ID: 1091522887

View in Genome Browser
Species Human (GRCh38)
Location 12:1265694-1265716
Sequence GGTGGGGCATGATACTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091522887 Original CRISPR GGTGGGGCATGATACTTTAA GGG (reversed) Intronic
900996586 1:6126389-6126411 GGTGGGGCAGGATTCTGTCAGGG - Intronic
900996622 1:6126502-6126524 GGTGGGGCAGGATTCTGTCAGGG - Intronic
904564857 1:31422737-31422759 TGTGGGGCCTGTTTCTTTAAAGG + Intronic
905927684 1:41763457-41763479 GGTGGGGCATCCAACTTGAATGG - Intronic
908016906 1:59850658-59850680 ACTTGGCCATGATACTTTAATGG + Intronic
910435873 1:87205234-87205256 GGTGGGACATGATGTTTTATTGG - Intergenic
913053380 1:115136264-115136286 TGTGGGGCAAGATACCTTCAGGG + Intergenic
913522041 1:119653908-119653930 GGTGGGGGAGGAGAATTTAATGG - Intergenic
917112537 1:171563966-171563988 GGTGGAGCAAGATATTTTATTGG + Intronic
920114287 1:203609102-203609124 GGTGGTGCATGCTACTTGAGAGG - Intergenic
1063981965 10:11461042-11461064 GGTGGGGCTTTAAACTTTCAAGG - Exonic
1064187389 10:13174262-13174284 GGTGGGGCATGCTACTCCAGAGG - Intronic
1064199413 10:13272019-13272041 GGTGGGAGATGATATTTTCATGG - Intergenic
1065422266 10:25558454-25558476 GGAGGGGCAGGTTTCTTTAAAGG + Intronic
1068640668 10:59402636-59402658 GGTGGGGCCTGATACTTGAGTGG + Intergenic
1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG + Intergenic
1083450699 11:62743132-62743154 GGTGGTGCATGCTACTTGGAAGG - Intergenic
1088433373 11:109782957-109782979 TGTGGTGCATGAGACTTCAAAGG - Intergenic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1097383669 12:58923812-58923834 GGTTGGGAAAGATTCTTTAAAGG + Intergenic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1109099595 13:58163778-58163800 GGAGGGGCATGAGACTGTAAAGG + Intergenic
1115369862 14:32601020-32601042 GGTGGGGGACAGTACTTTAAGGG + Intronic
1120599185 14:86480008-86480030 GGTGGAGTATGATAATTTTAGGG - Intergenic
1120793571 14:88607707-88607729 GATGGGGGATGATACTTGCAGGG - Intronic
1120793589 14:88607791-88607813 GGTGGGGGATGGTACTTGCAGGG - Intronic
1120793615 14:88607894-88607916 GGTGGGGGATGATACTTGCAGGG - Intronic
1123886692 15:24733774-24733796 GGAGGGGATTGTTACTTTAACGG + Intergenic
1135117671 16:19737397-19737419 AGTGGGGCAGGATACTGTGAAGG - Intronic
1136993590 16:35172679-35172701 GGAGGGGCAGGAAACTTTGAAGG + Intergenic
1145186523 17:20799331-20799353 TGTGGGGCATGAAACTTTTCTGG + Intergenic
1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG + Intergenic
1153730122 18:8002756-8002778 TGTTGGGGATGATACTTTATTGG - Intronic
1158303202 18:56075832-56075854 GGTGGGTTATGATACATAAAAGG + Intergenic
925616740 2:5750963-5750985 GGTGGGGAATTATTGTTTAATGG - Intergenic
927235169 2:20866961-20866983 GGAGGGGCAAAATGCTTTAAAGG + Intergenic
930428537 2:51243512-51243534 GCTGGGGCAAGATAGTTTATTGG - Intergenic
932857765 2:75255515-75255537 GGGAGGGCATTATACTCTAAGGG + Intergenic
938393383 2:130922724-130922746 GTTTGGGCCTGATAATTTAAAGG + Intronic
941481754 2:166024102-166024124 GGTGGTGCATGCTACTTTGGAGG + Intronic
1174293620 20:49527603-49527625 GGTGGGGAATTATTGTTTAATGG + Intronic
1185191858 22:49443147-49443169 GGTAGGGGGTGATACTTTGAAGG - Intronic
953621533 3:44536924-44536946 GGGTGGGCATGATCCGTTAAGGG - Intergenic
972302281 4:37796110-37796132 TTTGGGGCCTGATAATTTAAAGG + Intergenic
972761635 4:42111479-42111501 GGTGGGTCATGAAGCTTTCAAGG - Exonic
978935430 4:114369086-114369108 GGTGGGCCACCATACATTAAGGG - Intergenic
984066281 4:175052002-175052024 GGTGGTGCATGAGATTGTAAAGG - Intergenic
988422850 5:31027390-31027412 GCTTGGGCATGCTACTTGAAAGG - Intergenic
991112275 5:62914359-62914381 GCTGGGGCATGAGACTTTTCAGG + Intergenic
994603864 5:101942633-101942655 GGTGTGGCCTGATTCTCTAAGGG - Intergenic
995761973 5:115572659-115572681 TGTCTGGCATGATAATTTAAAGG - Intergenic
1000694585 5:164364689-164364711 GTTGGCGGATGCTACTTTAAGGG - Intergenic
1001040692 5:168333041-168333063 GGTGGGGCTTGAGACTTGAAGGG - Intronic
1007279221 6:40698172-40698194 GGTGGGGCATGTGACATTATTGG + Intergenic
1015458294 6:133456010-133456032 TGTTGGGCTTCATACTTTAATGG - Intronic
1021855575 7:24851770-24851792 GGTAGGACATGGCACTTTAATGG + Intronic
1025613404 7:63097589-63097611 AGTGGGAAATGATGCTTTAATGG - Intergenic
1028965198 7:96794372-96794394 AGTGGGGAATGAAAGTTTAATGG - Intergenic
1029474453 7:100774851-100774873 GGAGGGGCATGATTCTTTGGAGG - Intronic
1030849931 7:114471365-114471387 GGTGGGAAATGATACCTGAATGG - Intronic
1032376456 7:131423995-131424017 GCTGGGTCATGATACTTCAAGGG + Intronic
1037700668 8:21271381-21271403 GATGGGGCATAAAAGTTTAAGGG + Intergenic
1038370554 8:26985648-26985670 GGATGGGTATGATACTGTAATGG - Intergenic
1039185103 8:34907885-34907907 AGTGGGGCATGAAATTTTACTGG - Intergenic
1049334594 8:142076478-142076500 GGTGGGGCATGAGGCTAGAATGG - Intergenic
1056013322 9:82355422-82355444 GGTGGTGAATGATACTTTGGGGG + Intergenic
1057842599 9:98498238-98498260 GGTGGGGAGTGATTGTTTAATGG + Intronic
1185559143 X:1045276-1045298 GTTGGGGCAGGATCCTGTAAAGG - Intergenic
1195017911 X:100796814-100796836 GATGGGGGATCATACTTTACTGG + Intergenic