ID: 1091511131

View in Genome Browser
Species Human (GRCh38)
Location 12:1127345-1127367
Sequence CAGTATTATTTGTGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091511127_1091511131 9 Left 1091511127 12:1127313-1127335 CCACAAAAGGACATGTATAAGGA 0: 1
1: 0
2: 7
3: 35
4: 306
Right 1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 276
1091511125_1091511131 18 Left 1091511125 12:1127304-1127326 CCTGCTGGTCCACAAAAGGACAT 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091511131 Original CRISPR CAGTATTATTTGTGGGAAGA AGG Intronic
901821451 1:11832830-11832852 CATCATTCTGTGTGGGAAGATGG - Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
906674480 1:47683242-47683264 GAGTATTATTTGTGGGTACTTGG - Intergenic
908744411 1:67361833-67361855 CAGTTTTTTTTGTGGGTGGAGGG - Intronic
911645354 1:100332334-100332356 CAGTATTCATTGTGGGAGGGAGG + Intergenic
913690559 1:121275995-121276017 CAGTAATCTTGGTGGGAGGAAGG - Intronic
914146982 1:145003963-145003985 CAGTAATCTTGGTGGGAGGAAGG + Intronic
915169712 1:153969179-153969201 CAGTGTTCTTTGTGGGAAGGGGG + Intronic
916839246 1:168583232-168583254 CAGTGTAATATGTGGGATGATGG + Intergenic
917668967 1:177254007-177254029 CAGTATAATTTGGGGGACAATGG + Intronic
918251494 1:182707327-182707349 CAGTGTTCTTAGTGGGCAGAAGG - Intergenic
919873699 1:201845009-201845031 CAGTATTTTTTTTGGGAGGGGGG + Intronic
920477878 1:206294484-206294506 CAGTAATCTTGGTGGGAGGAAGG - Intronic
921803999 1:219433484-219433506 CAGTATGATTTTCTGGAAGAAGG - Intergenic
921999851 1:221465624-221465646 CAGTATTTTTTGTGTAAGGAAGG + Intergenic
922138356 1:222854988-222855010 CAGTACTACTAGTGGGAATAGGG + Intergenic
922953944 1:229583381-229583403 CAGTGTTCCATGTGGGAAGAAGG - Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG + Intergenic
924393720 1:243593042-243593064 CAGTTTTTATTGTGGGATGACGG - Intronic
1063262406 10:4405032-4405054 GAGTAGTCTTTGTGGGATGAAGG + Intergenic
1063616012 10:7601115-7601137 AAGTAAAATTTGTGGGGAGAGGG - Intronic
1065577423 10:27136153-27136175 CCTTATTATTAGTGGAAAGAAGG + Intronic
1066322647 10:34319580-34319602 CAGTATTATTTGTAAGATTATGG - Intronic
1068503360 10:57868120-57868142 AAATATTACATGTGGGAAGAAGG - Intergenic
1069868438 10:71518644-71518666 CAGCATTGTTTGTGAGAAGCAGG + Intronic
1069895501 10:71677983-71678005 CAGTATTCTTTGCGGATAGAAGG - Intronic
1069932350 10:71891316-71891338 CAGTAATATCTGTGGGCTGAAGG - Intergenic
1070004386 10:72409080-72409102 CAGCATGATGTGTGGGAAGCGGG - Intronic
1071157157 10:82704009-82704031 AAGGATTCTTTGTGGGTAGAAGG - Intronic
1073687384 10:105770110-105770132 CAGTAATATTTGAGGGAATCTGG + Intergenic
1075550908 10:123391614-123391636 CAGTCTGAGTTGGGGGAAGAGGG + Intergenic
1078043717 11:7893585-7893607 AAGGATTATATGTGGGGAGAGGG - Intergenic
1082304295 11:50552123-50552145 AAGTTTTAATTGTGAGAAGAAGG + Intergenic
1084222243 11:67689689-67689711 TATTGTTATTTGTGGGAGGAGGG - Intergenic
1084840773 11:71844497-71844519 CAGTATTATTTATTGATAGAAGG + Intergenic
1086062341 11:82712676-82712698 CAGCATTATTTGTGGAGACAGGG + Intergenic
1088289873 11:108224310-108224332 CAGAGTTATTTCTAGGAAGATGG + Intronic
1088598918 11:111458787-111458809 TGTTGTTATTTGTGGGAAGAGGG - Intergenic
1089208839 11:116787590-116787612 CACTATTATTTCTCTGAAGAAGG + Exonic
1090442334 11:126734877-126734899 CAGTGTTAATTGTGGCAGGATGG + Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1091923428 12:4323777-4323799 CTGTTTTATGTGTAGGAAGATGG + Intronic
1092632221 12:10394352-10394374 CAGTATTAAATGTGAGAAAATGG + Intronic
1092782801 12:12002941-12002963 CTGTTTTATTTGTTGGAAGGTGG + Intergenic
1094333138 12:29318502-29318524 CAGTAATATTTGTGGGAAATGGG + Intronic
1095199266 12:39363669-39363691 CAGTATTATTTCTCTGAACAAGG + Intronic
1095260420 12:40092914-40092936 CAGACAGATTTGTGGGAAGAGGG - Intronic
1095935030 12:47670159-47670181 GAGTATCACTTGTGGGAAAAAGG + Exonic
1099328388 12:81249391-81249413 CACTAATATTTGTGGGAACTTGG + Intronic
1099346204 12:81503089-81503111 AAGTGTTATTTATGGGAAGTGGG - Intronic
1102852360 12:116260779-116260801 CAGTGATATTTTTGGTAAGAGGG - Intronic
1103367908 12:120396609-120396631 CAGTATTATGTTTGTGAGGATGG - Intergenic
1103824093 12:123722166-123722188 CAGCATTATTTTTGGAAACAAGG + Intronic
1105562692 13:21509192-21509214 CATTATTATCATTGGGAAGATGG + Intronic
1106045360 13:26134744-26134766 GAGTTTGATTTCTGGGAAGATGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107952240 13:45474039-45474061 CAGGCTCATTTGTGGGGAGAAGG + Intronic
1109765273 13:66887245-66887267 CAGTATCATTAGTGGGATGATGG + Intronic
1110098027 13:71556078-71556100 TAGTCTTTTTGGTGGGAAGAAGG + Intronic
1110210432 13:72966014-72966036 CAGTTTTACTTGTGGATAGATGG + Intronic
1111491544 13:88982816-88982838 CAGTATTATATATGTGGAGAAGG - Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1114035013 14:18616044-18616066 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1114123632 14:19698972-19698994 CAGTAAGATTTGTGGGAAATGGG - Intergenic
1115418528 14:33165768-33165790 CAGTTTTGTTTGGGGGAAGGAGG - Intronic
1118419964 14:65591126-65591148 CACTATTCTTTGTGTGAAGGAGG - Intronic
1119672781 14:76532099-76532121 TTGTAATATTAGTGGGAAGAGGG - Intergenic
1119767203 14:77197818-77197840 CAGTAATGTTTGTTGGGAGAGGG + Intronic
1123468625 15:20534065-20534087 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123649489 15:22466997-22467019 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1123728943 15:23129276-23129298 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123747107 15:23326741-23326763 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124279376 15:28350057-28350079 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124303322 15:28561551-28561573 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124532221 15:30517991-30518013 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124766432 15:32489654-32489676 CAGTTTAAGTGGTGGGAAGAAGG - Intergenic
1125481826 15:40086369-40086391 TATTATTATTTGTGGGCAGTTGG - Intergenic
1127275993 15:57444646-57444668 TAGAATTATTTGTGAGAAGAAGG + Intronic
1127542541 15:59955411-59955433 CAGTATTGTTAGTGAGAACAAGG + Intergenic
1129030001 15:72611167-72611189 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129038220 15:72663915-72663937 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129129362 15:73479050-73479072 CAGCATAATCTGTGGGAAGCGGG - Intronic
1129211670 15:74073316-74073338 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1129398733 15:75267768-75267790 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129402341 15:75292044-75292066 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129728792 15:77917591-77917613 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1129839726 15:78736280-78736302 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129933372 15:79430579-79430601 CAATATTGTTTGTGGCAAAAGGG - Intergenic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1134473142 16:14546353-14546375 CAGGATGATTTTTGGGATGAGGG - Intronic
1134515308 16:14882168-14882190 GGGTATTATTTCTGGGAAGTGGG - Intronic
1134702981 16:16280813-16280835 GGGTATTATTTCTGGGAAGTGGG - Intronic
1134964562 16:18431302-18431324 GGGTATTATTTCTGGGAAGTGGG + Intronic
1134968849 16:18513837-18513859 GGGTATTATTTCTGGGAAGTGGG + Intronic
1135045650 16:19152968-19152990 CAGTATTCTTTGTGGGACTTGGG - Intronic
1135814287 16:25618101-25618123 CAGCATAATTTGTGGAAAAAAGG + Intergenic
1135997400 16:27261576-27261598 AAGTTTTCTTTGTGAGAAGATGG - Intronic
1138024170 16:53509937-53509959 CAGTCTTATAAGTGGGAAGTAGG - Intergenic
1138968073 16:62110337-62110359 CATTTTTCTTTTTGGGAAGATGG + Intergenic
1142827038 17:2519898-2519920 CAGTAGAAATTGTGGGAAGGAGG - Intergenic
1146804987 17:35857916-35857938 CAGTATTTTTAGTAGGCAGAAGG + Intronic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG + Intergenic
1152274612 17:79349039-79349061 GAGTTGAATTTGTGGGAAGAGGG - Intronic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1154146059 18:11867125-11867147 CACAATTATTTGGGGGAAGCAGG - Intronic
1155353307 18:24927627-24927649 GAGTATTATTTAGGGGAATATGG + Intergenic
1155817777 18:30335385-30335407 CAGTATTATTTGGGTAAATAAGG + Intergenic
1157875400 18:51268620-51268642 CTTTATTATTTTTGGGGAGAGGG + Intergenic
1160095863 18:75872360-75872382 GAATATTCTTTCTGGGAAGATGG + Intergenic
1161917956 19:7244185-7244207 CTGTATTATTTTTGTGACGATGG - Intronic
1162328911 19:10015005-10015027 CAGTGTGATTTGTGGGTAGCAGG - Intronic
1162594756 19:11619676-11619698 CAGTCATATTAGTGAGAAGAGGG + Intergenic
1166909331 19:46140579-46140601 CAGTATTTTTTCTGTTAAGATGG - Intergenic
925423265 2:3728661-3728683 CAGGTTTATTTGTGGTAGGAAGG - Intronic
925588384 2:5485944-5485966 GAGTATTATTAATGGGAAGTTGG + Intergenic
927344939 2:22027272-22027294 CAGTAACATTTATAGGAAGAAGG + Intergenic
928208721 2:29307170-29307192 CAGTATTTTCTGTGGGTTGAAGG - Intronic
928791399 2:34959810-34959832 CTGGATTATTTGTGGGAAAAGGG - Intergenic
931108071 2:59079780-59079802 TATTATTATTTTTGGGAAAATGG - Intergenic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
932056393 2:68448109-68448131 CAGTGTTCTTTGTGGGAACCGGG - Intergenic
932176430 2:69607127-69607149 GAGTGTTATGTGGGGGAAGAGGG + Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
932968874 2:76514091-76514113 CAGTAGGAGTTGTGGGAGGAAGG - Intergenic
935363179 2:102265015-102265037 CAGTCTTATTTGTGGCAAGGAGG - Intergenic
936288591 2:111200454-111200476 CAGTATGGGTTGTGGGAAGTGGG + Intergenic
936607500 2:113972957-113972979 CAGTATTATGAGTGGGAGCAGGG + Intergenic
938276239 2:130026808-130026830 CAGTAAGATTTGTTGGAAGTGGG - Intergenic
938327196 2:130417564-130417586 CAGTAAGATTTGTGGGAAATGGG - Intergenic
938362742 2:130703913-130703935 CAGTAAGATTTGTGGGAAATGGG + Intergenic
938705174 2:133917522-133917544 CACCATTATTTGAGGGAAGTGGG + Intergenic
939020417 2:136951656-136951678 TAGTATTCTGTGGGGGAAGATGG + Intronic
939071705 2:137552049-137552071 TGCAATTATTTGTGGGAAGATGG - Intronic
939581049 2:143946467-143946489 CAGAATTGTTTGTGGGCAAAGGG - Exonic
941728453 2:168889802-168889824 CAGTTTTACTTGTGAGAAAATGG - Intronic
942020416 2:171862378-171862400 AAGTATTATTTGTGGGATTGTGG - Intronic
942468487 2:176233846-176233868 CAGTATTATTGCAAGGAAGAAGG + Intergenic
942523191 2:176825977-176825999 CAGTTTTAGATGTGGGAAGGTGG + Intergenic
942529517 2:176894579-176894601 CAGTATTTTTTGTATGAACAAGG - Intergenic
944415569 2:199476066-199476088 TAATAGTAATTGTGGGAAGATGG - Intergenic
946857776 2:223969972-223969994 AAGTATGATATGTGGGTAGAAGG + Intergenic
947020077 2:225665058-225665080 CTATATTATTTGTGGAGAGAAGG - Intergenic
1168894087 20:1312072-1312094 TAGTTTTTTTTGTGGAAAGAGGG + Intronic
1170238095 20:14130692-14130714 CAGTATTTTTTGGGAAAAGAAGG + Intronic
1170269151 20:14504479-14504501 TAGTATTACTTATGGGAATAAGG + Intronic
1171105916 20:22432269-22432291 CAGTGTAATTTATGGAAAGATGG + Intergenic
1172039408 20:32033251-32033273 CAGTGTTGTTTGTGGTAAGAGGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173336495 20:42116321-42116343 CAGGATGATTAGTGAGAAGAGGG - Intronic
1174103041 20:48141729-48141751 AAGGATAGTTTGTGGGAAGAGGG - Intergenic
1174250443 20:49215571-49215593 CAATAATATTTGTGGGATTAAGG + Intergenic
1174788190 20:53452734-53452756 CAATATTATGTGTGTGAAGGAGG + Intronic
1175290450 20:57871711-57871733 CTGGAATATTTGTGGGAAAAAGG - Intergenic
1177093288 21:16798052-16798074 GACTATTATTTGGAGGAAGAAGG - Intergenic
1177194463 21:17888138-17888160 CATTCTTATTTGTGGAAAGAGGG + Intergenic
1178527435 21:33343192-33343214 CAGAATTATTTGTTGAATGAAGG + Intronic
1180459133 22:15543090-15543112 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1182658756 22:31910313-31910335 CAGAATGATTTGGTGGAAGAAGG + Intergenic
1183189639 22:36313613-36313635 CAGCATTAGCTGTGTGAAGATGG - Intronic
950267681 3:11587113-11587135 CAGTATTATTACTCAGAAGATGG - Intronic
953516892 3:43602183-43602205 GAGAAATATTTGTGGAAAGAAGG - Intronic
954733031 3:52681395-52681417 CAGTATTATTAGTTTGAAGTTGG + Intronic
955017586 3:55087340-55087362 CAGTAGGTTTTGTGGGAAGATGG - Intergenic
956121033 3:65966115-65966137 CAAAATATTTTGTGGGAAGAAGG - Intronic
956700518 3:71955006-71955028 CAATATAATTTGTAGGAAGTAGG - Intergenic
959658160 3:108833918-108833940 AATAATTATTTGTGGAAAGAAGG - Intronic
960203393 3:114865737-114865759 CAGTATAATTTGAAGGAAAAAGG + Intronic
961020592 3:123503089-123503111 CTGTATTTTTTGTGGAAACAGGG - Intronic
961944516 3:130672237-130672259 CAGTAAAGTTTGTGGAAAGATGG - Intronic
962168370 3:133075166-133075188 CAGTATTGTTTGTGGGGAAGGGG - Intronic
964515628 3:157504722-157504744 CAGTTTTCTTGGTGGCAAGAGGG - Intronic
968221207 3:196941752-196941774 CAGTATATTTTGTGGAAAAAGGG - Intronic
970686970 4:18579436-18579458 CTCTGTTATTTGTGGAAAGATGG - Intergenic
971843030 4:31879051-31879073 CAGTAATACTTGCTGGAAGAAGG - Intergenic
973949698 4:55999082-55999104 CTATATTATTTTTAGGAAGATGG + Intronic
976027013 4:80700406-80700428 CAGTATTATCAGTGGGATGGTGG + Intronic
976151893 4:82100710-82100732 CAGGATGATTGGTGGGAATAAGG - Intergenic
976983448 4:91261577-91261599 TAGCATTATTTGTGGAAGGAGGG - Intronic
979926551 4:126573596-126573618 CAATATTTTTTGTGTGCAGAGGG + Intergenic
980517706 4:133886155-133886177 CACTTTTAGTTGTTGGAAGATGG - Intergenic
980769102 4:137348840-137348862 CAGTTTCATTTGTGATAAGAAGG - Intergenic
982021719 4:151211372-151211394 CAGTATTGTTTTAGGGAATAAGG - Intronic
982782729 4:159507889-159507911 CAGTATTAAATGTGGTAACATGG + Intergenic
983041594 4:162934631-162934653 TACTATTATTTGTCCGAAGATGG - Intergenic
984153334 4:176162150-176162172 CAATATTATCTATGGCAAGATGG - Exonic
984221141 4:176977964-176977986 CAGTGATATGTGTGGCAAGATGG - Intergenic
985784214 5:1885743-1885765 CAGTATTATCTATGGGAGAAGGG - Intronic
985900192 5:2782777-2782799 CAGCAGTATTTCTGGGATGAGGG - Intergenic
987365472 5:17144665-17144687 CTGTCTTATTTCTGAGAAGAAGG + Intronic
989609795 5:43280033-43280055 CAGTAATACTTGTGTGAAGGTGG + Exonic
989612824 5:43312009-43312031 CAGTTATTTTTGTGTGAAGAAGG - Intronic
990842041 5:60092777-60092799 CAGATTTATTTGTGTGAACAAGG + Intronic
990956375 5:61344236-61344258 AAGTGGTATTTGGGGGAAGAAGG - Intronic
992319508 5:75598522-75598544 CAGTATTATCTGTGTTAAAATGG + Exonic
996897280 5:128500378-128500400 CTATATCATTTGAGGGAAGAGGG - Intronic
998202487 5:140136256-140136278 CATTATTATTTTTGGAAAAAAGG + Intergenic
998547663 5:143044636-143044658 CAGGATTATTGATAGGAAGATGG + Intronic
998676567 5:144415282-144415304 CAGTGTTATATGTTGGGAGATGG - Intronic
998821714 5:146063380-146063402 TAGGATTATATGTGGGAAAATGG - Intronic
1000378412 5:160606042-160606064 CAGTTTCATTTGTTGGAACATGG + Intronic
1000435274 5:161200251-161200273 AAGCATGATTTGAGGGAAGAAGG - Intergenic
1001338806 5:170824954-170824976 TTGGATTATTTGTGGGGAGAAGG - Intergenic
1001667788 5:173447581-173447603 CAGGGTTATTTGAGGCAAGAAGG + Intergenic
1001779982 5:174359999-174360021 CAGTACGATTTGAGGGCAGAGGG + Intergenic
1003292688 6:4793532-4793554 GAGTTTTATTTGTAGTAAGATGG + Intronic
1004479711 6:16006981-16007003 CAGGAATATGTGTGGGGAGAGGG - Intergenic
1008739244 6:54585204-54585226 GAGCATCATTAGTGGGAAGATGG - Intergenic
1011818785 6:91225391-91225413 GAGCAAAATTTGTGGGAAGAAGG - Intergenic
1011829433 6:91353425-91353447 GGGTATTATTGGAGGGAAGAGGG - Intergenic
1015026113 6:128534742-128534764 CTGTATTGTTGGTGGGAAGTGGG - Intergenic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1018139656 6:160817591-160817613 CAGACTTATTTTTGAGAAGATGG - Intergenic
1018447254 6:163869239-163869261 CTGTATTTTTTGTGGAAACAGGG + Intergenic
1021526020 7:21588912-21588934 CAGTGTTATTTATTGGAAAAAGG - Intronic
1023039696 7:36161309-36161331 CAGGATGATGTGTGGGATGAGGG + Intronic
1024621826 7:51165903-51165925 CATTATTATTTGTTCCAAGAAGG - Intronic
1025839273 7:65129384-65129406 CAGTATCATTTCTGTGAAGGTGG - Intergenic
1025883795 7:65566581-65566603 CAGTATCATTTCTGTGAAGGTGG + Intergenic
1025889650 7:65636025-65636047 CAGTATCATTTCTGTGAAGGTGG - Intergenic
1026384813 7:69835879-69835901 CAGTCTGATTATTGGGAAGAGGG + Intronic
1028269212 7:88767321-88767343 GAGTAATAGCTGTGGGAAGAAGG - Intronic
1028416465 7:90585842-90585864 AATTATTATTTGTGGAAACAAGG + Intronic
1030199733 7:106890585-106890607 CAGTATTATCTTTGGAAAGCAGG - Intronic
1030352696 7:108507479-108507501 TTGTATTTTTTGTGGAAAGAGGG - Intronic
1031197636 7:118637351-118637373 AACTATTATTTTTGGGGAGAAGG - Intergenic
1031885677 7:127243505-127243527 CAGAATTATTCCTGGGAAGAGGG + Exonic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1035372442 7:158388067-158388089 AAGTATTTTCTGTGGGGAGAAGG - Intronic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1036837478 8:12086723-12086745 CAGTATTATTTATTGATAGAAGG + Intergenic
1036837555 8:12088239-12088261 CAGTATTATTTATTGATAGAAGG - Intergenic
1036859270 8:12332971-12332993 CAGTATTATTTATTGATAGAAGG + Intergenic
1036859349 8:12334487-12334509 CAGTATTATTTATTGATAGAAGG - Intergenic
1037816111 8:22112956-22112978 GAGTATTTCCTGTGGGAAGATGG - Intergenic
1039136204 8:34325746-34325768 CACTATTATTTCAGAGAAGAAGG - Intergenic
1040939156 8:52815251-52815273 CAGTATTCTTTGATGGAGGAGGG - Intergenic
1041360950 8:57053528-57053550 CCTTATTTTTAGTGGGAAGATGG + Intergenic
1041529001 8:58841084-58841106 CATTACTATTTGTGGGTGGATGG + Intronic
1043353056 8:79384208-79384230 GCTTATTATTTGGGGGAAGATGG - Intergenic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1045770011 8:105725859-105725881 TAGCTTAATTTGTGGGAAGAGGG + Intronic
1046430539 8:114120812-114120834 TAGTACTATTTGGGGGTAGAGGG + Intergenic
1047427929 8:124763587-124763609 CAATTTTATTTTTGGGCAGAGGG - Intergenic
1048487487 8:134862194-134862216 CAGACTTATTAATGGGAAGATGG + Intergenic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1049937761 9:516059-516081 CAATAATATTTAAGGGAAGATGG - Intronic
1051351524 9:16202267-16202289 CAGTATTCTCTGTGGGATGGGGG - Intergenic
1051522493 9:18004771-18004793 TAGTATTATTTATTAGAAGAAGG + Intergenic
1052130172 9:24834994-24835016 CAAGATTATTTGTGGAAAGGTGG + Intergenic
1052252134 9:26410913-26410935 GAGAATAAATTGTGGGAAGATGG - Intergenic
1052856492 9:33410140-33410162 TATTATTATTTGCTGGAAGAAGG - Intergenic
1055270792 9:74556197-74556219 TGGAACTATTTGTGGGAAGACGG + Intronic
1055524740 9:77120367-77120389 CAGAAGTATCTGGGGGAAGACGG - Intergenic
1056018555 9:82418006-82418028 CAGGATTTTTTGTGGGAAATGGG + Intergenic
1056469314 9:86889993-86890015 CAGTATAAATTGTGGGGAGGTGG - Intergenic
1056544512 9:87602493-87602515 CCATTTTATTTATGGGAAGATGG - Intronic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1058074741 9:100638886-100638908 CAGTTTTACATCTGGGAAGACGG - Intergenic
1058433786 9:104943078-104943100 CAGAATTATCTCTGGGAAGTGGG - Intergenic
1058955122 9:109939357-109939379 CATTCTCATTGGTGGGAAGAGGG + Intronic
1059210191 9:112507083-112507105 TAGAAGTATTTGTGGGTAGAGGG + Intronic
1059957649 9:119534978-119535000 TAGTGTTCTTGGTGGGAAGAAGG + Intergenic
1060716635 9:125936611-125936633 CATTGTTATTTGAGGGAATAGGG + Intronic
1187160997 X:16765032-16765054 CAGTTTTATTGTGGGGAAGATGG + Exonic
1188132826 X:26458582-26458604 AAGTATGATTTATGAGAAGAAGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1190461075 X:50676068-50676090 CAGTATCATTTGTAGCAGGAAGG - Intronic
1192313996 X:70038017-70038039 CACTAGTAGTTGTGGGAAGCAGG - Exonic
1192431833 X:71118008-71118030 TATTATTATTTCTGGGAAGAAGG + Intergenic
1192845710 X:74905275-74905297 ATATATTATTTATGGGAAGAGGG + Intronic
1194974878 X:100384539-100384561 CACTATTATTTCTGTGAAAAAGG - Intronic
1196118708 X:112025153-112025175 CAGAATTATGTGTTGGAAGTGGG + Intronic
1196538213 X:116872854-116872876 TAGTGTTTTTTATGGGAAGAAGG + Intergenic
1196610601 X:117710367-117710389 GATTATTATTTGTTGAAAGAAGG - Intergenic
1197057415 X:122137183-122137205 CAATATTATTTCTCTGAAGAAGG - Intergenic
1197674919 X:129318944-129318966 CAGTTTTCTTTGAGGGAATATGG - Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1200684691 Y:6247743-6247765 CAGGAGTTTTTGTGGGAAGGGGG - Intronic
1200843275 Y:7805451-7805473 CAGTATTACTTGTGGGCAGAGGG + Intergenic
1200990221 Y:9339008-9339030 CAGGAGTTTTTGTGGGAAGGGGG - Intronic
1200992883 Y:9359323-9359345 CAGGAGTTTTTGTGGGAAGGGGG - Intronic
1200995536 Y:9379601-9379623 CAGGAGTTTTTGTGGGAAGGGGG - Intronic
1200998202 Y:9399947-9399969 CAGGAGTTTTTGTGGGAAGGGGG - Intronic
1201000711 Y:9468481-9468503 CAGGAGTTTTTGTGGGAAGGGGG - Intronic
1201003377 Y:9488811-9488833 CAGGAGTTTTTGTGGGAAGGGGG - Intronic
1201006033 Y:9509093-9509115 CAGGAGTTTTTGTGGGAAGGGGG - Intergenic
1201008691 Y:9529406-9529428 CAGGAGTTTTTGTGGGAAGGGGG - Intronic