ID: 1091521701

View in Genome Browser
Species Human (GRCh38)
Location 12:1251629-1251651
Sequence AAAGTGGCCCAGTTTGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091521701_1091521704 7 Left 1091521701 12:1251629-1251651 CCTATCTCAAACTGGGCCACTTT 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1091521704 12:1251659-1251681 TTAGAAAGAAAGCAAAAACACGG 0: 1
1: 0
2: 7
3: 143
4: 1414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091521701 Original CRISPR AAAGTGGCCCAGTTTGAGAT AGG (reversed) Intronic
900307085 1:2015830-2015852 GAAGTCTCCCCGTTTGAGATGGG - Intergenic
905803546 1:40861057-40861079 AAAGTGACCCAGTTTTATTTTGG + Exonic
916483280 1:165234899-165234921 AAAGTCGCCTGGTTTCAGATGGG - Intronic
918695765 1:187544507-187544529 AAAATGACCAGGTTTGAGATAGG - Intergenic
918778745 1:188669583-188669605 ATAGTGGCCAAGGTTGAGAGTGG - Intergenic
919893951 1:201996827-201996849 GCAGTTGCCAAGTTTGAGATGGG + Intronic
920024754 1:202986073-202986095 AAAGTGTCCTAGTTTGGGCTGGG + Intergenic
924118971 1:240777497-240777519 AATGTGGCTCAGTTTTAGAAAGG + Intronic
1062881345 10:980591-980613 AAAGGGGCCCAGTTATAGCTTGG - Intergenic
1064749849 10:18516427-18516449 GAAGTGGCCCAGTGTTTGATAGG - Intronic
1065523949 10:26598750-26598772 AAACAGGCTCAGTTTTAGATTGG + Intergenic
1066269385 10:33807545-33807567 CCAGTGGCCCCGTGTGAGATGGG + Intergenic
1067372652 10:45699631-45699653 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067387126 10:45826493-45826515 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067419001 10:46130758-46130780 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067447147 10:46358114-46358136 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067504354 10:46837347-46837369 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067590232 10:47502646-47502668 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067637352 10:48010748-48010770 TAAGTGGGCCAGTTTGAACTTGG - Intergenic
1067876135 10:50009586-50009608 TAAGTGGGCCAGTTTGAACTTGG + Exonic
1069899363 10:71698359-71698381 ACAGTGCCCCAGGTTGAGGTAGG + Intronic
1070133950 10:73675177-73675199 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1070342629 10:75511546-75511568 AAATTGGCCCAGCTTGGGAAAGG + Intronic
1071607765 10:87009305-87009327 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1072765148 10:98088995-98089017 AAAGTGGCCCTGTTTGCATTTGG + Intergenic
1074058683 10:109944708-109944730 CACGTGGCCCAGTTTGAACTAGG + Intronic
1075107324 10:119549329-119549351 AAAATTGCCCAGACTGAGATGGG + Intergenic
1076287428 10:129313840-129313862 AAGGTGGCCCAGTTAGATAGTGG - Intergenic
1078899485 11:15628346-15628368 TAAGTTGCCCTGCTTGAGATGGG - Intergenic
1079179621 11:18178414-18178436 CAAGTGGCACAGTTTCAGACTGG - Intronic
1079654982 11:22975881-22975903 AAAGTGGCCAAGGTAGAGTTTGG + Intergenic
1084210147 11:67617054-67617076 AGGGTGGCCCAGTTTGGGAGGGG - Intergenic
1087494214 11:98868570-98868592 AAAGTGGGCCAGATGGAGAGTGG - Intergenic
1087603866 11:100350415-100350437 AGAGTGGACCAGTTTGAGAAAGG - Intronic
1090254777 11:125275855-125275877 AAAGAGGTTCAGTTGGAGATGGG + Intronic
1090259761 11:125310797-125310819 AAAGGGTTCAAGTTTGAGATAGG - Intronic
1091521701 12:1251629-1251651 AAAGTGGCCCAGTTTGAGATAGG - Intronic
1095765968 12:45896238-45896260 AAAGTGACACAGTATGAGAAGGG + Intronic
1101607134 12:106255995-106256017 AAGGTGACCCAGCTTGAGAATGG + Intronic
1104466755 12:128996771-128996793 AAGGTGGCCCAGGCTGGGATAGG + Intergenic
1106241792 13:27918961-27918983 AAAGTGGCCCTGTTTAAGTCAGG + Intergenic
1106528932 13:30569284-30569306 AAAGAGGCCAAGTTTGAAATGGG - Intronic
1107264350 13:38535231-38535253 AAAGTCTCCCATTCTGAGATAGG + Intergenic
1107441533 13:40432024-40432046 TAAGTGGCCCATTTTGGGAAGGG - Intergenic
1107983160 13:45752679-45752701 AAAGTCACCCAGTTTGAAAATGG - Intergenic
1110189479 13:72714684-72714706 AAAGTGGCCCAGGTATAGCTTGG + Intronic
1113645510 13:111992366-111992388 AAAGTGGCCCAGGTTGTGCCCGG - Intergenic
1116080238 14:40162408-40162430 AAAGGGGCCAAGTTTCAGCTCGG + Intergenic
1116655486 14:47648130-47648152 AAAATGGCACAGTATGACATAGG - Intronic
1118745206 14:68768368-68768390 AACGTGGCCCAGGTTGCGAGAGG + Intergenic
1120727277 14:87959132-87959154 AAAATAGCCCAGTTTAAAATTGG + Intronic
1121877851 14:97470413-97470435 AATGTGCCCCAGTTTGAGTTTGG + Intergenic
1126180168 15:45777529-45777551 AAAGTGGCCCCATTTAAGTTTGG + Intergenic
1126252143 15:46579956-46579978 AAAGAGACCAAGTTTTAGATAGG - Intergenic
1128801163 15:70498014-70498036 CAAGTGAGCCAGTTGGAGATAGG - Intergenic
1131920600 15:97323882-97323904 AAAGGGGCCCAGATTTAGACTGG + Intergenic
1132811421 16:1799977-1799999 AAAGGGGCCCAGGCTTAGATGGG - Intronic
1132877094 16:2144750-2144772 ACAGGGTCCGAGTTTGAGATGGG - Intronic
1133142458 16:3757168-3757190 AAAGTGGCCCAATTTCAGGCCGG - Intronic
1133890417 16:9874137-9874159 TGAGTGGGCCTGTTTGAGATGGG - Intronic
1134435200 16:14250508-14250530 AAAGGGGACCAGTTTTACATGGG + Intronic
1134861739 16:17566270-17566292 AGAGTGGCCCAGGTTGAGGCAGG - Intergenic
1136090123 16:27912804-27912826 ATAATGGCACAGTTTGAAATGGG + Intronic
1137844212 16:51671304-51671326 AAAGTGTCCCAGGTTGAGATTGG - Intergenic
1138059740 16:53877743-53877765 AATCAGGCCTAGTTTGAGATAGG - Intronic
1139327114 16:66161152-66161174 ACATTGGCCCAGATTGAGAAAGG - Intergenic
1141849321 16:86633870-86633892 CAAGTGACCGAGTTTGACATCGG - Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1149757731 17:59201580-59201602 AAAGTGGCAGAGTTGGAGTTGGG - Exonic
1150756460 17:67918768-67918790 ACTGTGGGCAAGTTTGAGATGGG + Exonic
1151551554 17:74825239-74825261 ACAGTGGCCCAGTTGGAGGGTGG - Intronic
1153396490 18:4627572-4627594 AAAGTGACCTAGTTGGAGTTGGG + Intergenic
1153882017 18:9429511-9429533 AAACTAACACAGTTTGAGATTGG - Intergenic
1155650122 18:28131611-28131633 AAATTGGTCCATTTTGAGAGAGG + Intronic
1157848800 18:51029112-51029134 AAACTTGCCCAGCTTGAGAAAGG - Intronic
1159683519 18:71386527-71386549 AAAGTGCCCCAGTCTGTGGTAGG + Intergenic
1165808074 19:38594157-38594179 GTAGTGGCCCAGGATGAGATTGG + Intronic
1167393446 19:49211609-49211631 ACAGTGGCCCAGATGGACATGGG - Exonic
925218073 2:2114461-2114483 ATAATCGCCCAGTTTAAGATAGG + Intronic
927384131 2:22513695-22513717 AAAGTGACCTATTCTGAGATGGG + Intergenic
929288358 2:40162075-40162097 AGAGTGAGCCAGTTGGAGATGGG - Intronic
929323929 2:40582418-40582440 ATTCTGGCCCAGTTTGAGCTGGG + Intronic
929990033 2:46779243-46779265 AATTTTGCCCATTTTGAGATGGG + Intergenic
933677192 2:85067238-85067260 AAAGTGGCCCAGTTAGCAACCGG + Intergenic
936098621 2:109554526-109554548 AAATTGTCCCAGTCTGAGTTGGG - Intronic
936541979 2:113359748-113359770 AGAGTGGCCAAGTGTGAGAAAGG - Intergenic
937301281 2:120844012-120844034 AAACAGGCCCAGTGAGAGATGGG - Intronic
940764622 2:157776607-157776629 AAAGTGGCCCAGTGATGGATGGG + Intronic
941596136 2:167479654-167479676 AAAGAGGATCACTTTGAGATAGG - Intergenic
941610978 2:167661939-167661961 AAAATGTCCCAGAGTGAGATAGG - Intergenic
943271552 2:185811791-185811813 AAAGGGGCCCAGTTACAGCTTGG + Intronic
943587040 2:189753076-189753098 AAACTATCCCATTTTGAGATGGG + Intronic
944329475 2:198448420-198448442 AAAGTGGCACAATTTTTGATTGG + Intronic
944932242 2:204531510-204531532 AAAGTGGCACTATTTGAAATGGG + Intergenic
946532460 2:220586357-220586379 AAATTGAGCCAGTTTGAGTTGGG + Intergenic
947360153 2:229338610-229338632 AAATTTGCCCAGTCTGAGATAGG + Intergenic
1169322557 20:4645470-4645492 AAAGTGGCCCAGGTACAGCTTGG - Intergenic
1170588213 20:17751241-17751263 AAAGTGGACCCGTCTGAGACGGG - Intergenic
1172439948 20:34958279-34958301 AAGGTGACCCAGTTTGTGGTAGG + Intergenic
1179080955 21:38170283-38170305 AAAGTGGCCCAGTTTGGAGAAGG - Intronic
1180968206 22:19801395-19801417 CACGTGGCCCTGTTTGGGATGGG - Intronic
1181488645 22:23247540-23247562 AATGTGCCCCAGGGTGAGATGGG - Intronic
1181986877 22:26806106-26806128 AAAGTGACACAGCCTGAGATTGG + Intergenic
1182872624 22:33662124-33662146 AAAGTGGCCAAATTTGTGTTGGG + Intronic
1183043289 22:35199614-35199636 AAACTGGCCTAATTTGAGATGGG + Intergenic
1184818051 22:46886994-46887016 AATGTAGCCCAGTTTATGATTGG - Intronic
949228686 3:1724854-1724876 TAAGTGTCCTAGTCTGAGATGGG + Intergenic
950349674 3:12336036-12336058 AAAGTGTCCCAGTTTGGGTAAGG + Intronic
952188159 3:30993108-30993130 AAAGGGGCCCAGTTACAGCTCGG - Intergenic
954968460 3:54631251-54631273 AAAATGTCCCAGCTTGAGATTGG + Intronic
958103533 3:89045066-89045088 ATAGATACCCAGTTTGAGATGGG - Intergenic
961759636 3:129156632-129156654 AAAGTGGCTCAGATTCAGAATGG - Exonic
962732311 3:138294799-138294821 AAAGTGGCCTCCTTTGAGGTGGG - Intronic
963777340 3:149452386-149452408 AAAGGGGCCCAGGTAGAGCTTGG - Intergenic
964780731 3:160334708-160334730 AAAGTGAGCCAATTTGAGCTGGG - Intronic
965248122 3:166302674-166302696 AAAGAATCCCAGTTTGAGATGGG + Intergenic
965957615 3:174389723-174389745 AAAGGGGCCCAGGTAGAGCTTGG - Intergenic
969884902 4:10206688-10206710 CAAGGGGCCCAGTGTGAGGTGGG + Intergenic
975435966 4:74351539-74351561 AAAATCGCTCAGTTTGAGACAGG - Intergenic
976268661 4:83208478-83208500 ACAGTGGCTCAGTATGAGAGGGG + Intergenic
977367301 4:96086553-96086575 AAACTGGGCCAATGTGAGATTGG + Intergenic
977443667 4:97101498-97101520 GAAGTGCCCCAGTTTGATACGGG + Intergenic
978379260 4:108109821-108109843 CAAGTGTCCCAGGCTGAGATGGG + Intronic
981462513 4:145029688-145029710 AAAATGGCCCACTGTGAGAGAGG + Intronic
983136566 4:164090965-164090987 AAGGTTGCCCTGTTTGAAATGGG - Intronic
984855233 4:184189376-184189398 AAAGTGGCCTGATTTGAGGTAGG - Intronic
988102163 5:26694241-26694263 AAAGTGGTCTAGTTAGAGTTTGG + Intergenic
990631797 5:57678669-57678691 AAACTGACCCATTTTGAGGTGGG + Intergenic
991460765 5:66855851-66855873 AAAGTGTGTCTGTTTGAGATGGG + Intronic
993010099 5:82471144-82471166 AAAGAGGCATAGATTGAGATAGG - Intergenic
994116539 5:96067572-96067594 AAATTGGCCTAGTTTAAAATGGG + Intergenic
999043119 5:148437613-148437635 AAATTGGACCAGGTTGAAATTGG + Intronic
1003383949 6:5650235-5650257 AATGTGGCCCACTTTGACATCGG - Intronic
1003851421 6:10226684-10226706 AAAGAGGCTTTGTTTGAGATAGG + Intergenic
1004204717 6:13581759-13581781 AGAGTGGCCCTGTCTGATATCGG - Intronic
1007235756 6:40390527-40390549 AAAGTGGCTCAGGGTGGGATGGG - Intergenic
1007803311 6:44416706-44416728 AGTTTGGCCCAGTATGAGATTGG - Intronic
1007955392 6:45913570-45913592 AAAGTGGTCCAGGTTGAAGTGGG + Intronic
1009491708 6:64300197-64300219 CACGTGGCCAAGTTTGTGATGGG + Intronic
1013914419 6:115317897-115317919 AAAATGGCCCAGTTTTTAATAGG - Intergenic
1018729232 6:166636418-166636440 AGAGAGGCCCTGTCTGAGATAGG - Intronic
1020781647 7:12523662-12523684 CAAGTGGCCAACTCTGAGATAGG + Intergenic
1022624891 7:32025188-32025210 ATAAAAGCCCAGTTTGAGATGGG - Intronic
1023266580 7:38412409-38412431 CACTTGGCCCTGTTTGAGATGGG + Intronic
1026176074 7:67998139-67998161 AAAGTGGCTCAGCTGGAGATTGG + Intergenic
1035819815 8:2579284-2579306 CAAGTTGCCAAGTTTTAGATGGG - Intergenic
1037895387 8:22649167-22649189 AAAATGTCCCAGTTTGGGACAGG - Intronic
1039046418 8:33454464-33454486 AATGTGACCCACTTTGAGGTGGG - Intronic
1040493586 8:47947046-47947068 AAAGTGGGCCAGGGTGAGATGGG - Intronic
1046929032 8:119824710-119824732 AAAGGGGCCAACTTTGAGCTTGG + Intronic
1053112546 9:35475156-35475178 CAAGTGGCTCAGTTTGGAATTGG - Intergenic
1055460648 9:76517056-76517078 GAAGTGGAAGAGTTTGAGATAGG - Intergenic
1055525112 9:77125386-77125408 AAAATGGCCCAGTTTTATCTGGG + Intergenic
1058176689 9:101743428-101743450 AAAATGTCCCAGTCTGTGATGGG - Intergenic
1058729292 9:107834744-107834766 AAAGTGACACAGAATGAGATGGG - Intergenic
1060257911 9:122048613-122048635 TAAGTGGCCCAACTTGAGGTGGG - Intronic
1060308150 9:122434932-122434954 AAAGGGGCCGAGGTAGAGATTGG + Intergenic
1062597061 9:137304241-137304263 AAAGGGGCCCTGTGTGAGCTCGG + Intergenic
1187030511 X:15483249-15483271 AAAGTGCCCCAGCTTTATATGGG - Intronic
1190558091 X:51658115-51658137 AAAGTGCCCCAGGTTCACATGGG + Intergenic
1196456206 X:115893200-115893222 AAAGTGGCCAAGATTGTGATCGG - Intergenic
1196463269 X:115950323-115950345 AAAGTGGCCGAGATGGTGATTGG - Intergenic
1197385483 X:125796218-125796240 AAAGGGGCCCAGGTAGAGCTGGG + Intergenic
1199952161 X:152715293-152715315 AAGGTGGCTCAGTTTGAGACAGG - Intronic
1199954802 X:152734486-152734508 AAGGTGGCTCAGTTTGAGACAGG - Intronic
1199957522 X:152753155-152753177 AAGGTGGCTCAGTTTGAGACAGG + Intronic