ID: 1091515366

View in Genome Browser
Species Human (GRCh38)
Location 12:1174898-1174920
Sequence CTGTATATACAGGTATACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091515364_1091515366 -8 Left 1091515364 12:1174883-1174905 CCAAGGCATTGTGTTCTGTATAT 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1091515366 12:1174898-1174920 CTGTATATACAGGTATACCTCGG 0: 1
1: 0
2: 0
3: 25
4: 200
1091515362_1091515366 20 Left 1091515362 12:1174855-1174877 CCTGCACAGCTGGTTAAACATGT 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1091515366 12:1174898-1174920 CTGTATATACAGGTATACCTCGG 0: 1
1: 0
2: 0
3: 25
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091515366 Original CRISPR CTGTATATACAGGTATACCT CGG Intronic
906489890 1:46260137-46260159 CTGTATATGCACGCATACTTGGG + Intronic
906953844 1:50356560-50356582 ATATATATACAGACATACCTGGG - Intergenic
907858914 1:58331873-58331895 GAGTAGATACAGGAATACCTTGG - Intronic
909018595 1:70406292-70406314 CACTACATACAGGCATACCTTGG - Intergenic
909971736 1:81998946-81998968 GTGTATATATAGGTATATATAGG - Intergenic
912873815 1:113335044-113335066 ATGTAAGTACAGGCATACCTCGG + Intergenic
914933606 1:151958172-151958194 TTGTTTATAAAAGTATACCTTGG - Intergenic
915182566 1:154075307-154075329 GTGTATATATATGTATACGTGGG - Intronic
915909277 1:159902368-159902390 ATGTGTCTACAGGCATACCTTGG + Intergenic
916820012 1:168388978-168389000 TTGTATATATATGTACACCTGGG + Intergenic
916831766 1:168499764-168499786 GTATATAAACAGGCATACCTTGG + Intergenic
916947850 1:169746978-169747000 AACTATATACAGGCATACCTTGG + Intronic
917193058 1:172439127-172439149 GTCTATATACAGGCATACTTTGG - Intronic
917957426 1:180114789-180114811 CTATTTACACAGGTATACATGGG - Exonic
919535233 1:198779293-198779315 GTGTTTTTACAGGCATACCTCGG - Intergenic
920799862 1:209176448-209176470 TTATATATACAGGCATACCTTGG - Intergenic
921609569 1:217195324-217195346 CTATAATTACAGGCATACCTTGG + Intergenic
922333512 1:224598922-224598944 ATGTTTATACAGGTACACCTAGG - Intronic
922588893 1:226757885-226757907 GTGTATGTACAGGCATATCTTGG - Intergenic
923073471 1:230588160-230588182 CTGTATACAATGGTATACCCTGG + Intergenic
1063210735 10:3878827-3878849 CTGCAGATTTAGGTATACCTGGG + Intergenic
1064287628 10:14005803-14005825 CTGTATAAACAGGGAAACCAAGG - Intronic
1067999370 10:51313641-51313663 CTATATATACAGTTGTCCCTTGG + Intronic
1068104187 10:52592776-52592798 CTGGATATACAGGCATATCTTGG - Intergenic
1069200041 10:65602420-65602442 CTGAGTATACAGGCATACCTTGG - Intergenic
1069334977 10:67337996-67338018 TTATATATAGAGGCATACCTTGG - Intronic
1072643025 10:97227895-97227917 CTGTATTGACAGCTCTACCTTGG - Intronic
1076503867 10:130958889-130958911 ATGTATATACAGTCATCCCTAGG - Intergenic
1077952666 11:6977613-6977635 CTGTATTTGCATGCATACCTAGG - Intronic
1086345610 11:85892855-85892877 CTGTATAAACAGGAATATGTAGG + Intronic
1086762900 11:90655682-90655704 ATGTATATACTAGTATACATGGG + Intergenic
1087992269 11:104758931-104758953 CGGTATTTACAGGTACAACTGGG - Intergenic
1091515366 12:1174898-1174920 CTGTATATACAGGTATACCTCGG + Intronic
1092037990 12:5357375-5357397 GTGTTTATACAGGCATACCTTGG + Intergenic
1093635016 12:21456337-21456359 ATATATATACAGTCATACCTTGG + Intronic
1093823067 12:23645827-23645849 ATATATACACAGGAATACCTTGG + Intronic
1095228970 12:39713942-39713964 CTGTATATACACGTATATATAGG - Intronic
1095314047 12:40737303-40737325 GTGTATATACACATATACATGGG + Intronic
1095657963 12:44693447-44693469 ATCCATATACAGGCATACCTTGG - Intronic
1098075021 12:66720086-66720108 AGGTAGATACAGGCATACCTTGG + Intronic
1098387198 12:69931972-69931994 CTGTATATACAGATATCTCTGGG - Intronic
1101091772 12:101294332-101294354 CTGAATATACTGCTTTACCTTGG + Intronic
1102585754 12:113921898-113921920 CTCTATAGACAGCTCTACCTGGG + Intronic
1102796417 12:115692645-115692667 ATGTATATACAGCTATACATTGG - Intergenic
1105324812 13:19360754-19360776 TTCTATATACAGGCATACCTTGG + Intergenic
1108228237 13:48312546-48312568 CTTTCTTTACAGGTTTACCTTGG + Intronic
1109459208 13:62632569-62632591 TCCTATATACAGGCATACCTTGG + Intergenic
1110737459 13:78953783-78953805 CAGTATATACAAGCATACCTCGG + Intergenic
1111158821 13:84365979-84366001 AAATATATACAGGTATTCCTCGG - Intergenic
1111333271 13:86789413-86789435 CTGTTTATGCAGGTATATTTGGG - Intergenic
1112728958 13:102338026-102338048 TTGAATGTACAGGCATACCTTGG - Intronic
1113060061 13:106313440-106313462 CTGCATACACATATATACCTAGG - Intergenic
1115799639 14:36978212-36978234 ATCTATATACAGGCATACCTTGG + Intronic
1116392194 14:44406159-44406181 CAATATATAGAGATATACCTGGG + Intergenic
1117526184 14:56607676-56607698 CTGTATGTACATATATACATAGG + Intronic
1118553018 14:66977906-66977928 CTATATTTACAGGCATACCTTGG + Intronic
1119308769 14:73629391-73629413 TTGTTAATACAGGGATACCTGGG - Intergenic
1119394123 14:74313295-74313317 TTTTATATACAGGGAAACCTAGG - Intronic
1120044047 14:79786520-79786542 CTGTATACCCAGGAATACATTGG - Intronic
1121032704 14:90672800-90672822 CTGTATATACAGGAGTTACTAGG - Intronic
1122078579 14:99251596-99251618 CTGTAAATTCAGGTGCACCTGGG - Intronic
1123402879 15:20004230-20004252 CTGTCTCTACAGCTGTACCTGGG + Intergenic
1123512218 15:21010884-21010906 CTGTCTCTACAGCTGTACCTGGG + Intergenic
1126219085 15:46191543-46191565 AGTTATATACAGGCATACCTTGG + Intergenic
1126653563 15:50952064-50952086 CTGCATCTATAGGTATATCTAGG + Intronic
1127585887 15:60377444-60377466 TTCCATATACAGGCATACCTCGG + Intronic
1128281910 15:66402404-66402426 TTGTATTTTCAGGTTTACCTTGG + Intronic
1130237947 15:82155575-82155597 GTGTATATACAGGTACAAATGGG + Intronic
1134767912 16:16777869-16777891 CTGGATCTACAGATATACCAAGG - Intergenic
1135288875 16:21217558-21217580 CTGTATATACAGTTTTTCATAGG - Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1141304665 16:82851034-82851056 CTGCATGTACAGGCATCCCTCGG - Intronic
1145186357 17:20798030-20798052 CTGGAAATCCAGGTATACATTGG + Intergenic
1145347689 17:22051401-22051423 CTGCACATACAGGTATATATGGG + Intergenic
1146835929 17:36110647-36110669 CTGCCTAAACAGGTCTACCTTGG + Intergenic
1148696753 17:49564913-49564935 AAGAATATACAGGCATACCTTGG - Intergenic
1149933082 17:60775543-60775565 ATGTATATATAGGTTTACCTTGG + Intronic
1154317244 18:13314428-13314450 CTGCATGTACAGGCACACCTTGG + Intronic
1156130873 18:33972610-33972632 GGGTATATACAGGCATACATTGG + Intronic
1156563941 18:38162538-38162560 ATGTATATATAGGTATATATAGG - Intergenic
1165993257 19:39827639-39827661 CTGGATATACTGGTAGATCTGGG + Exonic
1166412201 19:42563047-42563069 CTTTATATCCAGATAGACCTGGG + Intergenic
930235162 2:48882325-48882347 CTGCATATACAGGTACAACCTGG - Intergenic
930583285 2:53238727-53238749 CTACATTTACAGGCATACCTTGG - Intergenic
931726754 2:65118835-65118857 TTGTATATACATATATACATAGG - Intronic
933418214 2:82014464-82014486 ATGTAGATACATATATACCTAGG + Intergenic
935521470 2:104110658-104110680 GTGTGTATACAGGCACACCTGGG - Intergenic
935837604 2:107072519-107072541 CTTTAGATATAGGTACACCTGGG + Intergenic
935974483 2:108564440-108564462 ATCTCTATACAGGCATACCTCGG - Intronic
937482261 2:122274644-122274666 GTGTATATATAGGTATATATAGG - Intergenic
937482324 2:122275625-122275647 GTGTATATATAGGTATATATAGG - Intergenic
937482327 2:122275681-122275703 GTGTATATATAGGTATATATGGG - Intergenic
937482331 2:122275725-122275747 ATGTATATATAGGTATATATAGG - Intergenic
937796919 2:126034651-126034673 ATTCATATACAGGCATACCTTGG - Intergenic
938424305 2:131171807-131171829 CCTTAAATACAGGCATACCTTGG - Intronic
938678394 2:133662762-133662784 CTGTAGGTACAGGCATACCATGG + Intergenic
940727797 2:157354868-157354890 ATATATATACAAGCATACCTTGG - Intergenic
942893847 2:181025483-181025505 TTGTGTATACAGGTATATTTGGG + Intronic
943642154 2:190371414-190371436 CAGTTTATACAGGTACACCGGGG - Exonic
943812386 2:192204116-192204138 CTGTGTGTACAGGCATACCTTGG - Intergenic
945345919 2:208716374-208716396 ATGTATGTACAGGCATAACTTGG + Intronic
945443010 2:209902884-209902906 ACGTGTATACAGGCATACCTTGG - Intronic
1169789710 20:9396648-9396670 ATTTATATACAGGCATACCTTGG + Intronic
1170564185 20:17586317-17586339 TAGTATATACAGGCATACCTTGG - Intronic
1174716487 20:52764670-52764692 ATGTACATACATGTATAACTTGG - Intergenic
1176726022 21:10433252-10433274 AAGTAAATACAGGCATACCTTGG + Intergenic
1179433341 21:41340939-41340961 CTGTATATAAAAATATACATAGG - Intronic
1180288350 22:10773861-10773883 AAGTAAATACAGGCATACCTTGG - Intergenic
1181077085 22:20387051-20387073 ATGAATATACAGGTATGCCCAGG + Intronic
1182403381 22:30101728-30101750 CTGTATTTAATGATATACCTTGG + Intronic
1182813396 22:33137078-33137100 CTGTATATTGTGGTAAACCTGGG - Intergenic
1182838931 22:33368672-33368694 ATATATATACAGGCATAACTTGG + Intronic
950957809 3:17073174-17073196 GTGTATGTACAGGCGTACCTTGG + Intronic
951009235 3:17657179-17657201 CTGTATATAGAGATATACGCAGG - Intronic
951083276 3:18478113-18478135 GTGTATATATAGGTATATATAGG - Intergenic
951083278 3:18478135-18478157 GTGTATATATAGGTATATATAGG - Intergenic
951083285 3:18478223-18478245 GTGTATATATAGGTATATATAGG - Intergenic
951302910 3:21020411-21020433 CTGTTTATAATTGTATACCTAGG - Intergenic
951517763 3:23580615-23580637 CTGCAAATACAGGCATACCTTGG - Intronic
951727721 3:25778770-25778792 GTGACTATAAAGGTATACCTAGG - Intronic
951862538 3:27269724-27269746 TAGCATATACAGGTATACCTTGG - Intronic
953591808 3:44264257-44264279 TAATATATACAGGTATACCTTGG + Intronic
957452595 3:80399338-80399360 CTGTATATACTTGCATAGCTTGG - Intergenic
959280986 3:104339833-104339855 ATCTATATTCAGGCATACCTTGG + Intergenic
959401349 3:105905873-105905895 CTATATATGCAGGTATATATAGG - Intergenic
959961204 3:112301110-112301132 CTTTATATACAGTCATTCCTTGG + Intergenic
960322384 3:116252138-116252160 CTGTGTATACAGGGACCCCTTGG - Intronic
960687668 3:120310615-120310637 CTGTAGATTCAGGTATTTCTTGG + Intergenic
961662893 3:128479783-128479805 GTTTATATACAGCTGTACCTTGG + Exonic
962366766 3:134791962-134791984 CTGCTAATACAGATATACCTGGG + Intronic
962976901 3:140453686-140453708 ATTTAGATACATGTATACCTTGG - Intronic
963095537 3:141535340-141535362 ATGTTTTTACAGGCATACCTTGG - Intronic
963256953 3:143154489-143154511 CTGAAGATACAAGTATATCTGGG - Intergenic
970390226 4:15602007-15602029 TTGCATGTACAGGCATACCTCGG + Intergenic
970606206 4:17684396-17684418 TGGTATATAAAGGTATACATTGG - Intronic
970847506 4:20558612-20558634 ATGTATGTACAGGCAGACCTTGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
973224969 4:47773793-47773815 TAGTATATAAATGTATACCTAGG + Intronic
973901352 4:55475880-55475902 CTTAATATCCAGGTGTACCTTGG - Intronic
974898011 4:67962703-67962725 CTGTATATAAAGTTATGCCAAGG + Intronic
975016219 4:69424294-69424316 CTATATATACATATATACCATGG - Intergenic
977483687 4:97614054-97614076 GTGTATATACTTGTATACCAGGG + Intronic
977596914 4:98892961-98892983 TTATATATAGAGGCATACCTTGG + Intronic
977790401 4:101093565-101093587 ATACATATACAGGTGTACCTTGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979874809 4:125874688-125874710 CTGTATAGTCATGTGTACCTTGG - Intergenic
980458988 4:133080686-133080708 CTGAATAAACAGTTAAACCTAGG - Intergenic
981043139 4:140241614-140241636 AGGTATATAAAAGTATACCTTGG - Intergenic
984876545 4:184372986-184373008 GTGTATATATAGGTATATATAGG + Intergenic
984972197 4:185201771-185201793 CGGTAAATACAGGCATACCTTGG - Intronic
987384684 5:17318175-17318197 GTGCATATACAGGTATTCATTGG - Intergenic
990141955 5:52715348-52715370 ATGGATAAACTGGTATACCTAGG - Intergenic
991367133 5:65880411-65880433 CTGTTGGTACAGGCATACCTTGG - Intergenic
992768260 5:80023268-80023290 GTGTATATGCAGGTACAGCTAGG - Intronic
994152428 5:96463119-96463141 CTGTATACACATGTCTACCTGGG - Intergenic
996104351 5:119481448-119481470 CTTTAAATACAGGCATATCTTGG + Intronic
996643237 5:125783679-125783701 GTTTACATACAGATATACCTTGG - Intergenic
997121041 5:131173278-131173300 TTTTAGATACAGGCATACCTAGG + Intronic
997694919 5:135852947-135852969 CCGTAATTACAGGCATACCTCGG + Intronic
1000362572 5:160461595-160461617 TTGTAAATACAGGTAAAACTTGG + Intergenic
1010898600 6:81398087-81398109 CTGTAAATACAGGCAAATCTTGG - Intergenic
1012488751 6:99753388-99753410 CTGTATTTACAAATATACTTTGG + Intergenic
1012964916 6:105663231-105663253 CTGGATTTACAGGCATACTTTGG + Intergenic
1014092733 6:117422884-117422906 CTGAATATACATAGATACCTAGG + Intronic
1016036832 6:139391912-139391934 CTGTCAATACAGGTATGGCTGGG + Intergenic
1016195085 6:141326122-141326144 TTGTATGTATATGTATACCTTGG - Intergenic
1016296935 6:142583076-142583098 CTGTATACATATGTATACATGGG - Intergenic
1017069019 6:150556381-150556403 CAGAATACACAGGCATACCTTGG - Intergenic
1017546262 6:155453890-155453912 ATGATTATACAGGCATACCTCGG + Intronic
1019230847 6:170561340-170561362 ATGAAGATACAGGCATACCTCGG - Intronic
1019837514 7:3403908-3403930 TTCCATATACAGGCATACCTTGG + Intronic
1021472084 7:21014959-21014981 AGGAATATACAGGCATACCTTGG + Intergenic
1021819873 7:24486228-24486250 ATGTATATACAGTTGTCCCTAGG - Intergenic
1021874036 7:25031910-25031932 CTGTAGATATAGGAATACATAGG - Intergenic
1024764898 7:52646089-52646111 CTGTATCTACACCAATACCTAGG - Intergenic
1027591294 7:80122271-80122293 TTTTATATACAGTTGTACCTTGG + Intergenic
1028973356 7:96884167-96884189 ATGTATATACAGTCATCCCTTGG - Intergenic
1031498926 7:122487414-122487436 GTCTTTATACAGGCATACCTAGG - Intronic
1031878719 7:127171795-127171817 TAATATATACAGGCATACCTTGG - Intronic
1033119658 7:138656376-138656398 ATGTACATATAGGCATACCTTGG - Intronic
1033508447 7:142029874-142029896 CTGTTTATACAGGTAAAATTGGG + Intronic
1034611899 7:152378634-152378656 AAGTAAATACAGGCATACCTTGG - Intronic
1036547778 8:9788855-9788877 GTGTATATATAAGTATACATGGG - Intergenic
1037447556 8:18981558-18981580 CTGTATATACAGGCATACTCTGG + Intronic
1038146134 8:24897926-24897948 CTGTATATCCAGATCTACCCAGG + Intergenic
1039556593 8:38480561-38480583 TTTTCTATACAGGCATACCTTGG - Intergenic
1039702155 8:39973060-39973082 CAGTATGTACAGGCATACCCTGG - Intronic
1041450601 8:58002563-58002585 CAGTATCTACTGGCATACCTTGG + Intronic
1043580041 8:81701532-81701554 GTATACATACAGGTATACCTTGG - Intronic
1043753173 8:83967323-83967345 CTATATATACAATTTTACCTAGG - Intergenic
1045728441 8:105203806-105203828 GCATATATACAGGCATACCTTGG + Intronic
1046168480 8:110472062-110472084 TTAAAAATACAGGTATACCTTGG + Intergenic
1047783805 8:128134189-128134211 CTGTCAACACAGGTATCCCTTGG + Intergenic
1050217867 9:3348235-3348257 CTGTATAAACTGGTATATGTTGG + Intronic
1050254747 9:3782410-3782432 TTGTATATACAGGTAGTCCTAGG + Intergenic
1050647245 9:7733337-7733359 CTATATATACAGTTGTCCCTCGG + Intergenic
1050776100 9:9262538-9262560 CTGTATAAAAAGGCATATCTTGG - Intronic
1050913629 9:11104737-11104759 CTGTGGATACATGTATCCCTGGG - Intergenic
1051019499 9:12525144-12525166 GTATAAATACAGGCATACCTCGG - Intergenic
1051853148 9:21532398-21532420 CTGTAAATACAGTTATACTTGGG - Intergenic
1055311026 9:74979669-74979691 CTTCTTATACAGGCATACCTTGG + Intergenic
1055785262 9:79864018-79864040 CTGTCTATTGAGGGATACCTGGG + Intergenic
1058285686 9:103175270-103175292 GTATATATACAGGTATATGTTGG + Intergenic
1058338663 9:103865425-103865447 CTGAATAGACAGGTACATCTAGG - Intergenic
1058404187 9:104653256-104653278 GTATATATACAGGGATCCCTTGG + Intergenic
1058799689 9:108533272-108533294 ATATATATACAGGTATGTCTAGG + Intergenic
1059420602 9:114188607-114188629 ATGTATATACAAATATATCTTGG - Intronic
1059490747 9:114665585-114665607 CTGTTAATAAAGATATACCTTGG + Intergenic
1060264124 9:122100438-122100460 CTGTATCTACAGGTATGTCAAGG + Intergenic
1186823360 X:13313816-13313838 CTGTTTCTCCAGGTATCCCTCGG + Intergenic
1188000213 X:24973574-24973596 CTGTATACTCAGGTAACCCTGGG - Intronic
1188168340 X:26890915-26890937 CTATACATAGAGGCATACCTTGG + Intergenic
1188278715 X:28236195-28236217 ATCTTTATACAGGCATACCTTGG + Intergenic
1188417656 X:29955785-29955807 CTGGATATACTGGTCTCCCTTGG - Exonic
1188705254 X:33320336-33320358 GAATATGTACAGGTATACCTTGG + Intronic
1190141680 X:47851978-47852000 TAGCATATACAGGCATACCTTGG + Intronic
1190445119 X:50516110-50516132 CTGTAGAGCCAGGTCTACCTGGG + Intergenic
1190878897 X:54478829-54478851 GTGTATATACAGTTTTACGTTGG - Intronic
1193686042 X:84578512-84578534 GTGTGTATACATGCATACCTTGG - Intergenic
1195109122 X:101628061-101628083 CAGTACATACAGGGAAACCTGGG - Intergenic
1196113205 X:111969389-111969411 ATGTTTATACAAGCATACCTCGG - Intronic
1196129235 X:112135900-112135922 ATATATATATATGTATACCTTGG + Intergenic
1196979525 X:121196127-121196149 TTGTGTATACATATATACCTAGG + Intergenic
1197273782 X:124454381-124454403 CTCTATATCTAGGTATATCTAGG + Intronic
1198634392 X:138679446-138679468 TAGAATATACAGGCATACCTTGG + Intronic
1200139778 X:153894094-153894116 CTGTGTAGACTGGTATCCCTAGG + Intronic