ID: 1091534362

View in Genome Browser
Species Human (GRCh38)
Location 12:1391591-1391613
Sequence CAGGGAAAGCCGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 529}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091534362_1091534369 -2 Left 1091534362 12:1391591-1391613 CCTGCCTCCCTCGGCTTTCCCTG 0: 1
1: 0
2: 5
3: 40
4: 529
Right 1091534369 12:1391612-1391634 TGACACCTTCCAGTGGAGCAAGG 0: 1
1: 0
2: 1
3: 17
4: 158
1091534362_1091534371 3 Left 1091534362 12:1391591-1391613 CCTGCCTCCCTCGGCTTTCCCTG 0: 1
1: 0
2: 5
3: 40
4: 529
Right 1091534371 12:1391617-1391639 CCTTCCAGTGGAGCAAGGAGAGG 0: 1
1: 0
2: 4
3: 72
4: 574
1091534362_1091534366 -9 Left 1091534362 12:1391591-1391613 CCTGCCTCCCTCGGCTTTCCCTG 0: 1
1: 0
2: 5
3: 40
4: 529
Right 1091534366 12:1391605-1391627 CTTTCCCTGACACCTTCCAGTGG 0: 1
1: 0
2: 2
3: 26
4: 300
1091534362_1091534373 27 Left 1091534362 12:1391591-1391613 CCTGCCTCCCTCGGCTTTCCCTG 0: 1
1: 0
2: 5
3: 40
4: 529
Right 1091534373 12:1391641-1391663 TGAAGCACCTCCTCACAACCTGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091534362 Original CRISPR CAGGGAAAGCCGAGGGAGGC AGG (reversed) Intronic
900119882 1:1044020-1044042 CAGGGTAGGCCGGGGGACGCTGG + Exonic
900123756 1:1060427-1060449 CAGGGAGCGCCGAGGGGGGCCGG + Intergenic
900169551 1:1259897-1259919 CAGGGAAAGTGGAGAGAGACTGG - Intronic
900192613 1:1357879-1357901 CAGGGAAAGTGGAGAGAGACAGG - Intronic
900270576 1:1785216-1785238 CAGGGACAGCTTAGGGAAGCGGG + Intergenic
900279857 1:1859706-1859728 GTGGGAAAGAAGAGGGAGGCAGG + Intronic
900287691 1:1909305-1909327 CGGGGAAAGGCGGGGGAGCCCGG - Intergenic
900528688 1:3142116-3142138 CGGGGGGAGCCGATGGAGGCTGG - Intronic
900542074 1:3208041-3208063 CTGGAACAGCCTAGGGAGGCCGG - Intronic
900563988 1:3323498-3323520 CCTGGAAAGCCCAGGGAGGCCGG + Intronic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
901040190 1:6358874-6358896 CAGAGAAAGGCGAGGGAGCAGGG + Intronic
901192635 1:7421754-7421776 AAGGGAAAGACCAAGGAGGCAGG + Intronic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902624707 1:17669907-17669929 CAGGGAAAGCCCAGGGGAGGCGG + Intronic
903304252 1:22401500-22401522 CAGGGGTAGCCGAGAGGGGCCGG - Intergenic
904035693 1:27557344-27557366 CAGGGAAGGCCTAGTGGGGCTGG - Intronic
904330545 1:29755517-29755539 GAGGGAGACCCCAGGGAGGCAGG + Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
905016208 1:34780641-34780663 CAGGGACTCCCAAGGGAGGCTGG + Intronic
905312696 1:37061226-37061248 CAGAGAGAGCCCAGGGTGGCAGG - Intergenic
905499957 1:38428359-38428381 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
906146540 1:43563964-43563986 CAGGGAAACCCGAGGAAGGAGGG + Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906445093 1:45889427-45889449 CTCGGAAGGCCGAGGAAGGCAGG - Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906763743 1:48407239-48407261 AAGTGAAAGCCAAGGGAGACTGG - Intronic
907255021 1:53172763-53172785 GAGGAAAAGCCGAGGGATGGAGG - Intergenic
907714846 1:56917074-56917096 GATGGATAGCGGAGGGAGGCAGG - Intronic
908610219 1:65849639-65849661 GAGGGAATGCCAAGGGAAGCTGG + Intronic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
915341598 1:155179535-155179557 AAGGGAAAGCAGCGGGAGCCGGG - Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
917579735 1:176363433-176363455 AAGGGAAATCCCAGGGTGGCTGG + Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
919944374 1:202308888-202308910 CATTGAATGCCGAGGGAGGAGGG - Intronic
920574638 1:207050644-207050666 CAGGGAAAGTCCCGGGAGGATGG - Intronic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
922537362 1:226391107-226391129 CAGGCAAGGCCGAGGTAGGAGGG - Intronic
922703711 1:227777788-227777810 CTGGGACATCCAAGGGAGGCTGG - Intronic
922764711 1:228150843-228150865 CAGGGACAGCCTTAGGAGGCTGG + Intronic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923503881 1:234589273-234589295 CACAGAAAGCCAAGGGAGGGAGG - Intergenic
923679523 1:236108290-236108312 CAGGGAAAGTCCAGAGAGGCAGG + Intergenic
924265121 1:242273897-242273919 CTGGGAGAGCCGAGGAATGCTGG + Intronic
1063160174 10:3413010-3413032 CAGGAAAAGCCGAGGACGGACGG - Intergenic
1063212312 10:3891984-3892006 CATGGGAAGCCAAGGTAGGCAGG + Intergenic
1063571180 10:7215754-7215776 CAGGGAAGGAGGAGGGAAGCAGG - Intronic
1063927101 10:10991068-10991090 CAGAGAAAGCCGAGTTTGGCGGG + Intergenic
1065305477 10:24364588-24364610 CAGGGAAGGCCCCGGGATGCTGG - Intronic
1065437802 10:25719737-25719759 AAGTGAAAGCGAAGGGAGGCTGG - Intergenic
1065933272 10:30497971-30497993 CAGGGAAAGCAAGGGAAGGCAGG - Intergenic
1066653644 10:37680991-37681013 CTGGGAAAGCCGGGGAAGCCAGG - Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1070799557 10:79237191-79237213 CAGAGTAAGCCGAGGGGGACTGG + Intronic
1071295640 10:84217259-84217281 CAGGGAAAGAGCTGGGAGGCAGG + Exonic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1073911221 10:108347054-108347076 GAGGGAAAGAGGAGGGAGGAAGG + Intergenic
1074504807 10:114060149-114060171 CAGGGAAACCCCAGGTAGGCTGG + Intergenic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1075687585 10:124375315-124375337 CAGGGATAGCCGCAGGTGGCTGG + Intergenic
1075729499 10:124627810-124627832 CTGGGAAGCCCTAGGGAGGCCGG - Intronic
1075806391 10:125192157-125192179 CAGAGAAAGCCCAGGTAGGCAGG - Intergenic
1075991304 10:126841198-126841220 CAGGCTAAGCCTGGGGAGGCTGG - Intergenic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1076307610 10:129476031-129476053 GAATGAGAGCCGAGGGAGGCAGG - Intronic
1076371601 10:129959293-129959315 GAGGGCAGGGCGAGGGAGGCCGG + Intronic
1076564276 10:131387368-131387390 CAGGGATGGCCGAGGGGAGCCGG - Intergenic
1077020491 11:415109-415131 CAGGAAGAGCCGGGGCAGGCGGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077487004 11:2843570-2843592 CAGGGACAGGCGGGAGAGGCCGG - Intronic
1079333176 11:19549974-19549996 CAGCAGAAGCCGGGGGAGGCTGG - Intronic
1079930513 11:26554086-26554108 CAGGGGAAGGTCAGGGAGGCAGG - Intronic
1080662887 11:34311842-34311864 CAGAGAAAGCCAATGGGGGCCGG + Intronic
1081831594 11:46120347-46120369 GAGGGACAGCCGAGGGGGGGCGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083158523 11:60840592-60840614 CAGGGCAAGCCAAGGGGGACTGG + Intergenic
1083227539 11:61294521-61294543 CAGGGAAAGCCCCGCGCGGCAGG + Intronic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1083759904 11:64810136-64810158 CAAGGCAAGCCGGGGGAGGGAGG + Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084611425 11:70205580-70205602 CAGGGAAGGCCGTGTGAGCCTGG - Intronic
1084613107 11:70216739-70216761 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1085052920 11:73388971-73388993 CAGGCAGAGCCCGGGGAGGCCGG - Intronic
1085449383 11:76622844-76622866 CAGGGGAAGGCGGGAGAGGCAGG - Intergenic
1085544168 11:77301684-77301706 AAGGGCAGCCCGAGGGAGGCGGG + Intronic
1086134662 11:83434030-83434052 AAGGGAAAGCGAAGAGAGGCTGG + Intergenic
1086444289 11:86857919-86857941 CAGGGAGAGCCCAGTGAGGACGG + Intronic
1086855926 11:91865774-91865796 CAGGGAAAGTGAAGGGAGGAGGG + Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1088917701 11:114239800-114239822 CAGGGTAAGCCCAGACAGGCGGG + Intronic
1089944052 11:122448916-122448938 TAGGGTGAGCCGAGTGAGGCAGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090107426 11:123868015-123868037 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091551210 12:1536213-1536235 AAGGGAAGGAAGAGGGAGGCAGG + Intronic
1091882498 12:3990900-3990922 CAGGGAAAGCAGAGGCCGCCTGG + Intergenic
1092231586 12:6778558-6778580 AAGGGGAAGGTGAGGGAGGCTGG - Intergenic
1092731936 12:11542959-11542981 CAGGGAAAGAGGAGGGAGTTGGG - Intergenic
1092743205 12:11649777-11649799 GAGGGAGAGCCGCGGGAGGGCGG + Intergenic
1093264551 12:16987355-16987377 CAGGAAAAGCTGATGGAGACAGG - Intergenic
1095982641 12:47981842-47981864 CAGGTAGAGGTGAGGGAGGCAGG + Intronic
1096259686 12:50082878-50082900 CAGGGAGGGCCGAGGGTGCCCGG - Exonic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1097262663 12:57728201-57728223 TAGGGAAAGCAGAGGGTGGGGGG + Intronic
1097290994 12:57914787-57914809 CAGGGAAAGCTGTTGGATGCAGG + Intergenic
1097925291 12:65121013-65121035 CAGGGGAAGGCGCTGGAGGCGGG + Intronic
1099533047 12:83810417-83810439 GAGGCAAAGCCAAGGGATGCAGG + Intergenic
1101732845 12:107440737-107440759 CAGGGAAATGGAAGGGAGGCAGG + Intronic
1101900707 12:108789317-108789339 CAGGGAAAGGGGTGCGAGGCCGG + Intronic
1102854795 12:116284187-116284209 CAGGGAAAGCAAATGCAGGCTGG - Intergenic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1103405582 12:120672731-120672753 CAAAGAAACCCAAGGGAGGCTGG + Intergenic
1103920602 12:124397234-124397256 CAGGCACGGCCGAGGGAGGGAGG + Intronic
1103940211 12:124497276-124497298 CTGGGAAAGCCCACGCAGGCAGG - Intronic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104569102 12:129909459-129909481 CAGGCCCAGCCCAGGGAGGCCGG + Intergenic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1104981513 12:132574982-132575004 CTGGGAAGGCTGAGGAAGGCGGG + Intronic
1105805382 13:23949130-23949152 CAGGGAAAGAGTAGAGAGGCTGG - Intergenic
1107853411 13:44591975-44591997 GAGGGGAAGCTGAGGGTGGCTGG + Intergenic
1109716564 13:66228806-66228828 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1112030094 13:95448979-95449001 TTTGGGAAGCCGAGGGAGGCAGG - Intronic
1113728316 13:112622358-112622380 CAGGGACAGCTAGGGGAGGCAGG - Intergenic
1113899591 13:113788821-113788843 CTGGGAAACCCCAGGGAAGCTGG + Intronic
1114491658 14:23106190-23106212 CGGGGGAGGCCGGGGGAGGCGGG - Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1116534603 14:46014847-46014869 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118458274 14:65964564-65964586 CAGGGGAAGCCAAGGAATGCTGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118875003 14:69776702-69776724 CAGGGAATGAGGAGGCAGGCAGG + Intronic
1119147943 14:72333371-72333393 CAGGGAAAGATGAGGGAAGTGGG + Intronic
1119433906 14:74585708-74585730 CAGGGAAAGCCAAGGAGGGTGGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121096404 14:91220760-91220782 CAGGCAATGACGAGGCAGGCGGG - Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121660723 14:95633066-95633088 CAGAGGAAGCCATGGGAGGCAGG + Intergenic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122697294 14:103562364-103562386 CGGGGGAAGCCGGGGGAGGAGGG + Intronic
1122823143 14:104357038-104357060 CAAGGAAAGCCGAGGGAGATTGG + Intergenic
1122854636 14:104554257-104554279 CAGGGAAAGCCAAGGCCGCCTGG + Intronic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124804439 15:32867336-32867358 CAGGGAGAGCAGGGTGAGGCTGG - Intronic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1125708859 15:41767174-41767196 CAGGGAATGACCAGGAAGGCCGG + Exonic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1128160590 15:65421179-65421201 CAGGGAGAGGCCAGGGAAGCTGG + Intronic
1128358297 15:66943546-66943568 AAGGGAAAGAAGAGGGAGGGAGG - Intergenic
1128592127 15:68908615-68908637 CAGGGAAAGCCCAGTGAGGCTGG + Intronic
1128647495 15:69388128-69388150 CAGGGAGGGAGGAGGGAGGCAGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129705835 15:77793542-77793564 CAGGGAAAGTTTAGGGTGGCAGG - Intronic
1129916890 15:79282406-79282428 GAAGGAAAGCCGAGGAGGGCAGG + Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131476868 15:92747276-92747298 CAGGGAATGCCAAGGGCTGCTGG - Intronic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1132540602 16:507054-507076 CATCGAAGGCTGAGGGAGGCGGG - Intronic
1132598294 16:763010-763032 CAGGGAAAGATGTGGAAGGCCGG + Intronic
1133037261 16:3040630-3040652 CAGGGAAGGCCCGGGGAGGCTGG + Intergenic
1133315064 16:4877711-4877733 CAGGGAAAGTTGCGGGGGGCAGG + Intronic
1133320205 16:4909060-4909082 CAGGCAGAGGCCAGGGAGGCAGG + Intronic
1133879824 16:9770862-9770884 CAGGGAAAACCGAAGGGAGCGGG - Intronic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1135202642 16:20451878-20451900 CAGGGAGAGACGAGGGCAGCTGG + Intronic
1135216461 16:20575988-20576010 CAGGGAGAGACGAGGGCAGCTGG - Intronic
1135303469 16:21350053-21350075 CTTGGAAAGCCGAGGCCGGCCGG + Intergenic
1135527952 16:23228342-23228364 TAGGGAAGGCCGAGGGGGTCTGG - Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136287973 16:29255121-29255143 CGGGGAACGCCGAGGATGGCTGG - Intergenic
1136300216 16:29329247-29329269 CTTGGAAAGCCGAGGCCGGCCGG + Intergenic
1136536545 16:30902970-30902992 CAGGCAAAGCAAAGAGAGGCTGG - Exonic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137716865 16:50603473-50603495 CGGGGAAAGAGGAGGGGGGCAGG - Intronic
1138378367 16:56582667-56582689 CAAGGAAAAACGAGGGAGGGAGG + Intergenic
1138528769 16:57623617-57623639 CAGGGAAAGAGCAGGGAGCCTGG - Intronic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1141193626 16:81842880-81842902 CAGGGAGGGCTGAGGGAGGGTGG + Intronic
1141786092 16:86201816-86201838 CAGGCAGAGCTGAGTGAGGCGGG + Intergenic
1141939187 16:87263405-87263427 CAGGGAATGCCCTGGCAGGCTGG - Intronic
1142093630 16:88227838-88227860 CGGGGAACGCCGAGGACGGCTGG - Intergenic
1142218478 16:88841458-88841480 AAGGGAAGGACGGGGGAGGCAGG - Intronic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143164541 17:4891430-4891452 CAGGGAGAGACCAGGGAGGGTGG - Intronic
1144466104 17:15498988-15499010 CAGGGAAAGCAGAGTCAGACAGG + Intronic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1146067701 17:29649492-29649514 CTTGGAAAGCTGAGGGAGGTGGG - Intronic
1146176085 17:30667479-30667501 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146349543 17:32083589-32083611 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146403539 17:32518973-32518995 CAGGGAAGGCCGAGCAAGCCAGG + Intronic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1147844263 17:43393850-43393872 CAGGGAACACTGAGGCAGGCAGG - Intergenic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148486478 17:47994337-47994359 CAACGGAAGGCGAGGGAGGCTGG + Intergenic
1148776620 17:50099293-50099315 CTGGGAGAGCTGAGGGATGCAGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150242554 17:63646933-63646955 AAAGGAAAGCTGAGGGTGGCAGG - Intronic
1150480309 17:65503996-65504018 CAGGGAAAGCCTGGGGATGGAGG + Intergenic
1151539534 17:74758078-74758100 CAGGGAAGGCTGTGGGAGCCTGG - Intronic
1151956505 17:77382822-77382844 GAGGCAAAGGCGAGGGAGGAGGG + Intronic
1151977284 17:77489967-77489989 CTGGGCAAGCCGAGGGCGGGCGG + Intronic
1152025226 17:77804670-77804692 CAGGGAAAACTGTGGGAGCCTGG - Intergenic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1152757269 17:82092242-82092264 CAGGGAAGGCCCAGCGAGCCTGG + Intronic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1153291324 18:3504921-3504943 TGGGGAGAGCCAAGGGAGGCTGG + Intronic
1153588843 18:6652024-6652046 TTTGGAAAGCCCAGGGAGGCAGG + Intergenic
1153752535 18:8247976-8247998 CAGGGATAGCAGAGAGAGGGCGG - Intronic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154498610 18:14981054-14981076 CAGGAGAAACCAAGGGAGGCAGG - Intergenic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1155630571 18:27887621-27887643 GAGGGAAAGAGGAGGGAGGGAGG - Intergenic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156363761 18:36407074-36407096 CAGGGAAAGCAGAGGACAGCAGG - Intronic
1156835052 18:41542655-41542677 CATGGAAGGCTGAGGCAGGCAGG + Intergenic
1157296580 18:46449253-46449275 GAGGGAAAGGCGAGTGAGGCAGG + Intronic
1157691284 18:49684057-49684079 CAGGGAAAGACGTGGGAATCTGG + Intergenic
1157816026 18:50729897-50729919 CAGAGAAAGCCGGGGCTGGCAGG + Exonic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1157862522 18:51153856-51153878 CAGGGCTGGCCGAGGGGGGCTGG + Intergenic
1158973328 18:62688364-62688386 CAGGGAATGCCAAGGGCTGCAGG - Intergenic
1159161751 18:64651394-64651416 CAAGGAAAGCTGTGGGTGGCAGG - Intergenic
1159164650 18:64684916-64684938 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1159599589 18:70416206-70416228 CAGGGAACGGGGAGGGAGACAGG + Intergenic
1160483243 18:79262119-79262141 CAAGGAAAGGGGAGGGAGGGAGG - Intronic
1160769835 19:825684-825706 CGGGGAGAGTCCAGGGAGGCGGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161541762 19:4856101-4856123 CAGGGAAAGTCCAAGGATGCTGG + Intronic
1162022467 19:7874106-7874128 CAGGGGAGGCCGATGGGGGCTGG - Intronic
1162583575 19:11545482-11545504 CAGGGAAGGTGGAGGGAGGGGGG + Intronic
1162743435 19:12786225-12786247 CAGGGACACGGGAGGGAGGCTGG + Intronic
1162806137 19:13138884-13138906 CAGGGATAGACGAGGGTGACAGG - Exonic
1162958402 19:14112479-14112501 CAGGGAGAGCCCAAGGGGGCTGG - Intronic
1163004756 19:14390120-14390142 GAGGGAAAGAAGAGGGAGGGAGG + Intronic
1163190392 19:15673036-15673058 TAGGGAAGGCCGTAGGAGGCGGG - Exonic
1163300866 19:16445323-16445345 GAGGGAAAGCCCAGGGAGTATGG + Intronic
1163334246 19:16660913-16660935 CCGTGCAAGGCGAGGGAGGCTGG - Intergenic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164426666 19:28147748-28147770 TAGGGAGAGCTAAGGGAGGCTGG + Intergenic
1164566157 19:29327484-29327506 CAGGGAGAGGCTGGGGAGGCGGG - Intergenic
1164734757 19:30532636-30532658 AAAGGGAAGCTGAGGGAGGCCGG + Intronic
1165443841 19:35845902-35845924 CGGGGAAAGCGGGCGGAGGCGGG - Intronic
1166305777 19:41936214-41936236 CAGGGAAGGCCGAGGGATCCAGG - Intergenic
1166937057 19:46340264-46340286 CAGGCAAAGCTGGGGGCGGCAGG - Exonic
1167040274 19:47019729-47019751 CAGGGAAAGGCGAGCAGGGCGGG + Intergenic
1167238681 19:48330475-48330497 CGGGGGCAGCCGAGCGAGGCGGG - Exonic
1167913964 19:52725372-52725394 CAGGGGAGGCCGACGGGGGCTGG + Intronic
925185370 2:1843083-1843105 CAGGGAGAGCCCAGCGAGGATGG - Intronic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926238686 2:11068867-11068889 CAGGGAAAGCTGAGGGGAGCGGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927542652 2:23926804-23926826 CCGGGAGAGCCGAGCAAGGCCGG + Exonic
929832606 2:45359024-45359046 CAGGTACAGGCCAGGGAGGCAGG - Intergenic
930017340 2:46979936-46979958 CATGGAAGGCTGAGTGAGGCAGG - Intronic
930551113 2:52836018-52836040 CAGGGAATGCCAAGGGTTGCAGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930712210 2:54559627-54559649 CAGGGACAGCTGAGGGGTGCAGG - Intronic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931169832 2:59790974-59790996 AAGGGAAAGGCGAGGGAGGCTGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931625164 2:64250719-64250741 ATGGGAAAGCCGGGGGAGGAAGG + Intergenic
931657738 2:64524887-64524909 CAGGGAGAGCCGGCGGTGGCCGG - Intronic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932350690 2:71029002-71029024 CAGGGACAGCCCAGCGAGGATGG - Intergenic
933280374 2:80326470-80326492 CAGGGAGAGGCAAGGGGGGCAGG - Intronic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
934116943 2:88807616-88807638 CTGGGACAGATGAGGGAGGCAGG - Intergenic
934516869 2:94993835-94993857 CAAGTAGAGCTGAGGGAGGCTGG + Intergenic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
935322380 2:101901800-101901822 CAGGGACAGACAAGGGAGTCAGG - Intergenic
935830609 2:106997556-106997578 CATGGAAAGCTGTGGGAGGGAGG + Intergenic
937475215 2:122209079-122209101 CAGGGAAAGCCCTGTAAGGCAGG - Intergenic
938571597 2:132566807-132566829 GAGGGAAAGCTGAGGGAGAATGG - Intronic
938697587 2:133848583-133848605 CAGAGACAGCCAACGGAGGCTGG - Intergenic
939139464 2:138336334-138336356 GAGGGAAAGCTGAGCCAGGCAGG - Intergenic
940089737 2:149902006-149902028 CAGGGAACTACGAGGAAGGCTGG - Intergenic
940845594 2:158638495-158638517 CAGCAAATGCCAAGGGAGGCAGG - Intronic
941664036 2:168226000-168226022 CAGGGAAAGAAGAGAGAAGCTGG + Intronic
943412754 2:187562908-187562930 AAGTGAAAGCCAAGAGAGGCTGG + Intronic
943951123 2:194133307-194133329 AAGTGAAAGCCAAGAGAGGCTGG + Intergenic
945143808 2:206715294-206715316 AAGGCAAAGCCCAAGGAGGCTGG - Intronic
945314733 2:208359822-208359844 CAGGGGAAGGCGAGGGTGGCTGG + Intronic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
947394181 2:229671275-229671297 AAGGGAAAGCCGAGTATGGCTGG - Intronic
947669235 2:231926110-231926132 CTGGGAGAGGCGTGGGAGGCTGG - Intronic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
947773353 2:232688217-232688239 CAAGGAAGGCCGAGGCAGGAGGG + Intergenic
948844710 2:240677502-240677524 GAGGGCAGGCCCAGGGAGGCGGG + Intronic
948849150 2:240697377-240697399 GAGGGCAGGCCCAGGGAGGCGGG - Intronic
949020946 2:241741105-241741127 CAGGGAAGGCTGGGGGAGCCGGG - Intronic
1169205806 20:3739886-3739908 CATGGACAGGCCAGGGAGGCTGG - Intronic
1169421819 20:5466541-5466563 CAGGTAAAGCCCAGGGATCCTGG - Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171242869 20:23585932-23585954 CAGGGCAGGACGAGGGAGGGAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172740675 20:37164221-37164243 GAGGGAGAGAGGAGGGAGGCAGG - Intronic
1172948559 20:38706891-38706913 CAGGGAAAGGTGAGGGAGAAGGG - Intergenic
1173139634 20:40470856-40470878 CTGGGAAAGCAGAGACAGGCGGG - Intergenic
1174615047 20:51829018-51829040 CAGGGAAAAGCCAGGGAGCCAGG - Intergenic
1174686916 20:52465099-52465121 CAGGGAAAGCAGAGACAAGCTGG - Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175306750 20:57981485-57981507 CAGGGCAAGGTGAGTGAGGCGGG + Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1176021161 20:62963117-62963139 TAGGGGAGGCCAAGGGAGGCTGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176515034 21:7777575-7777597 CTGGGAATGCCGTGGGAAGCAGG - Intergenic
1178293475 21:31388678-31388700 CAGAGAAAGTGGAGGGAGCCAGG + Intronic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178649062 21:34407587-34407609 CTGGGAATGCCGTGGGAAGCAGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178710411 21:34911748-34911770 CAGAGCAAGCCGAGGGAGACAGG - Intronic
1178712858 21:34934798-34934820 CAGGGAAAGAGGATGAAGGCAGG + Intronic
1179708426 21:43195586-43195608 CGGGGGAGGCCGGGGGAGGCGGG + Intergenic
1180063978 21:45403985-45404007 CTGGGAAGGCTGAGGCAGGCAGG + Intergenic
1180883117 22:19220712-19220734 CAGGAAAAGCCCAAGCAGGCTGG + Intronic
1181359503 22:22323673-22323695 AAGAGAAAGCCAGGGGAGGCTGG - Intergenic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181696528 22:24595422-24595444 CAGGGTAACCCCAGGGAGACGGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181987252 22:26808798-26808820 GAGGGAAAGGCGTGGGAGACAGG - Intergenic
1182302228 22:29343381-29343403 CAGGGAAGGCTGACAGAGGCAGG + Intronic
1182338826 22:29603427-29603449 CTGGGAAGGCCAAGGTAGGCAGG - Intergenic
1182458430 22:30467691-30467713 CAGGGAAAGTTGTGGGAGGTAGG + Intronic
1183468077 22:37990138-37990160 GAGGAAAAGACCAGGGAGGCTGG + Intronic
1183743813 22:39682100-39682122 CAGGGAATGCCTAGGAAGGTAGG + Intronic
1183748728 22:39706993-39707015 TTGGGAAGGCCGAGGGGGGCGGG + Intergenic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184746348 22:46458384-46458406 CAGGGCAGGACGAGGGTGGCAGG + Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185155764 22:49192534-49192556 GAGGGAAAGCCGCAGGAGCCCGG + Intergenic
949514524 3:4795031-4795053 AAGGCAAAGCCGCGTGAGGCTGG - Intronic
949885296 3:8688265-8688287 CAGGGACAGCCCAGCGAGGACGG - Intronic
950659114 3:14455716-14455738 CAGTGAAAGCCAGGGCAGGCTGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954134976 3:48578346-48578368 CAGGGAAAGCCAGGCGAGGATGG - Exonic
955239279 3:57165142-57165164 GAGGGTAAGGCGAGGGCGGCGGG - Exonic
955358318 3:58250378-58250400 CAGGCAAAGACGTGGGAGTCAGG + Intronic
955591188 3:60537646-60537668 GAGGGAAAGCCATGGGGGGCCGG + Intronic
956558222 3:70544267-70544289 CAGAGAAATCCTAGGCAGGCAGG - Intergenic
956873696 3:73442112-73442134 CAGGGAACCCCCAGGGTGGCTGG - Intronic
958094772 3:88929659-88929681 GAGGGCAAGCCGAAGGAGGGTGG + Intergenic
959189182 3:103088119-103088141 GAGGGAAAGCCAAGTGTGGCTGG + Intergenic
959981736 3:112525057-112525079 CAGGGACAGCCCAGCGAGGACGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961171713 3:124801975-124801997 CAGAGAAAGCCGGGGTGGGCTGG - Intronic
961786372 3:129349640-129349662 CAGGGACAGCCGAGGGCCTCAGG + Intergenic
962210940 3:133477068-133477090 CAGGGAGAGCCGTGGCAGACTGG + Intergenic
962848498 3:139290446-139290468 CAAAGACAGCCTAGGGAGGCTGG + Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963741480 3:149086223-149086245 CAGGGAACGCAGAGGAACGCGGG + Intronic
964729857 3:159853182-159853204 CAAGGAAAGGCCAGGGAGGCTGG + Intronic
964858701 3:161175729-161175751 ACAGGAAAGCAGAGGGAGGCTGG + Intronic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965781321 3:172289205-172289227 CAGACAAAGCCAAGGGATGCAGG - Intronic
965861810 3:173158381-173158403 AAGTGAAAGCCAAGAGAGGCTGG + Intergenic
966067005 3:175830982-175831004 AAGTGAAAGCCAAGAGAGGCTGG - Intergenic
966104924 3:176324062-176324084 AAGTGAAAGCCAAGAGAGGCTGG + Intergenic
966789272 3:183650653-183650675 CAGGGAAAGCCGAGAAATGTTGG + Exonic
967427192 3:189340714-189340736 CAGGGAAAGCCAAGGGCTCCAGG - Intergenic
967815520 3:193795240-193795262 CAGGGAAAGGCACGGGAGGAGGG + Intergenic
968727621 4:2255640-2255662 CAGGGACAGCCGTGGGGTGCTGG - Intronic
968922888 4:3531863-3531885 CAGGCAAAGGCTCGGGAGGCAGG + Intronic
968985857 4:3873916-3873938 CAGGGAAAGGGGAGAGAGGGAGG + Intergenic
969161873 4:5267364-5267386 CAGGGAAAGCGGGGAGGGGCAGG - Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969509230 4:7608171-7608193 CAGGAAGTGACGAGGGAGGCTGG - Intronic
969576556 4:8039346-8039368 CAGGGAAGCCTGAGGAAGGCTGG - Intronic
969591361 4:8123572-8123594 CAGGGAAAGCCAGGCCAGGCAGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
969938491 4:10706766-10706788 CAGGGAAAGGCAAGGCAGGGTGG - Intergenic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
971619315 4:28834302-28834324 CAAGGAAAGCCAAGGATGGCTGG + Intergenic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
977225169 4:94385892-94385914 AAGTGAAAGCCAAGGGAGGCTGG + Intergenic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
978315126 4:107427303-107427325 CAGGGAAAGACAAGAGAGCCAGG - Intergenic
982771381 4:159400418-159400440 AATGGAAGGCGGAGGGAGGCAGG + Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984708125 4:182862728-182862750 CAGGGAAGGCTGGGGGTGGCAGG - Intergenic
984908811 4:184652961-184652983 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984908826 4:184653020-184653042 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985067076 4:186133074-186133096 CAGTGAATGCCTAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985698705 5:1357867-1357889 CATGGAGAGCTGTGGGAGGCTGG - Intergenic
985939259 5:3121473-3121495 CAGGGGAAGCCGCGTGCGGCTGG - Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986773520 5:10994378-10994400 CGGGGAAAGAGGAGGGGGGCGGG + Intronic
987067651 5:14305214-14305236 CAGGGTTAGCCCAGGCAGGCAGG + Intronic
987263672 5:16229184-16229206 CAAGGAAAGCCAAGGATGGCCGG - Intergenic
989169083 5:38457488-38457510 CAGGGAAAGCCATGGGAAACTGG - Intronic
992265848 5:75017652-75017674 GAGGGACAGCGAAGGGAGGCAGG + Intergenic
992828205 5:80569925-80569947 CAGGGCCAGCCGAGGGCCGCCGG - Intronic
995362667 5:111316188-111316210 CAGGAATGGCCAAGGGAGGCTGG - Intronic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
997588382 5:135057991-135058013 CAAGGAAAGCCAAGGGTTGCCGG - Intronic
999848439 5:155511125-155511147 CTGGGAAAGCTTAGCGAGGCAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1002101692 5:176861067-176861089 TAGGGATGGCAGAGGGAGGCTGG - Intronic
1002303776 5:178271970-178271992 CAGCGGAAGCCCAGAGAGGCAGG - Intronic
1002846961 6:955533-955555 CAGAGAAAGCCGACTGAAGCAGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003084766 6:3052709-3052731 CTGGGAAAGCCCAGGGAAGCAGG + Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003618056 6:7673114-7673136 TAGGAAAAGCCGTGGGAGGGAGG + Intergenic
1004208496 6:13614750-13614772 CTGGGAAGGCCGAGGGCGCCGGG + Intronic
1005215201 6:23518526-23518548 CAGGGAAAGCCGGTGGCAGCAGG - Intergenic
1005562366 6:27053921-27053943 CAGGGAATTCCCAGGGAAGCAGG - Intergenic
1005986934 6:30881484-30881506 GAGGGAAAGAGGAGGGAGACTGG - Intronic
1006520045 6:34565976-34565998 CAGGGCAGGCCCAGGCAGGCAGG - Intergenic
1006815784 6:36848925-36848947 CAGGTACAGCCAGGGGAGGCAGG - Intergenic
1006851909 6:37104507-37104529 GAAAGAAAGCCGAGGGAGGTTGG - Intergenic
1007531782 6:42549108-42549130 AAGGGGAAGAGGAGGGAGGCCGG + Intergenic
1007655735 6:43450068-43450090 CAGGGACCTCCGAGTGAGGCAGG - Exonic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1014614499 6:123584716-123584738 AAGTGAAAGCCAAGAGAGGCTGG + Intronic
1014885009 6:126769334-126769356 CAGGTAATGCTGAGGGAGGGTGG - Intergenic
1014907078 6:127043393-127043415 CAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1017669101 6:156752923-156752945 CTGGCAAGGCCGAGGGTGGCAGG + Intergenic
1018135885 6:160778168-160778190 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1018176180 6:161181261-161181283 CTGGGATTGCTGAGGGAGGCGGG + Intronic
1019049218 6:169170331-169170353 CAGGGAATGGCAAGGGAGGAGGG - Intergenic
1019050256 6:169177069-169177091 CAGGGACTGCCGAGAGTGGCGGG + Intergenic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019772325 7:2891478-2891500 CACGTAAAGAGGAGGGAGGCGGG - Intergenic
1019788141 7:2992639-2992661 CAGGGAAAGCCGTGTGATGACGG - Intronic
1019894450 7:3972801-3972823 CTGGGAAACCCCAGGGAGTCGGG - Intronic
1019987378 7:4667545-4667567 TTGGGAAGGCCGAGGCAGGCAGG + Intergenic
1020011760 7:4809181-4809203 CAGTGACAGCCCGGGGAGGCGGG - Intronic
1020137647 7:5595683-5595705 CAGAGAAAGCCCAGTGTGGCTGG + Intronic
1021172849 7:17417136-17417158 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021638550 7:22715183-22715205 CAGGGAGAGAGGAGGGAGGCAGG + Intergenic
1022572623 7:31469457-31469479 AAGTGAAAGCGGAGAGAGGCTGG + Intergenic
1022848644 7:34237035-34237057 CAAGGAAAGCCTTGGGAGGATGG + Intergenic
1023220483 7:37916590-37916612 CAGCGAAAGATGAGGGTGGCAGG - Exonic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1025030389 7:55552071-55552093 GAGGGAAAGCCCTGGGAGCCAGG + Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1028369861 7:90078985-90079007 CAGGAAAAACCCTGGGAGGCAGG + Intergenic
1028670676 7:93397219-93397241 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1028718399 7:94000892-94000914 CTTGGGAAGCTGAGGGAGGCAGG + Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029257312 7:99278306-99278328 CAGGGAAAGTCCAGGGATGGTGG + Intergenic
1029267236 7:99352048-99352070 AAGAGAAAGCCAAGGGAGGCTGG - Intronic
1032220121 7:129988150-129988172 CAGGGAGAGGCGAGGAAGGATGG + Intergenic
1032383944 7:131508686-131508708 CAGTGAAAGCCGAGGAAACCGGG + Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032487029 7:132295672-132295694 CAGGTGAGGCCAAGGGAGGCAGG - Intronic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034260558 7:149752804-149752826 ATGGGGAAGCCCAGGGAGGCCGG + Intergenic
1034271840 7:149806868-149806890 CAGGAAAAGACCAGGGGGGCAGG - Intergenic
1034956253 7:155337310-155337332 CAGGCAAAGCCGAGGAGTGCCGG + Intergenic
1035231453 7:157468440-157468462 CGGGGAACGACGAGGCAGGCTGG - Intergenic
1035274472 7:157739316-157739338 CTGGGACAGCCGAGGGAAACTGG + Intronic
1035275446 7:157745471-157745493 CAGGGCAGGCTCAGGGAGGCAGG + Intronic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036472168 8:9061864-9061886 AAGGGAAAGCGAAGAGAGGCTGG + Intronic
1036619421 8:10414752-10414774 CAGGGAAAGCCAAGGATAGCAGG - Intronic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1036905325 8:12703915-12703937 CAGGGACAGCCCAGCGAGGATGG + Intergenic
1037276818 8:17189290-17189312 CAGGGAAAGCCGAGGGTAGTGGG - Intronic
1037485480 8:19342855-19342877 AAGGGAAAGAGGAGGGAGTCAGG + Intronic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1038327080 8:26579373-26579395 CAGTGAAATCCCAGGGAGGGGGG + Intronic
1039543056 8:38387029-38387051 TGGGCAAAGCCGAGGGAGCCCGG + Intronic
1039548648 8:38428099-38428121 CGGGGAAAGCCAAGAGAGACAGG + Intronic
1039552338 8:38452031-38452053 GAGGGAGAGGGGAGGGAGGCTGG + Intronic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040976977 8:53204352-53204374 TGGCGAAAGCAGAGGGAGGCAGG + Intergenic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1042711487 8:71722444-71722466 GAAGGAAAGCCGAGGGAGTTTGG - Intergenic
1044971578 8:97625044-97625066 CTGGGACAGCCGAGAGAGGAAGG - Intergenic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1046547357 8:115668677-115668699 GAGGGAAAGGGGGGGGAGGCAGG - Exonic
1047204916 8:122795354-122795376 CAGGGCTAGGCCAGGGAGGCAGG - Intronic
1047252745 8:123192975-123192997 CAGGGGAAGCGGCTGGAGGCAGG + Intronic
1049343340 8:142125565-142125587 CCGGGGAGGCCGAGGGAGGGAGG - Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049684151 8:143932601-143932623 CAGGGCCAGCCGGGGGAGGTGGG - Intronic
1050441545 9:5669279-5669301 CAGGGAAAAGGGTGGGAGGCGGG - Intronic
1051344917 9:16143141-16143163 CAAGGAAAGCCAGGGCAGGCAGG + Intergenic
1051605879 9:18917445-18917467 AAGGGAAAGAAAAGGGAGGCAGG + Intergenic
1053526120 9:38832705-38832727 CAGAGGAAGCCCAGAGAGGCTGG + Intergenic
1054198347 9:62057130-62057152 CAGAGGAAGCCCAGAGAGGCTGG + Intergenic
1054640007 9:67531233-67531255 CAGAGGAAGCCCAGAGAGGCTGG - Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1056413481 9:86354581-86354603 CTGGCAAAGGCGCGGGAGGCGGG - Intergenic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1057831535 9:98410699-98410721 GAGGGAAAGCCCAGGTAGACAGG - Intronic
1059082211 9:111262098-111262120 CAGGGAAAGCAAAGCCAGGCTGG + Intergenic
1061034463 9:128105993-128106015 CAGGGACAGCAGGGCGAGGCAGG + Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061423230 9:130483585-130483607 GGAGGGAAGCCGAGGGAGGCCGG + Intronic
1061490555 9:130941665-130941687 AAGGGAAATCCGAGGGTGGAGGG - Intergenic
1062209777 9:135357213-135357235 CAGAGAAAGCCAAGGGATCCAGG + Intergenic
1062476307 9:136729045-136729067 CAGGCAAAGGCCAGGAAGGCCGG + Intergenic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185991227 X:4894869-4894891 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1186193347 X:7087308-7087330 CAAGGAAAGCTAAGGGTGGCCGG + Intronic
1186411358 X:9347208-9347230 CAAGGAGAGCCTAAGGAGGCCGG - Intergenic
1187521776 X:20020597-20020619 AAGGGAAAGCCAAGAGAGGTAGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189288444 X:39868308-39868330 CAGGCAAAGCCCTGGGAAGCTGG - Intergenic
1189659897 X:43285962-43285984 CAGGGAAAGTGCATGGAGGCTGG - Intergenic
1190233131 X:48597652-48597674 AAGGGAAGGCGGAGGGCGGCGGG + Intronic
1194798481 X:98241138-98241160 CAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1198072014 X:133158903-133158925 GAGGGCAAGCCGAAGCAGGCTGG + Intergenic
1198518389 X:137429515-137429537 CCGGGGAGGCCGAGGGAAGCTGG + Intergenic
1198750298 X:139932180-139932202 CGCGGAGAGCCGAGGGGGGCAGG - Intronic
1199802105 X:151261853-151261875 AATGGAAAGGCAAGGGAGGCTGG + Intergenic
1200150739 X:153950190-153950212 CAGGGAAGGCCCAGGAAGCCGGG - Intronic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200231684 X:154446935-154446957 CAGGGAAAGCTCAGGATGGCTGG + Intronic
1200256789 X:154586573-154586595 CAGGGAAAGCTGCTGGAGACAGG - Exonic
1200260980 X:154617830-154617852 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1200267022 X:154652198-154652220 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1201565279 Y:15358816-15358838 CAAGGAAAGCTAAGGGTGGCCGG + Intergenic
1201774504 Y:17648520-17648542 CAGGGAAACCCCTGGGAGGGCGG + Intergenic
1201827052 Y:18257469-18257491 CAGGGAAACCCCTGGGAGGGCGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic