ID: 1091505728

View in Genome Browser
Species Human (GRCh38)
Location 12:1065973-1065995
Sequence AGATGTAGAATGCTAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091505726_1091505728 13 Left 1091505726 12:1065937-1065959 CCGTGTATATGTAATATATTTTG 0: 1
1: 0
2: 9
3: 97
4: 905
Right 1091505728 12:1065973-1065995 AGATGTAGAATGCTAATTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091505728 Original CRISPR AGATGTAGAATGCTAATTGG TGG Intronic
904276809 1:29390259-29390281 ACATGTAGAATTCTCATTGCTGG - Intergenic
907914782 1:58858734-58858756 AGAAGGAGAATGCTAATTCCAGG - Intergenic
909434551 1:75625749-75625771 AGATTTAGGATGGTAACTGGGGG - Intergenic
911198487 1:95019863-95019885 AGCTGTAGAAAGCTTATTGCTGG - Intronic
912252773 1:108028319-108028341 AAATGTAGAATGCAATTTTGTGG + Intergenic
912472714 1:109916558-109916580 AGATGTGGAATAATGATTGGGGG - Intronic
913084166 1:115419932-115419954 ACATGTAAACTGCTAATTGTAGG + Intergenic
914683928 1:149961267-149961289 AGATTTAGAAGACTATTTGGAGG - Intronic
915004074 1:152620868-152620890 AGATCTAGACTGCTAATTGGTGG + Intergenic
916207188 1:162326372-162326394 AGAGGTAGAATGCTAATACCTGG + Intronic
917118543 1:171625810-171625832 GGATGGAGAAAGCTAATTGATGG + Intergenic
917455941 1:175185993-175186015 AGAGGTAGGATGCAGATTGGTGG + Intronic
919588967 1:199475447-199475469 AGAGCTAGAATGCTAATTAATGG - Intergenic
920409903 1:205750781-205750803 GAATGGAGAATGGTAATTGGGGG - Intergenic
921470480 1:215542371-215542393 AGATGTAGAATTCTAAGAGATGG - Intergenic
924631166 1:245742317-245742339 AGATGTTGGATTTTAATTGGTGG + Intergenic
1063418594 10:5892376-5892398 AGATTTAGAATTCTAATTTTGGG + Intronic
1064715925 10:18176661-18176683 AGATCTAGAATGCCAAATGGAGG + Intronic
1064888688 10:20143045-20143067 ACATGTACAATTTTAATTGGGGG - Intronic
1065222657 10:23512082-23512104 AGAAGAAGAGGGCTAATTGGGGG - Intergenic
1065335335 10:24651440-24651462 ATATGCAGAAGGCTTATTGGGGG - Intronic
1068327267 10:55509543-55509565 ACATGTACATTGCTAAGTGGAGG - Intronic
1072739010 10:97898430-97898452 AGATGAAGAGGGATAATTGGGGG + Intronic
1073719249 10:106147867-106147889 AGATGTTGAATGCTCATAGCAGG - Intergenic
1074570717 10:114621688-114621710 TGATGGAGAATGCAAAATGGAGG - Intronic
1077913264 11:6592914-6592936 AAATGAAGAAATCTAATTGGTGG + Intronic
1078227075 11:9402098-9402120 AGGTTAAGAATGCTAGTTGGAGG + Intronic
1078960741 11:16265713-16265735 AGATGTAAAAGGTTAAATGGAGG + Intronic
1084406576 11:68977692-68977714 AGATGTACAACTCTAAATGGGGG - Intergenic
1089092154 11:115886919-115886941 AGAGGTAGAATGAAAATTTGGGG + Intergenic
1090963776 11:131580601-131580623 AGATGGAGAGAGCTAATGGGAGG + Intronic
1091505728 12:1065973-1065995 AGATGTAGAATGCTAATTGGTGG + Intronic
1098349513 12:69543524-69543546 ATATGTAGTATGCCACTTGGTGG + Intronic
1101055415 12:100907394-100907416 AGATCTAGAAAGCTTCTTGGAGG - Intronic
1101977874 12:109377609-109377631 AGAGGCAGAATGCAGATTGGTGG - Intronic
1106934500 13:34703529-34703551 AGATTTAGAATGCTCTTTGTTGG - Intergenic
1112135957 13:96577997-96578019 AGATTTAAAATGCCAAGTGGTGG + Intronic
1112965714 13:105190739-105190761 AGCTGTAGAATGTGAGTTGGTGG + Intergenic
1114755929 14:25259895-25259917 AGATGTAGAATGAGTTTTGGTGG + Intergenic
1117151757 14:52896302-52896324 AGCTGTAGATTGCTAATTACTGG + Intronic
1118493685 14:66286926-66286948 AGATGTGAAATGATAAGTGGTGG - Intergenic
1118698631 14:68410763-68410785 AGATGTAAGATGCAATTTGGAGG + Intronic
1119556271 14:75555559-75555581 AGAGGTGGGATGCTAATGGGAGG - Intergenic
1121530482 14:94649324-94649346 AAATGTAGAATGCAAAATGAAGG - Intergenic
1126146434 15:45477409-45477431 AGATGTTAAATACTAATTTGGGG - Intergenic
1126526374 15:49659576-49659598 AGGTGTATAATACTAATTTGGGG + Intergenic
1126566570 15:50107590-50107612 AGATTTAGAATGATAAATGAAGG + Intronic
1126648710 15:50900394-50900416 AGATGAAGAAGGCTAATTAAGGG - Intergenic
1126839088 15:52698282-52698304 GGATGTAGAATTCTTATTTGTGG + Intronic
1126959356 15:53973778-53973800 TGATGTTGAATGCTGTTTGGTGG - Intergenic
1135581649 16:23632541-23632563 AGAGATAGAATGCAGATTGGTGG + Intronic
1139066290 16:63319335-63319357 ATATGTAAAAAGCTAATGGGTGG + Intergenic
1141582130 16:85006924-85006946 AGAGAAAGAATTCTAATTGGAGG - Intronic
1142858634 17:2748117-2748139 AGATGTGGACTGCTAAATGCAGG - Intergenic
1144576590 17:16433593-16433615 AGATGGAGAATGGCTATTGGTGG + Exonic
1150179929 17:63107774-63107796 AGAGACAGAATGTTAATTGGTGG + Intronic
1150287291 17:63961523-63961545 AGATGTGGAGTGCTAAGGGGCGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153287456 18:3469556-3469578 AGAAGGAGAAAGCAAATTGGAGG - Intergenic
1153576590 18:6527947-6527969 AGATGTAAAATTTTAATTTGGGG - Intronic
1156600681 18:38602313-38602335 ATATGTACAATGCTTATTTGGGG + Intergenic
1158759824 18:60371542-60371564 AGATGTAGAATATTAAGTGGAGG + Exonic
1159530599 18:69651044-69651066 AGATGTAGAAGGCATATTGTTGG + Intronic
1164029522 19:21389878-21389900 AGACGCAGAGTGCTGATTGGTGG - Intergenic
1164453466 19:28386614-28386636 AGGTGTAGAAGGCTCACTGGAGG + Intergenic
1164453492 19:28386798-28386820 AGGTGTATAAGGCTCATTGGAGG + Intergenic
928746508 2:34421756-34421778 AGATGAAGTATTTTAATTGGTGG + Intergenic
929303711 2:40335180-40335202 AGTTGTAGTATGATAATTGTAGG - Intronic
936111206 2:109666675-109666697 ACATGTTGGCTGCTAATTGGAGG + Intergenic
937029673 2:118727969-118727991 AGGTGTTAAATGCAAATTGGAGG + Intergenic
937562360 2:123241668-123241690 AGAAGTAGAATGGTGGTTGGCGG + Intergenic
940018125 2:149128306-149128328 AGATTTAAAATGCTATTTGATGG - Intronic
940308853 2:152255512-152255534 AGAGGTAGAATGTTAAGAGGAGG - Intergenic
940557771 2:155253204-155253226 AGACAGAGAATGCAAATTGGTGG - Intergenic
945141712 2:206693562-206693584 AGGTGTAGAATGCCAAATGACGG - Intronic
946344550 2:219098273-219098295 AGATGTAGGGTGGTAACTGGTGG + Intronic
946676363 2:222163984-222164006 AGACGCAGAAGGCCAATTGGTGG + Intergenic
947676089 2:231981731-231981753 AGATGTTTAATACTAATTGGTGG + Intronic
1170181237 20:13532204-13532226 AGATGGTGAATGGTAATTTGAGG - Intronic
1172670063 20:36628951-36628973 AGATGAAAAATGTTAGTTGGGGG - Intronic
1177845555 21:26283975-26283997 AGAAGTAGAAAGTTTATTGGAGG + Intergenic
1181975415 22:26725555-26725577 AGAGATAGAATGTAAATTGGAGG - Intergenic
1184063842 22:42103961-42103983 ACATTTAGAAAGCTTATTGGAGG - Intergenic
951024740 3:17817353-17817375 AGATACAGAGTGCTGATTGGTGG + Intronic
955545182 3:60020387-60020409 AGATATAGAAAACTAAATGGGGG - Intronic
957127631 3:76182547-76182569 AGATTTAGAAGGCTTACTGGAGG - Intronic
957544756 3:81623207-81623229 AGATGTAGATTGGTAAGTGAGGG - Intronic
959638561 3:108604673-108604695 AGATGTAGAATCATGATTTGGGG + Intronic
960641943 3:119833340-119833362 AGATCTAGAATACTAATTCATGG - Intronic
961815099 3:129545618-129545640 AGATGCAGAAAGCAGATTGGTGG - Intronic
962008265 3:131369679-131369701 AGATCCTGAATCCTAATTGGGGG - Intergenic
962242466 3:133761967-133761989 AGAGGTAGAATTCTTATCGGTGG + Intronic
962731956 3:138291867-138291889 AGAGGGAGAATGCTAATAGGTGG + Intronic
964447398 3:156774439-156774461 AGAGGTAGAATCCAAATAGGTGG - Intergenic
971592662 4:28488152-28488174 AGATGTAGATTGCTCATGGTTGG - Intergenic
976724867 4:88205979-88206001 AGATATAAAATGATAAATGGTGG - Intronic
979269049 4:118738109-118738131 AGATTAAGAATGCAATTTGGGGG - Intronic
981134294 4:141192449-141192471 AAATATATAATGCTAATTTGTGG + Intronic
981386363 4:144135970-144135992 AGATGTAGAAAACAAATTAGTGG + Intronic
981657139 4:147124636-147124658 AGAGGAAGAGTGCTAATTAGAGG - Intergenic
984411132 4:179399420-179399442 AGATGAATAATGGTATTTGGAGG - Intergenic
988695847 5:33622075-33622097 AGATGTCAAATGCTCAGTGGTGG + Intronic
989325905 5:40194198-40194220 ATATATAGATTGCTAATTGTTGG - Intergenic
989577726 5:43004241-43004263 AGATGGCGAGTGCTTATTGGGGG - Intergenic
994200166 5:96965246-96965268 AGATGAAGAACTCTAATTAGTGG - Intronic
995186521 5:109277762-109277784 AGAAGTAGAATGGTGATTGCTGG - Intergenic
995289784 5:110438488-110438510 AGATGAACAATGTTAAGTGGAGG - Intronic
997096745 5:130922002-130922024 AGATGTAGGTTGCTGATTGGTGG - Intergenic
998890445 5:146740138-146740160 AGAGGTGAAATGCTAAATGGTGG + Intronic
999386747 5:151158865-151158887 AGAAGCAGAAAGCAAATTGGTGG - Intergenic
1000275081 5:159726952-159726974 AGATTTAGAATGCAAATGGAAGG + Intergenic
1000481521 5:161781986-161782008 ATATGAAGAATGGTAATTTGAGG + Intergenic
1000743157 5:164995571-164995593 ACATATAGAATGCTCTTTGGAGG + Intergenic
1001198262 5:169693116-169693138 ATATGGAGAATCCTAATTTGAGG + Intronic
1001669054 5:173458916-173458938 AGAAGTAGAATGGTAGTTGCCGG + Intergenic
1003724715 6:8747914-8747936 AGATTCAGGATGCTAATAGGTGG + Intergenic
1004400279 6:15282347-15282369 AGCTGTATAATGCTAAGTGTTGG - Intronic
1005042483 6:21611664-21611686 AGCTGTAGGTTGGTAATTGGCGG + Intergenic
1006909109 6:37552526-37552548 AGATGGAGAATGAGGATTGGAGG + Intergenic
1012485942 6:99722665-99722687 AGATGTACAGTGCAAATTGTTGG - Intergenic
1012513735 6:100034235-100034257 ACATGTAGAATGAAAATTTGGGG + Intergenic
1014442963 6:121494507-121494529 TGCTCTAGAATGCTAATAGGAGG - Intergenic
1014912741 6:127113632-127113654 AGATGTAGAGTGCTAGATGAGGG - Intergenic
1014947884 6:127518138-127518160 AGATGTAGAAAACAAGTTGGTGG - Intronic
1014978443 6:127918212-127918234 AGGATTAGAATGCTAATTGCAGG - Intronic
1017943309 6:159072811-159072833 ATATCTAGAATGCTAAATGTTGG - Intergenic
1018769612 6:166959150-166959172 AGGTGAAGAATGGGAATTGGAGG + Intergenic
1019265412 7:114082-114104 AGGAGCAGAAAGCTAATTGGGGG + Intergenic
1020878728 7:13731369-13731391 AGTTGTAGATTCCTAAATGGTGG + Intergenic
1023468670 7:40489119-40489141 AAATGAAGAATGCTTAATGGAGG - Intronic
1023514799 7:40991245-40991267 AGATGGAGAATGCTGGTTGGTGG + Intergenic
1025968247 7:66296030-66296052 ACATGTACAATGCTATTTTGAGG + Intronic
1030801117 7:113853757-113853779 AGAACTAAAAAGCTAATTGGAGG + Intergenic
1030937568 7:115603972-115603994 AGATGTAGAATACAGATTGGTGG - Intergenic
1031197932 7:118640307-118640329 ATATGTAGAAAGTTAATTGAAGG + Intergenic
1031822743 7:126525068-126525090 TGATGTAGAATTATAATGGGAGG + Intronic
1031823149 7:126529644-126529666 AGAGGCAGAGTGCTCATTGGAGG + Intronic
1032949852 7:136894977-136894999 AGTTGTAGAATGCTGACTCGGGG - Intronic
1036676489 8:10838407-10838429 AGGTGTAAAATGCTATTTGTAGG - Intronic
1040623495 8:49116872-49116894 TGATGTAGAATGTAAATTGGTGG - Intergenic
1041193271 8:55374784-55374806 AAATGAAGAATGCAAATTAGAGG + Intronic
1041430369 8:57775123-57775145 AGATGTAAAATGCTAGTGGTTGG + Intergenic
1045382581 8:101642105-101642127 AGATGTAGAAAGCAAATTTCAGG - Intronic
1046123186 8:109870346-109870368 AGCTCTAGAATGCTAATGGAGGG + Intergenic
1050647927 9:7742072-7742094 AGATTTAGAATGCTTATGAGTGG + Intergenic
1051443650 9:17115878-17115900 AGATGTAGAATGATTATTAAAGG + Intergenic
1052483395 9:29062649-29062671 AAAAGTAGAATGGTAATTGCAGG + Intergenic
1053366019 9:37523097-37523119 AGATTTACAGTGCTAATTGCTGG - Intronic
1054730494 9:68698061-68698083 AGATTTAGAATGCCAGGTGGAGG - Intergenic
1055749430 9:79488472-79488494 AGCAGTAAAATGCTAATTAGCGG - Intergenic
1056409961 9:86315459-86315481 ATATGGAAAATGTTAATTGGTGG + Intronic
1057727002 9:97574691-97574713 AGATACAGAGTGCTGATTGGTGG - Intronic
1058364609 9:104193931-104193953 AGATGTAGAATGCATCCTGGAGG + Intergenic
1059789549 9:117625517-117625539 AGATGGAAAATGCTGATTTGTGG + Intergenic
1186448130 X:9649580-9649602 AGATGTATAATGCAAATTAGAGG + Intronic
1187234623 X:17455597-17455619 ATATGTAGTATGCTAGTTGAGGG - Intronic
1188028607 X:25238249-25238271 ATATGTTGAATGTTATTTGGTGG + Intergenic
1188801346 X:34534447-34534469 AGTAGGATAATGCTAATTGGTGG - Intergenic
1193709383 X:84860831-84860853 ACATGAAGAATGCTAATGTGGGG - Intergenic
1195945350 X:110204546-110204568 AGAACTAGAATGCTTATTAGAGG - Intronic
1197832022 X:130653235-130653257 AGATGTAAAATGCTGAAGGGTGG - Intronic
1200990538 Y:9341584-9341606 AGGTGTAGAATGCATATTGCAGG - Intergenic
1200993200 Y:9361901-9361923 AGGTGTAGAATGCATATTGCAGG - Intronic
1201009008 Y:9531972-9531994 AGGTGTAGAATGCATATTGCAGG - Intergenic