ID: 1091519043

View in Genome Browser
Species Human (GRCh38)
Location 12:1217538-1217560
Sequence TCTGTTCCACATTTAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091519043_1091519046 6 Left 1091519043 12:1217538-1217560 CCTGCCTCTAAATGTGGAACAGA 0: 1
1: 0
2: 2
3: 8
4: 146
Right 1091519046 12:1217567-1217589 CCCGTCAGAATTCTCCACCTTGG 0: 1
1: 0
2: 1
3: 2
4: 89
1091519043_1091519048 11 Left 1091519043 12:1217538-1217560 CCTGCCTCTAAATGTGGAACAGA 0: 1
1: 0
2: 2
3: 8
4: 146
Right 1091519048 12:1217572-1217594 CAGAATTCTCCACCTTGGAATGG 0: 1
1: 0
2: 3
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091519043 Original CRISPR TCTGTTCCACATTTAGAGGC AGG (reversed) Intronic
900754981 1:4427687-4427709 TCTGGGCCAAATTCAGAGGCAGG + Intergenic
904374508 1:30071724-30071746 TCTGTACCCCACTTGGAGGCAGG - Intergenic
905304570 1:37008583-37008605 GCTGTTCCACATGAAGAGACGGG + Intronic
906047250 1:42841206-42841228 TCTGTCTCACATTTACAGTCTGG + Intronic
908020477 1:59893066-59893088 TTTATTCCTCATTTAGAGACAGG - Intergenic
908433018 1:64077548-64077570 TTTGTTCCACCTTTAGCGTCTGG + Intronic
909723485 1:78805294-78805316 TATTTACCATATTTAGAGGCGGG + Intergenic
914252559 1:145933682-145933704 TCTGTTTGACATTTATAAGCTGG - Exonic
914850263 1:151308947-151308969 ACTGTTGCACATGTAGAGGTAGG - Intronic
916349916 1:163837370-163837392 TCTGTTCCATATTCAGAGACAGG + Intergenic
916965644 1:169939661-169939683 TCTTTTCCACATTTAAATGCTGG - Intronic
918052099 1:180982827-180982849 TCTGTCACACATTTAGAGAAAGG - Intronic
918238552 1:182602255-182602277 TCTATTCAACATATAAAGGCAGG - Intronic
918886087 1:190197054-190197076 ACAGTTCCACATTGTGAGGCTGG + Intronic
1062882154 10:987966-987988 TCTGCTCCACACCCAGAGGCTGG + Intergenic
1064113728 10:12560021-12560043 TCTGGTCCGCATTGAGAGGAAGG - Intronic
1066930280 10:41749870-41749892 TAGGCTCCACATTTGGAGGCAGG + Intergenic
1067259360 10:44674569-44674591 TCTTTTCCTCTTTTTGAGGCTGG + Intergenic
1067825800 10:49571970-49571992 GCTGCTCCACCTTTAGATGCAGG + Intergenic
1069949771 10:72010797-72010819 TCTGTTCCCCATGTGGAGGTCGG + Exonic
1073871330 10:107868223-107868245 TCTGTTTTACATTTAGAGCTGGG - Intergenic
1078421545 11:11216731-11216753 TATGCTCCACATACAGAGGCAGG - Intergenic
1080017893 11:27526580-27526602 TCTTTTCCGCATTAAGAGGGTGG + Intergenic
1081400923 11:42641865-42641887 TCTGTTCCACATTTTCTTGCAGG - Intergenic
1083151683 11:60795551-60795573 TCAGGTCCACATCCAGAGGCTGG + Exonic
1083940953 11:65895529-65895551 TCTATTCCACATTGAGTGACAGG + Intronic
1083979069 11:66150337-66150359 TCTGTTCTACATTTAGTAACTGG - Intronic
1086063560 11:82724090-82724112 TCTGTTCCTCAGTAAGAGGTGGG - Intergenic
1086226660 11:84519736-84519758 TCTGTCCCACAGTTACTGGCTGG - Intronic
1091519043 12:1217538-1217560 TCTGTTCCACATTTAGAGGCAGG - Intronic
1097616768 12:61893045-61893067 TCTGTTCCACCTTTAAAGTTAGG - Intronic
1099647554 12:85378778-85378800 TCTGATCCAGATTTAAAGGGAGG - Intergenic
1099869882 12:88333559-88333581 TCTCTTCCACCTTGAGAGCCAGG - Intergenic
1100156286 12:91804248-91804270 TTTGTTGCACATCTAGGGGCTGG - Intergenic
1102214236 12:111148989-111149011 TTTTTTCCACCCTTAGAGGCAGG - Intronic
1105584472 13:21731148-21731170 TCTGTTCAACATACACAGGCCGG + Intergenic
1110310734 13:74045988-74046010 TTTGTTCCTTATTTAGAAGCTGG + Intronic
1120082716 14:80233941-80233963 ACTGTCCCAGACTTAGAGGCAGG + Intronic
1121570705 14:94944629-94944651 TCTGCTCCACATTTGTATGCAGG - Intergenic
1121646143 14:95517960-95517982 TCTTTTCCAAATTGAGAGGGAGG + Intergenic
1122823913 14:104360448-104360470 TCTGTTCCCCATTCACAGGTGGG + Intergenic
1127272712 15:57415649-57415671 TCTGAGCCCCATTTGGAGGCAGG + Intronic
1129073114 15:72968291-72968313 TCTGTTCTACATTTAGAACATGG - Intergenic
1129123029 15:73414460-73414482 TCTGCTCCACATTTCCTGGCTGG + Intergenic
1129678701 15:77646024-77646046 TGTCTGCCTCATTTAGAGGCTGG + Intronic
1132840494 16:1976431-1976453 TCTGTTCCACATCTTTGGGCTGG - Intronic
1137768011 16:50992690-50992712 CCTGTTCCACACTCAGAGCCAGG - Intergenic
1138744410 16:59346980-59347002 TATGTTCCAGTTTTAGAGACAGG + Intergenic
1140272990 16:73483106-73483128 GCTGATCCACATTCAGAGGAGGG - Intergenic
1140316918 16:73907392-73907414 TCTGTGCCACAATTTGAGGAGGG - Intergenic
1140395322 16:74621354-74621376 TCTCTTTCACTTCTAGAGGCAGG - Intergenic
1146579175 17:34021625-34021647 TCTGATCCATGTTTAGAGGAAGG - Intronic
1149324691 17:55517921-55517943 TCTGTTTAACATTTAGATGTTGG - Intergenic
1153986830 18:10358055-10358077 TCTGTTCCACTTTGGGAGACTGG - Intergenic
1154404038 18:14071565-14071587 AGTGTTCCACATTTAGGGGTTGG + Intronic
1155916329 18:31561216-31561238 CCTGATCCACATTGAGAAGCTGG + Intergenic
1156804241 18:41157479-41157501 TTTGTTCCACTTTTAGAGGTAGG - Intergenic
1156913088 18:42434420-42434442 ACTCTCCCACATTTAGAGGTTGG + Intergenic
1157708843 18:49834029-49834051 TCTGTTCCCTACTTAGATGCTGG + Intronic
1158964659 18:62611987-62612009 TCTGTCCCGCAGTCAGAGGCTGG - Intergenic
1160076337 18:75680998-75681020 TGTGTTCCACATTTAGAAGCTGG - Intergenic
1161035622 19:2082815-2082837 TCTCTTCCATTTTTAGAGACAGG + Intronic
927234355 2:20856609-20856631 TCTGTTCCCCATTTGGGGGAAGG + Intergenic
929694760 2:44104775-44104797 TCTCTTCCTCATTTACAGGGAGG + Intergenic
929715797 2:44308130-44308152 TTTGTTTTACATTTAGAGACGGG - Intronic
930555251 2:52887008-52887030 TCCGTTCCTCATGCAGAGGCTGG - Intergenic
932922157 2:75929035-75929057 TCTGTTCCAAAATTAGATGAGGG + Intergenic
934659558 2:96136016-96136038 TTTGTTCCACCATCAGAGGCAGG + Intronic
934681830 2:96289425-96289447 TATGGTCCACAGTTAGAGGTTGG - Intronic
935925236 2:108061140-108061162 TCTGGTCCAAATTTAGAAACTGG + Intergenic
937649305 2:124302308-124302330 TCTGTTTCACATTTATGTGCCGG + Intronic
938033373 2:128014981-128015003 CCTGACCCACATTTGGAGGCAGG - Intronic
939476900 2:142698278-142698300 TCTTTTCGACATTTAGATGCAGG - Intergenic
942521952 2:176813847-176813869 TTGTTTCCACATTTAGGGGCTGG - Intergenic
943669019 2:190641046-190641068 TCTGTCCCACGTCAAGAGGCTGG + Intergenic
944013629 2:195005263-195005285 TCTGTTCCAAATTTAGCAGGTGG - Intergenic
945604152 2:211907032-211907054 TATGTTAGACATTTAGTGGCTGG - Intronic
946176053 2:217922547-217922569 TCTGCTCTCCATTTAGAAGCTGG + Intronic
946342523 2:219080086-219080108 TAGGTTCCACATTTAGACCCAGG - Intronic
946482141 2:220067506-220067528 TCTGTTCCACATGGAGATTCAGG + Intergenic
948506783 2:238433803-238433825 TGTGTTCCAGTTTTAGAGGACGG + Intronic
948602649 2:239116078-239116100 CCTGTTCCGCACTGAGAGGCCGG - Intronic
948944160 2:241211044-241211066 TCTGTACCACATTTAGAAATAGG - Intronic
1168897141 20:1331355-1331377 TCTGATCCAGAGTCAGAGGCGGG - Intronic
1170528627 20:17266896-17266918 TCTGAGCCACATTTAGCAGCTGG + Intronic
1171077678 20:22145540-22145562 TCTGTTCCTCATTTGGGGGTAGG + Intergenic
1171802675 20:29640075-29640097 TTTCTTACACATCTAGAGGCTGG + Intergenic
1173574738 20:44105149-44105171 ACTCTTCCAAATCTAGAGGCAGG - Intergenic
1178567010 21:33696253-33696275 TCTGATCCACACATAGATGCTGG - Intronic
1182498359 22:30727085-30727107 CCTGTTCCACATGCATAGGCTGG - Intronic
1182547884 22:31086060-31086082 TCTGTGGTACATTTGGAGGCTGG - Intronic
1183184608 22:36284903-36284925 TCTGTTCCACCTCTAAAGCCAGG - Intronic
953667453 3:44935746-44935768 TCTTTTCCCCATTTACAAGCAGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
956996670 3:74833473-74833495 TCTGGTCCTCACCTAGAGGCCGG - Intergenic
959686192 3:109149521-109149543 TCTGGTCTACAAGTAGAGGCAGG - Intergenic
964655829 3:159065080-159065102 TCTGTCCCTCATTAAGTGGCAGG - Intronic
964727576 3:159830696-159830718 TCTGTTCCACATCTATAGTGTGG + Intronic
972002128 4:34050827-34050849 TTTTCTCCACATTTAAAGGCTGG + Intergenic
980097794 4:128511361-128511383 TATTTTTCCCATTTAGAGGCGGG + Intergenic
981856883 4:149305487-149305509 TCACTTCCACTTTTAGAGACTGG - Intergenic
983639531 4:169932085-169932107 TCTACTTCACATTTATAGGCTGG + Intergenic
983729143 4:170971836-170971858 TCTGTTCCACTTCCAGATGCAGG + Intergenic
984733947 4:183093350-183093372 TCTGTTCCAACTTTATAGTCTGG - Intergenic
985215419 4:187648577-187648599 TTTGTGGCATATTTAGAGGCTGG - Intergenic
986673333 5:10162523-10162545 CTTGTTCCACATTTAGCTGCTGG - Intergenic
987691976 5:21278977-21278999 TGTGTACCACTTTTAGAGGGTGG - Intergenic
991748410 5:69771117-69771139 TGTGTACCACTTTTAGAGGGTGG + Intergenic
991799990 5:70350962-70350984 TGTGTACCACTTTTAGAGGGTGG + Intergenic
991828610 5:70659077-70659099 TGTGTACCACTTTTAGAGGGTGG - Intergenic
991892345 5:71350393-71350415 TGTGTACCACTTTTAGAGGGTGG + Intergenic
992700261 5:79334567-79334589 TCTGTTCTACAGTGAGATGCTGG - Intergenic
995704788 5:114977112-114977134 TTTCTTACACTTTTAGAGGCTGG + Intergenic
997481255 5:134186328-134186350 TCATTTCCATATTTAGAGGATGG + Intronic
998321336 5:141235344-141235366 TCTGCTACAGATTTAGATGCAGG + Intergenic
998511251 5:142716190-142716212 GTTGTTCCACATCTAAAGGCTGG + Intergenic
998858927 5:146423979-146424001 TTTCTTCCACATTTACAAGCTGG - Intergenic
998909939 5:146948185-146948207 TTTATTCAACATTCAGAGGCAGG + Intronic
1000616209 5:163430405-163430427 TCTGTTGCAGATCTGGAGGCGGG - Intergenic
1001604870 5:172952385-172952407 TCTGTTCCCCAGTTACAGGAAGG + Exonic
1003495756 6:6661849-6661871 CCTGTTACACAATTAGAGCCTGG - Intergenic
1006002851 6:30979436-30979458 TCTGCACCAAATTTAGAGACAGG - Intergenic
1007747185 6:44050385-44050407 TATTTTCCACAATTAGTGGCTGG - Intergenic
1008051011 6:46900306-46900328 TCTGTTCCTGGTCTAGAGGCTGG - Intronic
1008309088 6:49942759-49942781 TATTTGCCACATTTAGAGACAGG - Intergenic
1008971053 6:57368628-57368650 TCCGTTCCACATTTTGGGGATGG + Intronic
1009160014 6:60270447-60270469 TCCGTTCCACATTTTGGGGGTGG + Intergenic
1013087060 6:106865870-106865892 CCTGGTCCTCATTTATAGGCTGG + Intergenic
1014398526 6:120957229-120957251 TCTTTTCCACTTTTTGAGTCTGG + Intergenic
1016065364 6:139677161-139677183 TCTGTTTCACAATTACATGCAGG - Intergenic
1016899271 6:149085367-149085389 TCATTTCCACCTTTGGAGGCTGG - Intergenic
1016995274 6:149957996-149958018 TCTGTTTAACATTTATAGCCTGG + Intergenic
1017717092 6:157220591-157220613 TCTCTTCTACTTTTAGAGACAGG + Intergenic
1020986017 7:15135354-15135376 TGTTCTCCACATTTAGAGGGTGG - Intergenic
1022472907 7:30692722-30692744 TCTGTAGGGCATTTAGAGGCAGG - Intronic
1022512295 7:30946682-30946704 TATGCTCCACTTTTTGAGGCTGG + Intronic
1022901333 7:34813472-34813494 CCACTTCCACATTGAGAGGCAGG - Intronic
1033442498 7:141393053-141393075 TTTGTGGCACATTTAGATGCTGG + Intronic
1034809948 7:154123379-154123401 TTTGTTCCACATTTACATGAAGG + Intronic
1037479897 8:19294857-19294879 TCTGTTCCACATGTAGGGGATGG - Intergenic
1039825309 8:41168543-41168565 TCTATACCACATTGAGAGGTTGG - Intergenic
1041526655 8:58813937-58813959 TCTGTTCAAAACTCAGAGGCTGG - Intronic
1044277057 8:90313466-90313488 TCAGTTCTAAATTTTGAGGCTGG - Intergenic
1044720894 8:95145162-95145184 TCTGATTCACATTTAGAGAGAGG - Intronic
1044878861 8:96701647-96701669 TGTGTGGCACATTTTGAGGCTGG - Intronic
1046184898 8:110699650-110699672 TCTATGCCACATTTATAGTCAGG + Intergenic
1046462318 8:114556348-114556370 TGTGTTCAACACTGAGAGGCGGG + Intergenic
1047088574 8:121547482-121547504 TCTGTTCTTGATTTTGAGGCTGG + Intergenic
1049833981 8:144721231-144721253 TCTGTACCACACTTGGAGGCAGG + Exonic
1051618046 9:19025374-19025396 TCTGTTACACATTAAGAGGAAGG - Intronic
1058852395 9:109025522-109025544 TCTGTTACACCTTGAGAGGAAGG - Intronic
1059589933 9:115647869-115647891 TCTGAGCCACATTTAGAGGCAGG - Intergenic
1192716529 X:73648035-73648057 TCTCTTCCACACCTGGAGGCTGG - Intronic
1193382298 X:80828890-80828912 TCTGTTCAACATTTTATGGCAGG + Intergenic
1195274534 X:103268686-103268708 TCTCTTCCACATGTAAATGCTGG + Intergenic
1198295576 X:135283405-135283427 GCTGTTCCTCATTTAAAGGAGGG - Intronic
1199546094 X:149008657-149008679 TGTGTCACAGATTTAGAGGCTGG - Intergenic