085 17:1875892-1875914 CCAAATACCACCAAATAGAATGG + Intronic
1144393805 17:14823134-14823156 CAGACTACATCCAAAAAGCAGGG - Intergenic
1144723609 17:17489297-17489319 CTGAAAACCCCCAAATAGCAAGG - Intronic
1145966762 17:28924503-28924525 CAGAGAATCACCAAAAAGCATGG + Intronic
1149325616 17:55526899-55526921 CAGGATACCACCAAGCCTCAGGG + Intergenic
1149980080 17:61303751-61303773 CAGAAAACCACAGTACAGCACGG - Intronic
1151320458 17:73349483-73349505 CAGAAAACCGCCACACATCAGGG + Intronic
1151947923 17:77329592-77329614 CAGCATCCCACGAAACAGGAAGG - Intronic
1152617577 17:81345077-81345099 CAGAATACCCCCAAAGCCCATGG + Intergenic
1154150475 18:11902623-11902645 CAGAAACCTACCAAACAGCAAGG - Intronic
1155938865 18:31782934-31782956 CTTGATATCACCAAACAGCATGG - Intergenic
1157059039 18:44265408-44265430 CAGAATAGCACCATACAGAGGGG + Intergenic
1158467990 18:57708501-57708523 CAAATTACCACCAAATAGAATGG - Intronic
1161836175 19:6648469-6648491 CAGATTACCAGCTTACAGCAGGG - Intergenic
1162746824 19:12803377-12803399 CACAATGCCACCTGACAGCAGGG - Intronic
1164091063 19:21952591-21952613 AAGAAAACCAGCAAACAGAAAGG + Intronic
1164110193 19:22149289-22149311 AAGAAAACCAGCAAACAGAAAGG + Intergenic
1164666327 19:30041023-30041045 CACACTACCACAAAACAGTATGG - Intergenic
1166459306 19:42972255-42972277 CAGAAAGCCAGCAAACAGGAGGG + Intronic
1168602948 19:57734370-57734392 GAGAAGACCACCAAACAACATGG + Intronic
1202642125 1_KI270706v1_random:102854-102876 CAGCCTACAACCAAACAGAATGG - Intergenic
925255348 2:2481043-2481065 CAGAAAGCCCCAAAACAGCAAGG - Intergenic
928754278 2:34505519-34505541 CAGAAAACTAACAAACAGAAAGG + Intergenic
931293049 2:60893717-60893739 CAGCATACCACAAAGGAGCAAGG - Intronic
931896790 2:66740577-66740599 CAGTTGACCACCAAACAACATGG - Intergenic
933181839 2:79235894-79235916 CAGAAAACATCCAGACAGCAGGG - Intronic
935028304 2:99298315-99298337 CAAAATAGTAACAAACAGCAAGG + Intronic
936970142 2:118169217-118169239 CAGAAAACCACCATCCAGAAAGG - Intergenic
937458934 2:122068855-122068877 CAGCAGACCACCAATCAGTAGGG - Intergenic
938994317 2:136661199-136661221 CATAATAGCACCAAACTGCTAGG - Intergenic
942125634 2:172822447-172822469 CAGAATGCCTATAAACAGCAAGG - Intronic
943278927 2:185905464-185905486 AAGGATACCACCGAACACCAGGG + Intergenic
944134998 2:196389536-196389558 CAGAACACCTACAAACAGCCTGG + Intronic
945151077 2:206792671-206792693 CAGAATAACACCAACTTGCATGG - Intergenic
945277660 2:208004452-208004474 AAGTATTCCACCAACCAGCATGG - Intronic
945959051 2:216113227-216113249 CAGAATCCCCCCAAACAGAGGGG - Intronic
947290128 2:228563730-228563752 CATAATTCCACCAAACACCTTGG - Intergenic
947308161 2:228770584-228770606 AAAAATAAAACCAAACAGCAAGG + Intergenic
1171220028 20:23387859-23387881 CAGAATAACACCAAATATCTGGG - Intronic
1171889230 20:30693024-30693046 CAGCCTACAACCAAACAGAATGG - Intergenic
1173295877 20:41756337-41756359 CAGAAGACAATAAAACAGCATGG - Intergenic
1174442221 20:50565178-50565200 CAGCATACCAAAAAGCAGCAAGG + Intronic
1175508387 20:59503798-59503820 CAGCATACCCCCAAGAAGCATGG - Intergenic
1175704197 20:61163822-61163844 TAAAATACCAACAAGCAGCAAGG - Intergenic
1176378803 21:6101544-6101566 CAGAAGCCCACCAAACAGACGGG - Intergenic
1176609757 21:8869762-8869784 CAGCCTACAACCAAACAGAATGG + Intergenic
1176871880 21:14089936-14089958 CAGAAAACCACCAAATTACAAGG - Intergenic
1177418860 21:20829146-20829168 CAAATTACCACCAATCATCACGG + Intergenic
1177540195 21:22482809-22482831 CAAAATGCTACCAAATAGCATGG + Intergenic
1178180298 21:30152613-30152635 CAGAATACCAAGAAATAACACGG + Intergenic
1179558075 21:42193357-42193379 CTGAGAACCACAAAACAGCAAGG - Intergenic
1179744671 21:43436693-43436715 CAGAAGCCCACCAAACAGACGGG + Intergenic
1179826850 21:43971112-43971134 CAGAAAACAGCCAGACAGCAGGG + Intronic
1179880251 21:44290629-44290651 CAGAATCCCCCCAGACAGCCAGG - Intronic
1179963061 21:44781729-44781751 TAGAACACCACAAAACAGAAAGG - Intronic
1180359815 22:11879004-11879026 CAGCCTACAACCAAACAGAATGG + Intergenic
949309842 3:2684791-2684813 CAGATTACAACAAAACAACATGG - Intronic
952698669 3:36302325-36302347 CAGCATCCCAGCAAAGAGCATGG + Intergenic
953591017 3:44254091-44254113 GAGAATACCACCTAACCACAAGG - Intronic
954044090 3:47914715-47914737 CTGATTACCACCATACAACAGGG + Intronic
954666475 3:52256069-52256091 CAGAGTACCACCAAGCAAAAAGG + Exonic
956809138 3:72847644-72847666 CAGAAGAGCAGCAGACAGCAGGG + Intronic
958502718 3:94935666-94935688 CAGAGTACCACCAAGCAGAAAGG + Intergenic
958789652 3:98636509-98636531 CAGAAAATCATCAAACTGCAAGG + Intergenic
959552852 3:107683005-107683027 GAGAATAACACCAAAATGCATGG + Intronic
959934248 3:112013103-112013125 CAGAATTCCAGCAAAGAGTAGGG - Intronic
961349712 3:126292094-126292116 AAGAAATCAACCAAACAGCAGGG - Intergenic
963350765 3:144148433-144148455 AAGAATACTACCACAGAGCAGGG - Intergenic
963462507 3:145634690-145634712 CAACATACCACCAAACTGGAAGG - Intergenic
963965146 3:151359895-151359917 CAGAATATTACAAAACAGAAGGG + Intronic
963985366 3:151587302-151587324 AAGAAAACCACCAAACAGTATGG - Intergenic
966233753 3:177677360-177677382 AAGAATAGCAACCAACAGCAAGG - Intergenic
966890684 3:184405532-184405554 GAGATGACCAGCAAACAGCAGGG - Intronic
1202736438 3_GL000221v1_random:4540-4562 CAGCCTACAACCAAACAGAATGG + Intergenic
969383693 4:6827393-6827415 CAGAACTCCAGCTAACAGCAAGG + Intronic
971246393 4:24932750-24932772 CAGAATACCTGAAAACACCAGGG + Intronic
972004755 4:34086463-34086485 CAGAATAACACATAACAGAAGGG + Intergenic
972324060 4:37998535-37998557 GAGAAAACCACCTAAGAGCAAGG - Intronic
976611712 4:87037297-87037319 CAACCTACCACCAAGCAGCATGG - Intronic
977355934 4:95946556-95946578 TAAAATACTATCAAACAGCATGG - Intergenic
978484492 4:109235710-109235732 CATAAAACAAACAAACAGCAAGG + Intronic
979207503 4:118057620-118057642 CAGTATAAAACCCAACAGCAGGG + Intronic
979564858 4:122143335-122143357 CAGAAGACCACAAAACAACCAGG - Intergenic
982737261 4:159019520-159019542 CAGATAAGCACCAAACAGAAGGG - Intronic
984737496 4:183124039-183124061 CTGAATTCTACCAAACTGCAAGG - Intronic
1202769493 4_GL000008v2_random:188726-188748 CAGCCTACAACCAAACAGAATGG - Intergenic
986905252 5:12488043-12488065 CAGAATAGCACTATACAGAAGGG + Intergenic
989096039 5:37782122-37782144 CTGCATACCACTAAAGAGCAAGG - Intergenic
989116145 5:37954825-37954847 CTGAAAACCACAAAACAGGAAGG - Intergenic
993623563 5:90195507-90195529 CAGAAGACCACAAAACAACCAGG + Intergenic
994829466 5:104760253-104760275 CAAAATACAACCAAATAGCTGGG + Intergenic
995340003 5:111047930-111047952 CACAATTCCACTAAACTGCAGGG + Intergenic
995651224 5:114370734-114370756 CAGAATGGTACCAAACAGAATGG + Intronic
996636489 5:125695675-125695697 CTGAATACCACCAAACATATTGG - Intergenic
996682569 5:126243673-126243695 TAGGATACCACCAAACACAAAGG - Intergenic
998576290 5:143320976-143320998 CAGAATACCAAGAACCAGTATGG + Intronic
998897974 5:146820589-146820611 GAAAATATCCCCAAACAGCATGG - Intronic
1000930245 5:167242855-167242877 CAGATGACCACTGAACAGCATGG - Intergenic
1000954513 5:167526948-167526970 CACAATACATCAAAACAGCATGG + Intronic
1002909987 6:1482710-1482732 AAGAATAGCACAAAACAGGAAGG - Intergenic
1003088267 6:3079071-3079093 AAAAATACCACCACACAGCTGGG - Intronic
1006649408 6:35538438-35538460 CAGAAAACAAACAAACAGCCGGG + Intergenic
1008224615 6:48899312-48899334 CAGCATAGCACGAAAGAGCATGG - Intergenic
1008351932 6:50501480-50501502 CAGAAAATCAGCAAACAACAAGG + Intergenic
1013803944 6:113976130-113976152 CTGAATACCACAAACCAACAGGG - Intronic
1014072751 6:117202170-117202192 CATAATAGCACAAAACAGTAAGG + Intergenic
1014110880 6:117617521-117617543 AAGCACAGCACCAAACAGCAAGG + Intergenic
1015210401 6:130691170-130691192 GAGAATGCCAGCAAACAGCTCGG + Intergenic
1016742880 6:147546971-147546993 GAGAATAACACCATACAGCTGGG + Intronic
1016792316 6:148078902-148078924 CAGAAAACCACCAACCTGCTGGG - Intergenic
1017790739 6:157796585-157796607 CAGGATCCCACCTAACTGCAAGG + Intronic
1018015132 6:159705073-159705095 AAGAAAACCAACAAACAGAAAGG + Intronic
1020469623 7:8521380-8521402 CACAGTTCCACCTAACAGCAAGG - Intronic
1022593536 7:31689330-31689352 CAGAATTCAACCAAAAAGCTAGG - Intronic
1026540715 7:71277515-71277537 AAGAATATTACAAAACAGCAAGG + Intronic
1027196777 7:76036061-76036083 CAGAATAGCACCAAATGGGATGG - Intronic
1028625987 7:92877582-92877604 CAGAAAACCATCAAACCACAAGG + Intergenic
1028738302 7:94243435-94243457 CAGAAAACCTCCAACCAGCCTGG + Intergenic
1028837328 7:95389364-95389386 TAAAATACCACCAAAGAACATGG - Intronic
1030088108 7:105834602-105834624 CAGAATAGCACCCTTCAGCAAGG - Intronic
1030154540 7:106440318-106440340 AAGAACACCAACAAACAGAAAGG + Intergenic
1031446079 7:121856451-121856473 CAGAATACCACAAATCTGAATGG + Intergenic
1031770095 7:125831646-125831668 CAGAACATCCCAAAACAGCATGG - Intergenic
1032719768 7:134541267-134541289 CAGAATATCACAGAAAAGCATGG + Exonic
1033115469 7:138620894-138620916 CCTAAATCCACCAAACAGCAGGG + Intronic
1034016184 7:147589404-147589426 CAGCAGCCCTCCAAACAGCAAGG + Intronic
1034555376 7:151847176-151847198 CAGAATAACACTAGACATCAGGG - Intronic
1036558110 8:9877511-9877533 CAGAAAACTAACAAACAGAAAGG + Intergenic
1039023963 8:33237735-33237757 CAGAACAACACAAATCAGCATGG - Intergenic
1040571900 8:48618930-48618952 CAGAAGCCCACCAAACAGAGTGG - Intergenic
1041484641 8:58361186-58361208 CAGAAAACCACTAAACCACAGGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1041902064 8:62993188-62993210 TAGTATCCCACCAGACAGCAAGG + Intronic
1042316569 8:67432299-67432321 ATGAATACCCCTAAACAGCAGGG + Intronic
1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG + Exonic
1044219495 8:89652137-89652159 CAGAAAATCACCAAACCACAAGG + Intergenic
1044362625 8:91306356-91306378 AAGAAAAGCACCAAACAGCTGGG - Intronic
1045943077 8:107761559-107761581 CAGAATACAGCCAAAGAGCAAGG - Intergenic
1046412769 8:113869279-113869301 TACAATAGCACCAAACATCAAGG - Intergenic
1050450942 9:5780391-5780413 AGGAAAACCACCAAACAGAAAGG + Intronic
1050525542 9:6543341-6543363 CGGAATGACACCAGACAGCAGGG + Intronic
1052623112 9:30939777-30939799 CAGAAGACCATTATACAGCAAGG - Intergenic
1053166768 9:35849966-35849988 CAGGATGCCAGCAATCAGCAAGG - Intronic
1056931955 9:90886211-90886233 CTCAATATCACCAAACAGCAGGG + Intronic
1057175848 9:92998667-92998689 CAGAAAACTAACAAACAGAAAGG - Intronic
1058447928 9:105070190-105070212 CAAAATAGGACCAAACTGCATGG - Intergenic
1203694384 Un_GL000214v1:82452-82474 CAGCCTACAACCAAACAGAATGG - Intergenic
1203705169 Un_KI270742v1:34979-35001 CAGCCTACAACCAAACAGAATGG + Intergenic
1203558839 Un_KI270744v1:30832-30854 CAGCCTACAACCAAACAGAATGG - Intergenic
1203641889 Un_KI270751v1:21611-21633 CAGCCTACAACCAAACAGAATGG + Intergenic
1186422853 X:9440073-9440095 CAGAATCCCACAAAAGAACAGGG + Intergenic
1190412927 X:50154827-50154849 CAAAATAACAACAAAAAGCAGGG - Intergenic
1193770121 X:85578226-85578248 AAGAAAACCCCCAAAAAGCAGGG + Intergenic
1194078627 X:89430012-89430034 CAGAATAACACCAGTCAGAATGG - Intergenic
1194918528 X:99734512-99734534 AGGAATACCACCAAAAATCATGG + Intergenic
1198133385 X:133722400-133722422 CAGGATACCACCACATAGCACGG + Intronic
1200077725 X:153559928-153559950 CAGCCTACCGACAAACAGCAGGG - Exonic
1200431235 Y:3085134-3085156 CAGAATAACACCAGTCAGAATGG - Intergenic
1200634942 Y:5639899-5639921 TAAAATACTATCAAACAGCATGG - Intronic
1200845014 Y:7823099-7823121 CAAAAAACCACCAAACAACTTGG + Intergenic
1200849092 Y:7864253-7864275 CAGAATACCACTTATAAGCACGG - Intergenic
1202029647 Y:20558239-20558261 CAGAATCCCACAAAATAGGAGGG + Intergenic