ID: 1091529066

View in Genome Browser
Species Human (GRCh38)
Location 12:1337114-1337136
Sequence CAGTATTAGATCAAAGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091529066_1091529071 16 Left 1091529066 12:1337114-1337136 CCTTAATCTTTGATCTAATACTG 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1091529071 12:1337153-1337175 GTCTCCCACTGTTATTGTGTGGG 0: 70
1: 1358
2: 5090
3: 4993
4: 1983
1091529066_1091529070 15 Left 1091529066 12:1337114-1337136 CCTTAATCTTTGATCTAATACTG 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1091529070 12:1337152-1337174 AGTCTCCCACTGTTATTGTGTGG 0: 79
1: 1443
2: 5271
3: 5264
4: 2011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091529066 Original CRISPR CAGTATTAGATCAAAGATTA AGG (reversed) Intronic
905608291 1:39324737-39324759 GAGTATTAAATGAGAGATTATGG + Intronic
906259374 1:44375060-44375082 CAGTATTAAATCAGAGGTCAAGG + Intergenic
910212297 1:84806009-84806031 CAATAATAGATCAAAGTTTCAGG - Intergenic
910699321 1:90056107-90056129 CATTATTAAATTAAAGATAAAGG - Intergenic
911933656 1:103938042-103938064 CAGTATGAGCTCATAGATAAGGG - Intergenic
912790488 1:112644693-112644715 CATTATTACATCAAATATTAGGG + Intronic
913168838 1:116213580-116213602 CAGTATTAGTGTCAAGATTAGGG + Intergenic
915691026 1:157690879-157690901 CAGTCTTAGAGCTAAGATTCAGG - Intronic
915815981 1:158965314-158965336 CAGTATTAGATCGATCATTCAGG + Intronic
917186012 1:172356644-172356666 CATTATTATATTAAAGTTTATGG + Intronic
917360501 1:174170139-174170161 CAGCACTAGATCAAGAATTAAGG - Intronic
917816753 1:178718539-178718561 CAGTGATAGTTCAAAGAGTAAGG + Intergenic
918925840 1:190784546-190784568 CAGTGTTAGATGAAACATTGAGG + Intergenic
919252555 1:195075950-195075972 CAGTTTTAGCTCAAGGAATATGG + Intergenic
922879991 1:228973640-228973662 CAGAATTAGATCCAAGGTGAGGG + Intergenic
923650726 1:235870724-235870746 CAGAAATAGAACAAAGATTGTGG - Intronic
1066322647 10:34319580-34319602 CAGTATTATTTGTAAGATTATGG - Intronic
1072080388 10:92023961-92023983 CAGTAATAGCTCAAATACTATGG + Intronic
1074534269 10:114317505-114317527 GATTATTGGATCAAAGAGTATGG - Intronic
1075468809 10:122672551-122672573 CAGTAGGAGATCACAGATTGAGG + Intergenic
1076980491 11:201859-201881 CTGTATTAAATCAAGGTTTAAGG + Intronic
1082913510 11:58404737-58404759 CATAGTTAAATCAAAGATTAAGG + Intergenic
1083143375 11:60739644-60739666 CAGTTTTTGATCAATGATTGAGG - Intronic
1085500944 11:77023224-77023246 CAGAAGTAAATCAAATATTATGG + Exonic
1086863837 11:91956449-91956471 CAATATTAGTTCAAAGATATGGG - Intergenic
1087137255 11:94733309-94733331 CAGTAGGAGATCACAGATAATGG - Intronic
1090678815 11:129031315-129031337 GATTATTATTTCAAAGATTATGG - Intronic
1091529066 12:1337114-1337136 CAGTATTAGATCAAAGATTAAGG - Intronic
1092575647 12:9779945-9779967 CAGTATTAGACCAATCATTAAGG - Intergenic
1094000970 12:25693668-25693690 CAGTATAAGAACAAAGGTTTGGG - Intergenic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1094215265 12:27934001-27934023 CTGTCTTAGATCACAGATCAAGG + Intergenic
1095073829 12:37892800-37892822 CAGTCTGAGATCAAAGAGCAAGG + Intergenic
1099497954 12:83376284-83376306 CAGTATTAGATAGAACATTGAGG - Intergenic
1100093804 12:91006700-91006722 GAGTACTAGATCAAATATTGAGG - Intergenic
1100734339 12:97510657-97510679 CCCTATGTGATCAAAGATTATGG - Intergenic
1101171105 12:102094915-102094937 AAATATTAGATAAAAGTTTATGG - Intronic
1102338015 12:112098902-112098924 AAGTATTAGAAAAGAGATTAGGG - Intronic
1106500877 13:30327681-30327703 CAGTATTAGAGCAATGCCTAAGG - Intergenic
1107155342 13:37160155-37160177 CAGCATTAGATAAATCATTAAGG - Intergenic
1107956206 13:45514532-45514554 CAGAATTAGATAAAAGAGGATGG - Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1109110132 13:58306684-58306706 CAAAATTAAATCAAAAATTATGG - Intergenic
1109347457 13:61132033-61132055 CAGCATTAGGTCCAAAATTAAGG - Intergenic
1109598854 13:64596205-64596227 CAGTATTAGATAGAACATCAAGG + Intergenic
1109832259 13:67806225-67806247 CAGTATGAGATCAAATGTTAAGG + Intergenic
1111053849 13:82921984-82922006 CATTATTAAATAAAAGATAAAGG + Intergenic
1111083119 13:83337992-83338014 CAGTATTAGATGAAACATAATGG - Intergenic
1111122463 13:83871677-83871699 CAGGTTAAGATAAAAGATTATGG - Intergenic
1111135355 13:84034705-84034727 CAGTAATAGATGTCAGATTATGG + Intergenic
1112996602 13:105581820-105581842 CCATATTAGATGAAAGATTGTGG - Intergenic
1115231177 14:31162333-31162355 AAATATAAGATAAAAGATTAGGG + Intronic
1116711348 14:48371985-48372007 CAGTCTGAGATCAAACAGTAAGG - Intergenic
1117138526 14:52762746-52762768 CTGAATTAGATAAAACATTATGG - Intronic
1124985038 15:34600028-34600050 AAGTATTAGATCTGAGATCAGGG + Intergenic
1129981117 15:79872281-79872303 CAGAATTAGATCAGAGAAAATGG - Intronic
1130164630 15:81440747-81440769 CAGTATTACAGGAACGATTAGGG - Intergenic
1131821689 15:96280365-96280387 CATTATTGGATCAAAGATTATGG - Intergenic
1137507912 16:49071629-49071651 CAGTAATAGCACAAAGATTGGGG - Intergenic
1138667906 16:58587701-58587723 CATTATGAGATCAAGGCTTAGGG + Intronic
1138877654 16:60972388-60972410 CAGTTTTAGATCATAAATTCAGG - Intergenic
1139734249 16:68973627-68973649 CAATATTAGATCTAAGCTCATGG - Intronic
1145972859 17:28967084-28967106 CAGTATTACATCCAAGGTTGTGG + Intronic
1150529712 17:65964275-65964297 GAATATTAGCTCAAAGATAATGG + Intronic
1151375168 17:73683534-73683556 CAGAATTACAGCAAAGAGTAGGG - Intergenic
1153044797 18:845992-846014 CATTATTAATTCAAAGAGTAAGG + Intergenic
1153221910 18:2868989-2869011 AGGTATTGGATCAATGATTAAGG - Intronic
1155283687 18:24267087-24267109 CAGTATTAGAAAAAAGAAAATGG + Intronic
1156782452 18:40867095-40867117 CAAAATATGATCAAAGATTAAGG + Intergenic
1158124633 18:54087577-54087599 CAGTCTTTGATGAAAGATAAAGG + Intergenic
1158185531 18:54767209-54767231 GAGTATTAGAGCAAACATTTAGG - Intronic
1159266453 18:66086888-66086910 AAGTATTAAATCAGAGACTATGG + Intergenic
1162072777 19:8164672-8164694 CAGGTTCAGATAAAAGATTATGG - Intronic
1163881154 19:19923646-19923668 CAGTCTGAGATCAAACTTTAAGG - Intronic
1163942977 19:20512115-20512137 CAGTTTTTTAACAAAGATTAAGG - Intergenic
931509458 2:62974780-62974802 AAGAACTAGATCAGAGATTAGGG - Intronic
936834941 2:116697963-116697985 CAGTATTGGAGCAAAGCTCAGGG + Intergenic
937269106 2:120636518-120636540 CAGAAAAAGAACAAAGATTATGG - Intergenic
937516768 2:122664321-122664343 CAGTCTTAGTTCATATATTAAGG + Intergenic
939330250 2:140750188-140750210 CAGTATTAGATGAGGCATTAGGG - Intronic
940631420 2:156244334-156244356 AAGTATCAAATCAAAGATTGGGG - Intergenic
942823691 2:180147693-180147715 CAATATTACACCAAAGATAATGG + Intergenic
943862317 2:192883261-192883283 CAGCTTTAGATCAAAGAGGAAGG - Intergenic
945193333 2:207213244-207213266 GAGTATCAGATGAAAGATCAGGG - Intergenic
946111876 2:217427014-217427036 CAGTGTTATTTCAAAGACTATGG + Intronic
1174730067 20:52907419-52907441 CAGTCTTACATCAAAGCTCAGGG - Intergenic
1174956237 20:55101916-55101938 CAGTTTAAGATAAAAGATTGTGG + Intergenic
1177187746 21:17817199-17817221 CAGTATGTGATGGAAGATTATGG - Intronic
1178419547 21:32432645-32432667 CTGTTTTAGATGAAGGATTACGG - Intronic
1182920009 22:34070522-34070544 AAGTTTTAGATAAAAGATTATGG - Intergenic
953521884 3:43650621-43650643 CAGGATTAGAGCAGAGCTTAGGG + Intronic
956876073 3:73464631-73464653 CATTATTAAAACAAAGATAAAGG + Intronic
958174609 3:89980603-89980625 AAGTATTTGCTCAAAAATTAAGG - Intergenic
958810408 3:98854401-98854423 CAGTATAAGAGAAATGATTATGG - Intronic
959794042 3:110401168-110401190 CAGTCAGAGATTAAAGATTAGGG + Intergenic
959881633 3:111449982-111450004 CAGTATTAGACCTAAAATTGAGG + Intronic
962178548 3:133180967-133180989 CAGTACAACATGAAAGATTAGGG - Intronic
962290835 3:134135021-134135043 CAGTTTTTGCTCAAAGATTTGGG + Intronic
963665068 3:148173713-148173735 CAGTATGAGATGAGAGATAAGGG - Intergenic
964363099 3:155918955-155918977 GAGAATTAGATCAGAGATGATGG + Intronic
964800004 3:160545982-160546004 CACTTTTAGATCTAAGTTTAAGG + Intronic
965075788 3:163973879-163973901 CTGTGTGAGATCAAAGAATAGGG + Intergenic
965599653 3:170442291-170442313 CAGAAATAGATCAAGGATTAGGG + Intronic
967544190 3:190704137-190704159 CATTATGACATCAAAGATTGAGG - Intergenic
970036399 4:11740357-11740379 CAGTAATATATGAAAGATTCAGG + Intergenic
971987749 4:33848053-33848075 CAGTATTAGACCAATCATCAAGG + Intergenic
973065575 4:45786541-45786563 CTGTATTAGATACATGATTATGG - Intergenic
975509123 4:75172883-75172905 CTGTATTAGACCCTAGATTAGGG - Intergenic
977971770 4:103221050-103221072 CAGTATTAGACCAATCATTGAGG + Intergenic
979294979 4:119021926-119021948 CAGTAAGAGATCAAAGACCAAGG - Intronic
980323436 4:131308904-131308926 CAGTGTTAGAATAACGATTAGGG - Intergenic
980820927 4:138016139-138016161 CAGAATTAAGTCAAAGATTTAGG - Intergenic
985330678 4:188829191-188829213 GAGTATGAGATCAAACATGAAGG + Intergenic
986373199 5:7101690-7101712 CAGTCTTAGATGAAAGACTTTGG - Intergenic
987131712 5:14866422-14866444 CAGTATTACTTAAAATATTAAGG - Intronic
987172363 5:15271796-15271818 CAGTCTGAGATCAAACAGTAAGG + Intergenic
987796070 5:22628178-22628200 CATTATTAGATCAACCATCAAGG + Intronic
988203052 5:28094290-28094312 CAGTATTACAGCTAAGATGAAGG + Intergenic
989214238 5:38887671-38887693 CAGTTTTACATAAAAGAGTATGG - Intronic
989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG + Intergenic
990184455 5:53198826-53198848 CAGGTTCAGATCAAGGATTATGG + Intergenic
991616997 5:68507390-68507412 CATCATTAAATCAAAGATCAAGG - Intergenic
993983786 5:94573226-94573248 CAGGTTAAGATAAAAGATTATGG + Intronic
993989965 5:94643991-94644013 AAGTATTAGATAAAACATAATGG - Intronic
996478321 5:123946357-123946379 CAGGTTAAGATCAAAGATTGTGG - Intergenic
997728269 5:136141029-136141051 TAGTATTGGATTAGAGATTAGGG + Intronic
999076363 5:148799524-148799546 CTGTATTAGATCTAAAATCAAGG - Intergenic
999885982 5:155923383-155923405 TAGTATTAGACAAAAGATCAGGG - Intronic
1000387248 5:160686380-160686402 CAGTATCACCTCAAACATTATGG + Intronic
1005248154 6:23912711-23912733 CAGCATTAGAGCAAAAATTAAGG - Intergenic
1007798756 6:44373725-44373747 CAGAATTAGAATAAAAATTAGGG + Intronic
1008072924 6:47116034-47116056 TAGCACTAGATCAAAGATGAAGG + Intergenic
1008371555 6:50737406-50737428 CAGAATTAAATCTAAGAATAAGG + Intronic
1009365041 6:62851456-62851478 CAGTATTAGAAACAATATTATGG - Intergenic
1011468728 6:87686584-87686606 CATTACTAGATCAAACATTACGG + Intronic
1012442627 6:99275705-99275727 CAGTCTCATCTCAAAGATTAAGG + Exonic
1012570286 6:100717295-100717317 CAGTAATACATTAAAGACTAAGG + Intronic
1013834611 6:114318879-114318901 CATTCTTAGAAAAAAGATTATGG - Intronic
1015657695 6:135538374-135538396 CAGTATTAGAAAAAAAATTGTGG + Intergenic
1017604196 6:156115888-156115910 CAGTATTAGCCCAGAGCTTAAGG - Intergenic
1018197439 6:161367493-161367515 CAGTATGTGCTCAAAGGTTATGG + Intronic
1021439985 7:20666849-20666871 CAGAATTAGTGTAAAGATTAGGG - Intronic
1024592338 7:50899238-50899260 CAGTCTGAGATCAAACTTTAAGG + Intergenic
1026274765 7:68866972-68866994 CAGGTTAAGATAAAAGATTAGGG - Intergenic
1027689850 7:81330925-81330947 CAGTATTAGGTAACTGATTAAGG + Intergenic
1039672296 8:39615030-39615052 CAGCATTAGACAAAATATTAAGG + Intronic
1043217699 8:77615881-77615903 CAGTATTAGAAAAATGTTTAAGG - Intergenic
1045980270 8:108178217-108178239 TCTTATTAGATCAAAGTTTATGG + Intergenic
1046152633 8:110247751-110247773 CAGTATTAGATAGAACATTGAGG + Intergenic
1046152676 8:110248818-110248840 CAGTATTAGATAGAACATTGAGG - Intergenic
1047098622 8:121651555-121651577 CAGTAGTAGGTCAGAGATTCAGG + Intergenic
1048865023 8:138754333-138754355 CAATTTTATATCAAAGATTTTGG - Intronic
1049501431 8:142969499-142969521 CAGTATTGAATCAAGGTTTAAGG - Intergenic
1050920453 9:11195537-11195559 CATTATTAGATCAAAGGAGAAGG - Intergenic
1051766236 9:20527099-20527121 CAGTGTAAGATCAAAGGGTAAGG + Intronic
1053546844 9:39032161-39032183 CAGTATCAGACAAAATATTATGG + Intergenic
1053811162 9:41853814-41853836 CAGTATCAGACAAAATATTATGG + Intergenic
1054619432 9:67333625-67333647 CAGTATCAGACAAAATATTATGG - Intergenic
1058037442 9:100268224-100268246 CAGGATTAAAAAAAAGATTATGG + Intronic
1059633543 9:116151147-116151169 CAGTCATAGATCAAGGGTTAGGG + Intergenic
1061740235 9:132698250-132698272 CACTATCAGATCAGCGATTATGG + Intergenic
1185717184 X:2352192-2352214 CAGGATTATATCATAGTTTAGGG - Intronic
1188832824 X:34921485-34921507 CAGTTTAATATCAAATATTAAGG - Intergenic
1190052721 X:47163073-47163095 CATGATTAGACCTAAGATTATGG - Intronic
1191114875 X:56841903-56841925 CAGTCTGAGATCAAACTTTAAGG - Intergenic
1191642507 X:63442577-63442599 CAGGTTAAGATAAAAGATTATGG - Intergenic
1196266663 X:113656698-113656720 CATTATTAGATTAAAGTTTTGGG - Intergenic
1200215368 X:154365900-154365922 CAGTAGAAGCTCAAAGAGTAGGG + Intronic
1201461283 Y:14227785-14227807 AATTATTAGATCAAAGTATATGG + Intergenic
1202033703 Y:20607951-20607973 CAGTATTAGACCAGTTATTAAGG - Intergenic