ID: 1091532965

View in Genome Browser
Species Human (GRCh38)
Location 12:1377220-1377242
Sequence ACTGTTCACTAGAGAGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091532965_1091532967 -5 Left 1091532965 12:1377220-1377242 CCGTCCACTCTCTAGTGAACAGT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1091532967 12:1377238-1377260 ACAGTTTTCAGTCTCTCTTGTGG 0: 1
1: 0
2: 2
3: 28
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091532965 Original CRISPR ACTGTTCACTAGAGAGTGGA CGG (reversed) Intronic
904706254 1:32393309-32393331 ATTAATCACCAGAGAGTGGAAGG - Intronic
904966428 1:34377936-34377958 AGTGTTCAGTAAAGAGTGGCTGG + Intergenic
905472627 1:38205134-38205156 ACTGTTGCATAGAGAGGGGAAGG + Intergenic
907281208 1:53348603-53348625 ACTGTTCACAAGAGAGGGCATGG + Intergenic
909178732 1:72392891-72392913 ACTGACTACTAGAGAGTGGAGGG + Intergenic
909204521 1:72738426-72738448 GCTGTTCTCTTGAGAGTGAATGG - Intergenic
909357992 1:74731563-74731585 TCTGTTCACTTGAGATAGGACGG + Intronic
910329045 1:86047946-86047968 ACTGTTGACTTGAAAGTGAATGG - Intronic
914415064 1:147472041-147472063 ACAATTCTCTAGAGAGGGGAAGG + Intergenic
917249082 1:173037792-173037814 AATGTTTACAAGTGAGTGGAGGG - Intergenic
921715174 1:218410417-218410439 ACTGTTCTGTAGAGAGGGGAGGG - Intronic
923312129 1:232745341-232745363 ACTGCTCACTTCAGGGTGGAAGG - Intergenic
924079492 1:240379232-240379254 ACTGATCACAAGAGACAGGATGG - Intronic
1074874694 10:117604620-117604642 AATGTTCAGTTGAGAATGGAGGG + Intergenic
1076190503 10:128479893-128479915 ACTTTTCACTACAGACTGGGAGG + Intergenic
1083519639 11:63296345-63296367 AGATTTCACTAGAGTGTGGAAGG - Intronic
1083603668 11:63963912-63963934 AGTGTTCTCTAGATAGTGGCGGG - Intergenic
1084047355 11:66576968-66576990 AATTTTTACAAGAGAGTGGAGGG + Intergenic
1084431945 11:69116087-69116109 GCTGCTCTCTGGAGAGTGGACGG - Intergenic
1090796821 11:130142480-130142502 ACTGTTCACTAAGGAGTGAGTGG - Intronic
1091532965 12:1377220-1377242 ACTGTTCACTAGAGAGTGGACGG - Intronic
1092549491 12:9482474-9482496 ACTCTTTACTAGACTGTGGATGG - Intergenic
1092995974 12:13951010-13951032 AATGTTCACAAGGGAGTGGGAGG - Intronic
1093125534 12:15323216-15323238 ATTATACACTGGAGAGTGGAGGG + Intronic
1093818878 12:23586323-23586345 ACTATTCCCAAGAGAGTGGTAGG + Intronic
1093911011 12:24747587-24747609 ACACCTCACAAGAGAGTGGAGGG + Intergenic
1094521772 12:31198671-31198693 ACTCTTTACTAGACTGTGGATGG + Intergenic
1099964768 12:89433852-89433874 AATGTTGACTAAGGAGTGGATGG + Intronic
1103861172 12:124015550-124015572 ACTGAGCACTTGAGAGTGAAGGG + Intronic
1104288388 12:127446451-127446473 CCTGTGCACCAGAGAGTGCAAGG + Intergenic
1105490144 13:20880590-20880612 AATGTTCACTAAAGAATGAATGG + Intronic
1106506304 13:30373544-30373566 ACAGCCCACTGGAGAGTGGAGGG - Intergenic
1106890806 13:34243562-34243584 ACTGTTCATTAGAGGCTGGAGGG + Intergenic
1110764731 13:79269766-79269788 ACTGTTCGCTAGACAATGGCTGG + Intergenic
1112320037 13:98397414-98397436 ACTGTTCACCAGAGTGTGAATGG - Intronic
1121323451 14:93006304-93006326 TCTGTTCACCAGGGAGGGGATGG - Intronic
1122259584 14:100506070-100506092 ACTGTGGTCTAGAGGGTGGAGGG - Intronic
1122531445 14:102430413-102430435 AGTGTACACTGGAGACTGGAGGG - Intronic
1125527050 15:40383167-40383189 ACTGGGCCCGAGAGAGTGGAGGG - Intronic
1126063286 15:44804613-44804635 AGTGTTCCCTACAGGGTGGAGGG + Intergenic
1127259958 15:57320170-57320192 ACTGCTCTCTAGAGAGCTGATGG + Intergenic
1134530176 16:14976362-14976384 ACTTGTCACTGGAGAGTTGAAGG + Intronic
1138821913 16:60270834-60270856 ACTTTTCATTAGAGACTGTAAGG - Intergenic
1139866170 16:70064592-70064614 ACTTGTCACTGGAGAGTTGAAGG - Intergenic
1145017810 17:19410535-19410557 GCTGTGCACTGGGGAGTGGAAGG + Intergenic
1146684448 17:34831658-34831680 TCAGTGCACGAGAGAGTGGAAGG + Intergenic
1147905814 17:43822407-43822429 ACTGTTGAGCAGAGAATGGAAGG - Intronic
1151179207 17:72313521-72313543 GCTGTCCACAAGAGAGGGGATGG - Intergenic
1156069993 18:33195639-33195661 ACTGTTCAATAGTCTGTGGAAGG - Intronic
1156362579 18:36397286-36397308 TCTGTTCAGCAGAGAGTAGAGGG - Intronic
1157837608 18:50921307-50921329 TCTGTTGAAAAGAGAGTGGAAGG - Intronic
1158225516 18:55197220-55197242 ACTTTTCACTGAAGAGTTGAAGG - Intergenic
1158587688 18:58755813-58755835 ACTGGCCAACAGAGAGTGGAGGG + Intergenic
1160476983 18:79200257-79200279 ACATTTCAGTAGACAGTGGATGG - Intronic
1163214870 19:15869036-15869058 ATTGGTCATTAGAGAGGGGAAGG + Intergenic
1164048429 19:21563002-21563024 ACTTTGGAGTAGAGAGTGGAAGG + Intergenic
1165323328 19:35099631-35099653 ACTGTGCACTGGAGGGTGCAGGG - Intergenic
1166623857 19:44331698-44331720 ACTGTTCACTTGGCAGTGAAAGG - Intronic
927693047 2:25221916-25221938 CCTCTTCTCTAGACAGTGGAGGG - Intergenic
945518441 2:210792738-210792760 ACTGTACAGTAGAGAAAGGAAGG - Intergenic
1169103719 20:2975740-2975762 CCTGGTCACTAGAGAGTAGGGGG + Intronic
1169215109 20:3789053-3789075 AATGGTCACTTGAGAGGGGATGG - Intronic
1169485562 20:6028301-6028323 TATGTTAATTAGAGAGTGGAAGG + Intronic
1169858899 20:10131773-10131795 ACTGCTCTCTAGAGAGAGGCAGG - Intergenic
1170714789 20:18822299-18822321 ACTGTGCACAACAGTGTGGATGG - Intronic
1173325460 20:42028971-42028993 ACTGATTGCTAGATAGTGGAGGG + Intergenic
1173804417 20:45914539-45914561 ACTGTTCATGGAAGAGTGGAAGG + Intergenic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1174212440 20:48890534-48890556 AGTGTTCAAGAGAGATTGGAAGG + Intergenic
1174920260 20:54694553-54694575 ACTGTTCTCCTGAGAGTGAACGG - Intergenic
1177914511 21:27072017-27072039 ATTGTACACTAGAGACTAGATGG - Intergenic
1178216428 21:30604467-30604489 ACTGCTTATCAGAGAGTGGAAGG + Intergenic
1179218792 21:39388818-39388840 GCCGTTCCCTGGAGAGTGGACGG + Intronic
1179445743 21:41429003-41429025 GCTGTGCAGTAGCGAGTGGATGG + Intronic
1179449444 21:41458492-41458514 ACAGTTCACGGGAGGGTGGAGGG - Intronic
1184888942 22:47367768-47367790 TCTGTTCAGTAGAGAAAGGATGG + Intergenic
949361787 3:3240311-3240333 ACTGTTCAGAAGAAGGTGGAAGG + Intergenic
954329863 3:49884159-49884181 ACTGTTCTCTGGAGCCTGGAGGG - Intergenic
955788066 3:62560774-62560796 AATGTTCCTTAAAGAGTGGATGG + Intronic
955977307 3:64490927-64490949 ACTGATCCCTAGAGAAGGGAAGG - Intergenic
956231147 3:67018305-67018327 CCTGCTCACTAGGGAGTGGGAGG - Intergenic
957398613 3:79678150-79678172 ACTGGTCATTAAAGAATGGATGG + Intronic
959105293 3:102058587-102058609 TGTGTTCAGTATAGAGTGGATGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961167820 3:124775861-124775883 TCTGGGCACCAGAGAGTGGACGG - Intronic
961802967 3:129466969-129466991 ACTGCTGACTTCAGAGTGGAAGG - Exonic
965051189 3:163649773-163649795 ACTGTTCACAAAAGGTTGGAGGG - Intergenic
965709572 3:171543805-171543827 AATGTTAGCTAGAGAGTGGTGGG + Intergenic
966132356 3:176655606-176655628 ATTGCTCATTAGAGAGTCGAAGG + Intergenic
966329380 3:178793983-178794005 AGGGTTCATTAGTGAGTGGATGG + Intronic
966500082 3:180629444-180629466 ACTAGTCAATAGAGAGTCGAAGG + Intronic
967414162 3:189198223-189198245 ACTGTACACTAGAGGGTAGGTGG - Intronic
972259384 4:37393005-37393027 GCTGTTCACTTGAGTGTGGCTGG - Intronic
977921730 4:102652258-102652280 AATGATTACTAGAGGGTGGAAGG - Intronic
979002879 4:115247975-115247997 ACAGTTCAATATAGAATGGAGGG - Intergenic
979917708 4:126458081-126458103 ACTGTTGACTAAAGAAAGGAAGG - Intergenic
982895234 4:160912772-160912794 ACTTTTCATTATAGAGTGAAAGG - Intergenic
987473887 5:18366728-18366750 AGTGTCTAGTAGAGAGTGGATGG - Intergenic
988666341 5:33332225-33332247 ATTGTTGACTAGAGAATGGATGG - Intergenic
990188985 5:53237065-53237087 TTTGTTCACTGGAGAGTGGTTGG + Intergenic
990815522 5:59780839-59780861 ACTGAGCCCTAGAGAGTGGTTGG - Intronic
991250620 5:64557386-64557408 ATCGTTCATTAGAGAGTGGGAGG - Intronic
997463882 5:134073639-134073661 AATGTTCATCAGAGAGAGGATGG + Intergenic
997794966 5:136800037-136800059 ACTATTTATAAGAGAGTGGATGG + Intergenic
1000228980 5:159297572-159297594 ACTGTTCTCTTGATAGTGAATGG - Intergenic
1003905822 6:10698795-10698817 ACATTTCCCTAGAGAGAGGAAGG + Intronic
1012036552 6:94148850-94148872 AGTGCTCAATAGAGATTGGAGGG + Intergenic
1013179259 6:107704527-107704549 ATTGTTCAGTACTGAGTGGATGG - Intronic
1015130782 6:129806780-129806802 ACCTGTGACTAGAGAGTGGAAGG - Intergenic
1015469938 6:133592880-133592902 ACTGTTCTCTAAAAAGAGGAAGG - Intergenic
1017013931 6:150084723-150084745 ACACTTCACTAGAAAGTGGAAGG + Intergenic
1022172561 7:27843949-27843971 ACTGTTCTCAAGAGAGAGCAAGG - Intronic
1023143967 7:37130496-37130518 ACTGGTCACTAGAGAGTGTCAGG + Intronic
1023839157 7:44086180-44086202 ACTGTACTCTGGAGAGGGGATGG - Intergenic
1027370229 7:77501372-77501394 CCTGTTCATGAAAGAGTGGAAGG - Intergenic
1028122482 7:87071756-87071778 ACTGTTCACTCCATAATGGAGGG + Intergenic
1028873322 7:95792920-95792942 ATTGTGAACTAGGGAGTGGAAGG + Intronic
1029303136 7:99600060-99600082 CCTCATCACTGGAGAGTGGAGGG + Intronic
1035477465 7:159153370-159153392 ACTGTGCATTAGAGCCTGGAGGG + Intergenic
1037297861 8:17420217-17420239 ACTGTCCACTGGAGAATGAATGG - Intergenic
1037338183 8:17812534-17812556 ACTGTATAATAGAAAGTGGAGGG - Intergenic
1037774078 8:21821257-21821279 ACTGTGCATTACACAGTGGAGGG + Intergenic
1039185849 8:34915501-34915523 GCTGTTCACTTGATAGTGAAGGG + Intergenic
1040010259 8:42655707-42655729 ACTGTTAACTAGACTGTAGATGG + Intergenic
1040979783 8:53234494-53234516 AATGTTTAGTAGAAAGTGGAGGG - Intronic
1045523614 8:102924727-102924749 ACTGTTTAATATAGACTGGAGGG + Intronic
1045643119 8:104273500-104273522 ATTGTTCACTAGCGAGCGGTGGG + Intergenic
1046061686 8:109147643-109147665 ACTTTTCTCAAGAGAGTGAAAGG + Intergenic
1047403908 8:124569077-124569099 ACTCTCCACTAGAGAGTCAAAGG - Intronic
1047477169 8:125244330-125244352 TCTGTTCATTAAAGAGAGGAGGG + Intronic
1050268172 9:3913325-3913347 ACTGTTGAGTATAGAATGGATGG - Intronic
1050311872 9:4361490-4361512 ACTATTGATTAGAGAATGGAAGG - Intergenic
1052207785 9:25864561-25864583 AATATTCACTAAAAAGTGGAAGG + Intergenic
1053260056 9:36654751-36654773 AATGTTCATTAGGGAGTAGATGG - Intronic
1056643702 9:88391829-88391851 ACTGTTGACTAGACCGCGGATGG - Intronic
1062206268 9:135339161-135339183 ACTGTGCACTAGAGAGTGAGAGG + Intergenic
1185513442 X:679480-679502 ACTCTGCATTAGAGACTGGAAGG + Intergenic
1187476164 X:19612998-19613020 ACTGTTCAGTAGATGTTGGAGGG - Intronic
1188264262 X:28051515-28051537 ACTGTTCCCTAGACAGTGCTTGG + Intergenic
1188937100 X:36190095-36190117 ACTGTTCACCTGGGAGTGAAAGG + Intergenic
1189554425 X:42127319-42127341 CCTGTTCACTAGAGAGCTGGGGG - Intergenic
1192369599 X:70502280-70502302 TCTGTTCACAAGAGAATGGTTGG - Exonic
1195002992 X:100660107-100660129 AATGTAAACTAGAGAGAGGAAGG - Intronic
1197235971 X:124063934-124063956 ACTCTTCATTACAGAGTGCATGG - Exonic
1197654169 X:129098380-129098402 ACTCTGGACTAGAGGGTGGAGGG - Intergenic
1199429493 X:147743028-147743050 ACCTTTCACTAAAGGGTGGAGGG + Intergenic
1199731613 X:150638327-150638349 ACTAGTCACTAGAGTATGGATGG + Intronic
1199806192 X:151302870-151302892 ACTTTTCACCAGGGAGAGGATGG + Intergenic
1200884430 Y:8253877-8253899 TCTGTGCACTAGAGAGTGTCCGG + Intergenic