ID: 1091526918

View in Genome Browser
Species Human (GRCh38)
Location 12:1312000-1312022
Sequence ATCATGTTCTTGAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 351}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091526918_1091526922 4 Left 1091526918 12:1312000-1312022 CCATTTTTCCTCAAGAACATGAT 0: 1
1: 0
2: 3
3: 31
4: 351
Right 1091526922 12:1312027-1312049 TCTTTTGCATCTCAGTGCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 209
1091526918_1091526921 3 Left 1091526918 12:1312000-1312022 CCATTTTTCCTCAAGAACATGAT 0: 1
1: 0
2: 3
3: 31
4: 351
Right 1091526921 12:1312026-1312048 GTCTTTTGCATCTCAGTGCAGGG 0: 1
1: 0
2: 6
3: 18
4: 232
1091526918_1091526920 2 Left 1091526918 12:1312000-1312022 CCATTTTTCCTCAAGAACATGAT 0: 1
1: 0
2: 3
3: 31
4: 351
Right 1091526920 12:1312025-1312047 TGTCTTTTGCATCTCAGTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 189
1091526918_1091526923 8 Left 1091526918 12:1312000-1312022 CCATTTTTCCTCAAGAACATGAT 0: 1
1: 0
2: 3
3: 31
4: 351
Right 1091526923 12:1312031-1312053 TTGCATCTCAGTGCAGGGGTTGG 0: 1
1: 0
2: 1
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091526918 Original CRISPR ATCATGTTCTTGAGGAAAAA TGG (reversed) Intronic
900531086 1:3153522-3153544 ATCATGTGCTGCAGGAGAAACGG + Intronic
905102222 1:35534308-35534330 AGAATGATCTTTAGGAAAAATGG - Intronic
905304741 1:37009810-37009832 ATCGTGGTAATGAGGAAAAATGG + Intronic
910823198 1:91373907-91373929 ATCAACTTCTTGAGGAAAGGGGG - Intronic
910834784 1:91497759-91497781 AACATGTTATGAAGGAAAAATGG + Intergenic
912660039 1:111519345-111519367 ATCATGGTCTTGGGAAATAATGG + Intronic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
913442740 1:118916147-118916169 ATAAGCTCCTTGAGGAAAAATGG - Intronic
915037857 1:152943684-152943706 ATGATCTTCTTGGGGAAATAAGG - Intergenic
916052911 1:161048672-161048694 ATCAAGTTGCTGAGGAGAAATGG - Exonic
916565270 1:165970309-165970331 TTCATTCTATTGAGGAAAAAAGG + Intergenic
917281836 1:173384811-173384833 AACATATTCATGAGAAAAAATGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917578128 1:176345459-176345481 CTCATATTCTTGAGCAAAACCGG - Intergenic
917707494 1:177649040-177649062 ATGATGTTCAAGGGGAAAAATGG + Intergenic
917825212 1:178812783-178812805 CCCATGTTCTTAAGGAAAATAGG - Intronic
918129333 1:181611551-181611573 ATCTTATCCTTGAGGAAGAATGG - Intronic
921269201 1:213452122-213452144 ATCTTGTTCTTGAGCTACAAGGG + Intergenic
921898238 1:220423357-220423379 AACATGATTTTGAGGATAAAAGG + Intergenic
922961177 1:229646878-229646900 AGCATGTTCCTGGGGCAAAAGGG + Intronic
923773558 1:236958787-236958809 ATCATTTTCATGTGGAGAAAGGG + Intergenic
1063179045 10:3580367-3580389 ATCATGTTTTTGAGAAGAGAAGG - Intergenic
1063323839 10:5077427-5077449 ATGATGTTCTTGTGGGAAACTGG + Intronic
1063599534 10:7467611-7467633 ATCATAATGTTGAGTAAAAAAGG - Intergenic
1064287038 10:14000686-14000708 ATCGTGTTCTCAAGGAGAAAGGG - Intronic
1064950789 10:20847783-20847805 AGAATATTCTTGAGGCAAAACGG - Intronic
1066455411 10:35567878-35567900 ATCATCTATTCGAGGAAAAATGG + Intronic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068309602 10:55261336-55261358 ATTTTGTACATGAGGAAAAAAGG + Intronic
1068817931 10:61338673-61338695 AACAGATTCTTGAGGAAATAAGG - Intergenic
1068893359 10:62171697-62171719 ATTATCTTCTTGACAAAAAAAGG + Intergenic
1069081702 10:64095307-64095329 ATAATGTTCTACAGCAAAAAAGG - Intergenic
1070393573 10:75992124-75992146 ATTATGCACATGAGGAAAAAGGG + Intronic
1070539347 10:77405047-77405069 AAAATGTGCTTGAGGAAACAAGG + Intronic
1071236258 10:83653049-83653071 ATAATTTTCTTGAAGGAAAAAGG + Intergenic
1073502355 10:103951858-103951880 ATCATTTTATTAAGGAACAAGGG - Intergenic
1073644948 10:105292228-105292250 ATTTTGTTCTGGAGGAAACACGG + Intergenic
1074679631 10:115891290-115891312 ATAGTGTTCTGGAAGAAAAAGGG + Intronic
1077448581 11:2618479-2618501 TTCGTGTTCTTGTGGAAAATTGG + Intronic
1078293459 11:10040548-10040570 ATCCTGTACTGGAAGAAAAAAGG + Intronic
1079151346 11:17902440-17902462 AGCATGTTCAAGAGAAAAAATGG + Intronic
1079315091 11:19400789-19400811 ATCATCATCTTGATGGAAAATGG + Intronic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1080282864 11:30578882-30578904 AACATGATTTTAAGGAAAAATGG - Intronic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1081389229 11:42509374-42509396 ATCATGTTCTTGCAGCAACATGG - Intergenic
1081919946 11:46765293-46765315 ATCATATTCTTAAGGAGAAGTGG - Intronic
1082188123 11:49208907-49208929 ATAATATTCTTTAGGAAAAAGGG - Intergenic
1083010318 11:59391073-59391095 ATTATGTTTTTGAGGACAAACGG - Intergenic
1083084225 11:60125815-60125837 CTCAAGTTTTTGAAGAAAAAAGG + Intergenic
1085648890 11:78249006-78249028 ATCATGTTCTTCATGAAAATGGG + Intronic
1086971013 11:93080812-93080834 AACATGTTCTTCTGGACAAAGGG - Intergenic
1088158791 11:106842699-106842721 ATCATAGTGGTGAGGAAAAAGGG + Intronic
1088790616 11:113223079-113223101 TTCATATTTTTGGGGAAAAAAGG + Intronic
1089999632 11:122944448-122944470 AACATGTTCTAGAGGAGAATGGG - Intronic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1091875608 12:3930778-3930800 AGCTTCTTCTTCAGGAAAAAGGG + Intergenic
1092436739 12:8453680-8453702 ACCATGTTCTAGAGTAATAAAGG - Intergenic
1093318676 12:17684585-17684607 ATAATATTCTGGAGGAGAAAAGG - Intergenic
1093388856 12:18592759-18592781 TTTATGTTGATGAGGAAAAACGG + Intronic
1093828860 12:23730448-23730470 GACATGTTCTTGAGGGAAGATGG + Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1094237052 12:28180385-28180407 ACTGTGTTTTTGAGGAAAAAAGG - Intronic
1096471230 12:51877494-51877516 ATCTTCTTCTTGAAGATAAATGG + Intergenic
1098309373 12:69133052-69133074 ACCAAGCTATTGAGGAAAAAAGG - Intergenic
1098433227 12:70442851-70442873 ATCATGAACTTGTGAAAAAAAGG - Intergenic
1099825081 12:87765258-87765280 AACATATTGTTGAGCAAAAAAGG - Intergenic
1101051667 12:100869989-100870011 ATCATGTTGTTGAGAAACACAGG - Intronic
1101052551 12:100878403-100878425 ATCAGGTACTTGAGGACAAATGG - Intronic
1101553877 12:105788606-105788628 ATCATGCTATGGAGGAAAGAAGG + Intergenic
1101660572 12:106761593-106761615 CTCATGTTCATTAGGAAAATGGG - Exonic
1106058531 13:26263098-26263120 GTCATATTTTTGAGGAAAGAAGG + Intronic
1107577187 13:41738796-41738818 ATCATTTTTTTGAAAAAAAATGG + Intronic
1107662280 13:42651028-42651050 AGCATTTTCTAGAGGGAAAAGGG + Intergenic
1108301794 13:49085002-49085024 ATCAGGTACTTGAGGAAATGAGG - Intronic
1109500552 13:63231694-63231716 ATCATATTTATGAGGAATAAAGG - Intergenic
1109756140 13:66762460-66762482 ATCATAAGCTTGAGGAAAGATGG - Intronic
1110841443 13:80148076-80148098 AACATGTGCATGTGGAAAAATGG - Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111553973 13:89855233-89855255 ATTATATTCTTGAGGATAATTGG - Intergenic
1111910410 13:94304403-94304425 ATCATATGCGTGATGAAAAATGG + Intronic
1111968189 13:94882216-94882238 GTCATGTTCTAAAGGAGAAAAGG - Intergenic
1113065153 13:106365841-106365863 AATATATTCTTAAGGAAAAATGG + Intergenic
1113199047 13:107844810-107844832 GTCATGCTCTTGAGGAAATTAGG - Intronic
1113616193 13:111682297-111682319 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1113621661 13:111767190-111767212 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1114537900 14:23434418-23434440 AACTAGTTCTTGAGGAAAAAGGG - Intronic
1114855607 14:26437279-26437301 AGCATGTTATAGAGGAAAAGTGG - Intergenic
1115339716 14:32280177-32280199 ATTATCATCTTGAAGAAAAAAGG - Intergenic
1115857842 14:37650184-37650206 ATCTTTTTCTTGAGGACGAAGGG + Intronic
1116139513 14:40972993-40973015 ATAAAGATCTTTAGGAAAAATGG + Intergenic
1116178085 14:41499063-41499085 AACATGCTCTTGAGGAGACAGGG - Intergenic
1116493124 14:45529075-45529097 TTTATGTTCATGAGGAAAACGGG - Intergenic
1116760056 14:49001661-49001683 AACATGTTAATGAGGAGAAATGG - Intergenic
1117045829 14:51812283-51812305 ATCCTCTCTTTGAGGAAAAATGG + Intergenic
1117084907 14:52189837-52189859 ATCTTGTTATCCAGGAAAAAGGG + Intergenic
1117674170 14:58139224-58139246 CACATGTTCATGCGGAAAAAGGG - Exonic
1118157527 14:63256200-63256222 AGCATGTGGTTGAGGAATAAGGG - Intronic
1118550421 14:66944043-66944065 ATCTTGTTTTTCTGGAAAAAGGG - Intronic
1118676027 14:68185547-68185569 ATCATGTTCTTGAGTAGATTAGG + Intronic
1119643399 14:76330772-76330794 ATCCTGGGCTTGAGGACAAAGGG + Intronic
1120099605 14:80429190-80429212 CCCATGTTAATGAGGAAAAAAGG - Intergenic
1120343163 14:83247205-83247227 ATTATTTTATTCAGGAAAAATGG + Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1121829692 14:97039441-97039463 AATATGTTCTTGAGGAAATCAGG - Intergenic
1123973333 15:25529076-25529098 AGCTTGATCTTCAGGAAAAATGG + Intergenic
1124795958 15:32780073-32780095 GTCATGTTTTTTAGGAAATAAGG - Intronic
1125138008 15:36366794-36366816 AACATATTCTTGAGGGAAAGGGG - Intergenic
1126299584 15:47181297-47181319 ATCATGTACTTTAGGCAATATGG + Intergenic
1127153656 15:56105839-56105861 CTCATGTTTTTAAAGAAAAAAGG + Intronic
1127699109 15:61479838-61479860 ATCATGATGTCAAGGAAAAAGGG + Intergenic
1128526624 15:68416617-68416639 ATCATCTTCTTCAAGAACAAGGG + Intronic
1129526907 15:76224013-76224035 AATATTCTCTTGAGGAAAAAAGG + Intronic
1130745948 15:86654152-86654174 ATCATGTACCTGAGTGAAAAAGG + Intronic
1131800388 15:96062985-96063007 ATCATTCTATTGATGAAAAATGG - Intergenic
1132331347 15:101014319-101014341 CTCATGTTCTTGAGGTTACAGGG + Exonic
1133529330 16:6640246-6640268 ATCAACTTCTTGAGGAAATGTGG - Intronic
1135046544 16:19160643-19160665 ATCATGTTAGGGAGGAAGAAGGG - Intronic
1135106053 16:19650846-19650868 ATTATTATCTAGAGGAAAAAAGG - Intronic
1136341347 16:29645804-29645826 ACCATGTTCTTGGGGAAGAAGGG - Intergenic
1136525632 16:30828145-30828167 ATCCTGTGCTAGAGGAGAAATGG + Intergenic
1136563040 16:31052362-31052384 ATCATGCTCTTTAGGGCAAAGGG - Intergenic
1137930446 16:52582257-52582279 AGCATGTTTTATAGGAAAAAGGG - Intergenic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1137989379 16:53137787-53137809 TTTATGTTCTTGAAGATAAATGG + Intronic
1138070271 16:53985960-53985982 TTCAGGTTCATGATGAAAAATGG + Intronic
1139869200 16:70090718-70090740 ATCATGTTTGAGAGGCAAAATGG - Intergenic
1140386182 16:74541419-74541441 ATCATGTTTGAGAGGCAAAATGG + Intronic
1140934638 16:79658989-79659011 ATCGTTTTCTTGAGGACAAGAGG + Intergenic
1142473173 17:174594-174616 GTCATGTTCCAGAGGCAAAAGGG + Intronic
1143370853 17:6438280-6438302 ATAATGTTGATGAGAAAAAAAGG + Intergenic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1145194042 17:20870898-20870920 ATCATATGCTAGAGGAAAGAAGG + Intronic
1145297992 17:21610275-21610297 ATCATATACTAGAGGAAAGAAGG - Intergenic
1145352268 17:22093120-22093142 ATCATATACTAGAGGAAAGAAGG + Intergenic
1145404412 17:22572545-22572567 ATCATATGCTAGAGGAAAGAAGG + Intergenic
1146956573 17:36939549-36939571 ATCCAGTCCTTGAGGAAAACCGG - Intronic
1148525194 17:48325577-48325599 AGCATTTTCTTTAGGAAAACAGG - Intronic
1148931755 17:51132605-51132627 TTTATGTTTTTGAGGAATAATGG - Intergenic
1151039478 17:70841897-70841919 ATCATATATTAGAGGAAAAATGG + Intergenic
1151184513 17:72353447-72353469 ATCATGTTCTCTGGGAGAAACGG + Intergenic
1153127840 18:1817606-1817628 AACAAGTTTTTGGGGAAAAATGG - Intergenic
1153136687 18:1925587-1925609 ATCAAAAGCTTGAGGAAAAATGG - Intergenic
1153988687 18:10376101-10376123 ATGATATACTGGAGGAAAAAAGG - Intergenic
1156196516 18:34780048-34780070 GTCATTTTCTGAAGGAAAAAGGG + Intronic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1158180202 18:54706855-54706877 ATCATGCATTTGAGGAAAAATGG - Intergenic
1159271284 18:66154637-66154659 ATAAAGTTCTTTAGGATAAAGGG + Intergenic
1159302346 18:66590938-66590960 ATTATCCTCTTGAGGAAGAAAGG - Intronic
1159686652 18:71429918-71429940 ATCATTTTCATGAGTAGAAAAGG - Intergenic
1162686584 19:12390661-12390683 TTCATGTCCTTGAAGAAAACGGG + Exonic
1162690916 19:12430351-12430373 TTCATGTCCTTGAAGAAAACGGG + Exonic
1163667398 19:18609817-18609839 ATTATCTCCTTGAGGACAAAAGG + Intronic
1163916818 19:20247310-20247332 TTCAGGTTCTTGAGGGAGAAAGG - Intergenic
1164901034 19:31923515-31923537 ATCACGTTTTTGAGGAAAATTGG - Intergenic
1167410593 19:49341567-49341589 ATCATGTTCCCCAGGAGAAAGGG + Intronic
926515111 2:13833884-13833906 AGCTAGGTCTTGAGGAAAAACGG - Intergenic
927280739 2:21304004-21304026 ATCATCTTCCTGTGAAAAAATGG + Intergenic
928793339 2:34985522-34985544 AGCTTGTTTTTAAGGAAAAATGG + Intergenic
928867062 2:35929383-35929405 ATCATCTTCCTTAGGAAAAAAGG + Intergenic
929744888 2:44646660-44646682 TTCATGGTTTTGGGGAAAAAGGG - Intronic
929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG + Intergenic
930187180 2:48421722-48421744 ATAATGTTTTTGATGAAATAAGG - Intergenic
930917111 2:56706241-56706263 ATCATGTTTTTGAATAAATAAGG + Intergenic
931312820 2:61098461-61098483 GTTATGTTGTTGAGTAAAAAAGG - Intronic
932066085 2:68562308-68562330 AACATGTTTTTGAAGGAAAAAGG + Intronic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
935772030 2:106434315-106434337 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
935908039 2:107861631-107861653 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
935994447 2:108753862-108753884 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936129830 2:109826738-109826760 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936424004 2:112399310-112399332 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
940355231 2:152734177-152734199 ATAATGGACTTAAGGAAAAACGG - Intronic
940672922 2:156692867-156692889 ATCCTGTTCGTTTGGAAAAAAGG + Intergenic
940963879 2:159816285-159816307 ATAATTTTCTAGAGGAAAAGTGG + Intronic
941226320 2:162854202-162854224 ATAATATTCTTTAGAAAAAAGGG - Intergenic
941369458 2:164646237-164646259 GTAACTTTCTTGAGGAAAAAGGG + Intergenic
941771560 2:169350841-169350863 ATCTTGTTCCTGAAGAAAGAAGG - Intronic
941773507 2:169367116-169367138 TTCATTTTATTGTGGAAAAATGG - Intergenic
942238206 2:173933072-173933094 ATCACGTTCTGATGGAAAAATGG + Intronic
942579119 2:177397327-177397349 AACATGCACTTAAGGAAAAAGGG - Intronic
943398478 2:187372859-187372881 ATCATGTTCTTGTGGAGTCAGGG - Intronic
944855853 2:203765808-203765830 ATAATGTTCTCAAGGACAAAAGG + Intergenic
947168866 2:227290742-227290764 TTCAGGTTCTAAAGGAAAAAGGG + Exonic
948430493 2:237915537-237915559 ATTATGTTAATGAGGTAAAATGG + Intergenic
1170709729 20:18779373-18779395 ATCATCATCTTGGGGAAAGAGGG - Intergenic
1172053107 20:32134388-32134410 ATGAATTGCTTGAGGAAAAATGG - Intronic
1174770045 20:53291089-53291111 TTCATGTTCTTGAGGAGACATGG - Intronic
1175080528 20:56416611-56416633 ATCATGTTATTGGGGAAAAAAGG - Intronic
1175291780 20:57880829-57880851 TTCATGTTCATGAAGAAAAAAGG - Intergenic
1176928292 21:14777796-14777818 ATCATATTCAGAAGGAAAAATGG + Intergenic
1178027154 21:28481000-28481022 AACTTGTTTTTAAGGAAAAAAGG - Intergenic
1178038076 21:28607457-28607479 AAAATGTTGTTGAGGAAAACTGG + Intergenic
1179067637 21:38041123-38041145 TTCATCCTCTTGAAGAAAAATGG - Intronic
1183045919 22:35219939-35219961 ATCATCTTCATAAGGAACAATGG - Intergenic
1183873456 22:40758484-40758506 AGCATGCTGTTGTGGAAAAAAGG + Intergenic
1184549446 22:45196737-45196759 CACATGTTCTTGAGGAAAGCCGG - Exonic
949323853 3:2841995-2842017 AACATGTTCTTGAAAAAAATGGG - Intronic
950376196 3:12574329-12574351 ATCATTTTCTTGGGGAGAAGTGG + Intronic
950992948 3:17460552-17460574 ATCATGTTAAAGGGGAAAAATGG - Intronic
951148124 3:19253866-19253888 ATTATGTTCTACAAGAAAAACGG + Exonic
951307277 3:21080726-21080748 AACATCTTTTTGAGGAAAAAGGG - Intergenic
951990239 3:28668491-28668513 ATCATTTTTTTAAAGAAAAATGG + Intergenic
953486656 3:43304838-43304860 ATCATGTTCTGGAAAAGAAAGGG + Intronic
955057467 3:55469488-55469510 GTCATATTCTCAAGGAAAAAAGG - Exonic
955748827 3:62167498-62167520 ACCATTTTATTGAGGAAAAATGG + Intronic
956011540 3:64836927-64836949 AGCAAGTTCTTAAGGAAAAGTGG + Intergenic
956518935 3:70082515-70082537 TTCATTTTCCTAAGGAAAAAAGG - Intergenic
956655538 3:71546901-71546923 ATCATGAGCTTGAGAAAAGAAGG + Intronic
958633902 3:96717745-96717767 ATCTTGTTTTTAAGAAAAAAGGG - Intergenic
958659280 3:97044429-97044451 ATCATTTTCTTATGCAAAAATGG - Intronic
960435316 3:117619362-117619384 GTCATATTCTAGAGCAAAAAGGG + Intergenic
961252479 3:125519305-125519327 TTCATTTGCTTGAGGAAAAGGGG - Intronic
963134603 3:141889902-141889924 ATCCAGTGCTTGAGGAGAAAAGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964011861 3:151901251-151901273 GTCATCTCCTAGAGGAAAAAAGG - Intergenic
965249628 3:166326582-166326604 AATATGTTCTTGAGGGAAATTGG + Intergenic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
965788888 3:172366405-172366427 ATTTAGTTCTTGAGTAAAAAGGG + Intronic
966669242 3:182508544-182508566 TTCATGGTTTTGAGGAAGAAAGG - Intergenic
967968636 3:194983605-194983627 ATTAAATTCTTGAGGAAACAGGG + Intergenic
968015960 3:195333073-195333095 ATCATATCCTTGATGAAAGAAGG + Exonic
968151816 3:196343020-196343042 ATCATGTACTTGAGATAAACGGG + Intergenic
968244546 3:197130027-197130049 AACATGTTGCTGAAGAAAAAAGG + Intronic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
970452602 4:16185793-16185815 ATGATGTCCTTGAGGAAGGAGGG - Intronic
971161766 4:24140733-24140755 AGCATGTTCATGAGGAACTAGGG - Intergenic
971999170 4:34007985-34008007 ATCATATACTAGAGGAAAGAAGG - Intergenic
972014708 4:34228707-34228729 ATCATGTTCATCAGGAATATTGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972155914 4:36161679-36161701 ATCTTGTTATTGAGGAAAGCAGG - Intronic
973248263 4:48034029-48034051 ATCATAATCTTGAGGACAGATGG + Intronic
973290264 4:48464017-48464039 ACCATGTACTTGAGGAAGATGGG - Intergenic
974504806 4:62755572-62755594 ATCACGTTCTGGAGGCAGAATGG - Intergenic
974939515 4:68448865-68448887 AGCATGTACTAGAGCAAAAAAGG + Intronic
975193000 4:71488383-71488405 ATAAGGTTCTTGAAAAAAAATGG + Intronic
975386453 4:73765450-73765472 AACATGTTCTTGACAAAATAAGG + Intergenic
975426989 4:74241366-74241388 ATAATGATATTGGGGAAAAATGG - Intronic
975435847 4:74350363-74350385 ATAATGCTGTTGAGGAAAAAGGG - Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
975894670 4:79074579-79074601 ATCATGTTCTTGTGGGAACATGG + Intergenic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
977255910 4:94739834-94739856 AGCATTTTCTTGGTGAAAAAAGG - Intergenic
977265562 4:94849438-94849460 ACCGTTCTCTTGAGGAAAAAGGG + Intronic
978449262 4:108812892-108812914 ATCCTGTCCCTGAGGGAAAAGGG - Intronic
979617126 4:122756069-122756091 AAAATGTTCTTGAAGAATAATGG - Intergenic
982817595 4:159905843-159905865 AGCATGTTTTTCAGGAAGAATGG - Intergenic
982962118 4:161853067-161853089 ATCATTTACTTGAGCAAAAATGG + Intronic
983728942 4:170969604-170969626 ATCATGTTCTGGTGGAGACATGG - Intergenic
983762463 4:171428458-171428480 GATATGTTCATGAGGAAAAAGGG - Intergenic
984315459 4:178124511-178124533 ATCATGTTCTTAAGCAGTAAGGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
986274558 5:6262376-6262398 ATCATAATCTTGAGTAAAGAGGG + Intergenic
986513706 5:8538302-8538324 TTTATGTTCTTGAGGAATATTGG - Intergenic
987189027 5:15454390-15454412 ATCATGTTCTTGCAGCAACATGG - Intergenic
987298560 5:16576260-16576282 ATCTTGTTTTTGAAGATAAATGG - Intronic
987435719 5:17891655-17891677 ATTATGCTTTTGATGAAAAATGG - Intergenic
987437287 5:17910518-17910540 ATCATGTAATTGAAGAAAATTGG - Intergenic
987547196 5:19327028-19327050 ATTATGTTTTTTAGGAAAATTGG + Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
988660741 5:33265109-33265131 AGAATATTCTTCAGGAAAAAGGG + Intergenic
988668503 5:33356353-33356375 ATAATTTACTTGAGGAAAAAAGG + Intergenic
988813834 5:34812049-34812071 AACATATTCTTGAAAAAAAAAGG + Intronic
989014191 5:36910240-36910262 ATCATGTTCTAGAAAAACAAAGG - Intronic
989635483 5:43528279-43528301 ATCATGTTATGGAGGAAAAGGGG - Intronic
991115511 5:62950138-62950160 AAGATGTTATTGAGGAAGAAAGG - Intergenic
991330465 5:65487625-65487647 AACATGTTCTTAACGAAATAAGG + Intergenic
991908219 5:71534189-71534211 ATCATCTTTTAGAAGAAAAATGG - Intronic
993015824 5:82533409-82533431 ATCATGTTCTGGAGAAAACAGGG + Intergenic
993485088 5:88474160-88474182 ATTATGTTCTTGGAGGAAAAGGG + Intergenic
993671413 5:90765181-90765203 ATCATCTTCCTGAGGAGAACTGG + Intronic
995045066 5:107636677-107636699 ATCATGTTCTTGAATACAGATGG + Intronic
995953537 5:117746476-117746498 AGCATGTACTTGAGGAGTAAGGG - Intergenic
996696648 5:126404383-126404405 ATCATGTCCTTGATGCAAACTGG - Intronic
996977008 5:129447150-129447172 AACATGTTCTCAAGGAGAAACGG - Intergenic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
997769273 5:136539447-136539469 ATCATGTTTTTGCAGCAAAATGG + Intergenic
998948717 5:147369586-147369608 ATCATGTGTTTGAGGTTAAAAGG - Intronic
999342825 5:150787818-150787840 ATCCTGTGTTTGAGGAAATAAGG + Intronic
999563760 5:152834560-152834582 AAAATATTCTTCAGGAAAAAAGG - Intergenic
1003133398 6:3414686-3414708 ATCTTGGCCTTGAGGAAATAAGG - Intronic
1003766294 6:9240898-9240920 ATAGTTTTCTTGTGGAAAAATGG - Intergenic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004399591 6:15276082-15276104 ATAATGTTAATGAGGAAAAGAGG + Intronic
1005075770 6:21905393-21905415 ATCAGGTGCTTTAGGTAAAAGGG - Intergenic
1005273456 6:24191017-24191039 ATCATGTCTCTGAGGGAAAATGG + Intronic
1007276088 6:40675065-40675087 ATCATTTGCTTGAGGATAACTGG + Intergenic
1007304887 6:40896109-40896131 ATCATGTTTTGAAGGAAGAAGGG - Intergenic
1007983688 6:46185965-46185987 ATCTTGTTCTGGAGACAAAAAGG + Intergenic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1008271095 6:49491016-49491038 AGCATGTGCTTTTGGAAAAATGG + Intronic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008994794 6:57646171-57646193 AACAGGCTATTGAGGAAAAAGGG - Exonic
1009183339 6:60544968-60544990 AACAGGCTATTGAGGAAAAAGGG - Intergenic
1009521416 6:64687254-64687276 ATCATGTTCATGAGAAATATTGG - Intronic
1009866374 6:69402695-69402717 ATCATGTTCTACAGAAAGAAAGG + Intergenic
1010089921 6:71968729-71968751 ATCATGTTATTGATGCTAAAAGG + Intronic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010260892 6:73815701-73815723 ATCTTGTTAATAAGGAAAAAGGG + Intronic
1010373137 6:75134848-75134870 ATTGTGGTCTTGAGTAAAAAGGG + Exonic
1012031770 6:94078288-94078310 AACATGTTCTGGAGAGAAAAAGG - Intergenic
1013893851 6:115060941-115060963 ATCATTTACTTGAAGACAAAGGG - Intergenic
1015137359 6:129888465-129888487 ATCATATTTTTGAAGAAAATGGG - Intergenic
1015734573 6:136384881-136384903 ATCATGCTCATTAGGATAAACGG + Intronic
1015925084 6:138300759-138300781 GTCAGGATCTTGAGGCAAAAGGG + Intronic
1017813757 6:158002373-158002395 TTCATGTTCATGTGGAAATAGGG + Intronic
1017998709 6:159558632-159558654 AGGATGTACTTCAGGAAAAAGGG + Intergenic
1018091542 6:160349852-160349874 ATCAGGTACATTAGGAAAAAAGG + Intronic
1018161304 6:161045443-161045465 ATTATGTTTATGTGGAAAAATGG + Intronic
1018714873 6:166524457-166524479 ATCATGTTCATGACTAAAGATGG - Intronic
1018801905 6:167229356-167229378 ATCTTGTTTTTCTGGAAAAAAGG + Intergenic
1020528914 7:9303503-9303525 AAAATGTTATTGAGGAAAACTGG + Intergenic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1027484114 7:78738668-78738690 AGGATGTTCATGATGAAAAAAGG + Intronic
1027753723 7:82184403-82184425 ATCATGTTCTCTAGAAAAAGGGG - Intronic
1027943778 7:84719707-84719729 ATCATTGAATTGAGGAAAAAAGG + Intergenic
1028309098 7:89307903-89307925 AGTATATACTTGAGGAAAAAAGG - Intronic
1029854107 7:103495930-103495952 ATTATTCTCTTGAGGAAAATTGG + Intronic
1030459482 7:109813413-109813435 ATCACGTTCCTGTGGAAAACTGG - Intergenic
1030936133 7:115586405-115586427 TCCATGTTCCTGAGGAAGAAGGG + Intergenic
1030985168 7:116232963-116232985 GTCATTTTCTTTAGGACAAAAGG + Intronic
1032705126 7:134414777-134414799 ATGATCGTCTTGGGGAAAAAAGG + Intergenic
1035626977 8:1077788-1077810 AGCATCTTCTTGTGGAAAAGGGG - Intergenic
1035947338 8:3979918-3979940 TTCATATTATTGAGGACAAAGGG - Intronic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1038270923 8:26075166-26075188 ATCATGTCCTTGCAGAAATATGG + Intergenic
1039623709 8:39025757-39025779 AAAATGTTCTTGGGGAAAAAAGG - Intronic
1040951740 8:52944177-52944199 AGCATGTTGCTGAGGAAAGAAGG - Intergenic
1042007105 8:64193399-64193421 ATCAAGTTGTTTAGTAAAAAAGG - Intergenic
1043050121 8:75376184-75376206 GCCTTGTTTTTGAGGAAAAATGG + Intergenic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044420051 8:91984232-91984254 ATCATGTTCTCCAGGAAGAGAGG - Intronic
1044526185 8:93254033-93254055 ATTAAGTTCTTGAAGAAATAAGG + Intergenic
1045511634 8:102816213-102816235 ATGAAGATGTTGAGGAAAAAAGG + Intergenic
1045771904 8:105751689-105751711 CTCATTTTCTTAAGCAAAAAAGG + Intronic
1045835457 8:106515818-106515840 GTCATATACTTGAGGAAACATGG - Intronic
1046592391 8:116221858-116221880 ATCATGTTTCTTAGGAAAAATGG + Intergenic
1047638098 8:126788533-126788555 ATTATGTTCTTGAAGAATATCGG + Intergenic
1049112452 8:140655818-140655840 ATCATGTTGTTGTGGAGTAATGG - Intergenic
1050400807 9:5251899-5251921 AACATGCTCCTGAAGAAAAATGG + Intergenic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1051707307 9:19894102-19894124 TTTATGTTTTTGAGGAAGAAGGG + Intergenic
1051762321 9:20481341-20481363 TTCAGGTTCCTGAGGAAAATAGG - Intronic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052075810 9:24138748-24138770 AGAATGTTCATGAGAAAAAAAGG + Intergenic
1052206218 9:25844268-25844290 CTCATTATCTTGAAGAAAAAGGG + Intergenic
1053613605 9:39741190-39741212 AACATGTTCTTGAGGTACCATGG - Intergenic
1053871646 9:42499146-42499168 AACATGTTCTTGAGGTACCATGG - Intergenic
1054239909 9:62601207-62601229 AACATGTTCTTGAGGTACCATGG + Intergenic
1056748855 9:89330039-89330061 ATTATGATGTTGATGAAAAAAGG + Intronic
1057465250 9:95308179-95308201 AGTATGTTTTTGAGGCAAAATGG - Intronic
1057565788 9:96164828-96164850 ATGACGTTCTTGAGAAGAAAAGG - Intergenic
1058494209 9:105537399-105537421 ATCATTTTCCTCAGGATAAATGG + Intronic
1060737139 9:126073271-126073293 ACCATGTTCTTGGGGGTAAATGG - Intergenic
1061839528 9:133349744-133349766 CTCATGTTCTGGATGAAATAAGG - Intronic
1185814218 X:3139243-3139265 ATCATCTCTTTGAGGAATAAGGG + Intergenic
1185853266 X:3508777-3508799 ATCATGTTTTTGAAGGAACATGG - Intergenic
1187742741 X:22373899-22373921 TTCCTGTTCTTGAGTAAACATGG - Intergenic
1188132487 X:26454174-26454196 ATCATGTTCTTTATAACAAAAGG - Intergenic
1188776315 X:34223881-34223903 TACATGTGCTTGAGGAAAATAGG - Intergenic
1189079197 X:37951892-37951914 ATCATATTCTTGAGGAGGATGGG + Intronic
1189670817 X:43407031-43407053 TTCATTTTTTTAAGGAAAAATGG + Intergenic
1190861300 X:54347136-54347158 ATCATTTTATGAAGGAAAAATGG - Intronic
1191812053 X:65199751-65199773 ATCATGTTTTTGCGGAGACATGG - Intergenic
1192659261 X:73024605-73024627 ATAATTATCTTGAGTAAAAATGG - Intergenic
1193446770 X:81615397-81615419 TTGATGTTCCTGAGGAAGAAGGG - Intergenic
1193557378 X:82972576-82972598 AGAATGTTGTTCAGGAAAAATGG + Intergenic
1194103359 X:89735319-89735341 ATCATGTTCATCAGGAATATTGG + Intergenic
1194110832 X:89832354-89832376 TTCATTTTCTTGAGGAAATGTGG + Intergenic
1194292356 X:92089973-92089995 ATGATCATCTTGAGGAAAAATGG - Intronic
1195032835 X:100943352-100943374 AACATACTGTTGAGGAAAAAAGG - Intergenic
1195100155 X:101547848-101547870 ATCTTATTCTTGAAGAAAATGGG - Intergenic
1195174314 X:102300298-102300320 GTCATGTGCTTGAGGATATATGG - Intergenic
1195184551 X:102386795-102386817 GTCATGTGCTTGAGGATATATGG + Intronic
1195827479 X:109018022-109018044 GTGATGGTCTTAAGGAAAAAGGG - Intergenic
1197879235 X:131147447-131147469 ATCATGTATTTGAGGATACAGGG - Intergenic
1198440428 X:136658001-136658023 ACCATTTTATTGAGAAAAAAAGG - Intronic
1198472232 X:136957963-136957985 ATCACGTTCTTGGGAAAAAGTGG + Intergenic
1199489747 X:148385252-148385274 CACATGCTCTGGAGGAAAAATGG - Intergenic
1200422504 Y:2986548-2986570 ATCATGTCCTTGTGGCAACATGG - Intergenic
1200463493 Y:3487092-3487114 TTCATTTTCTTGAGGAAATGTGG + Intergenic
1200609864 Y:5314599-5314621 ATGATCATCTTGAGGAAAAATGG - Intronic