ID: 1091538996

View in Genome Browser
Species Human (GRCh38)
Location 12:1441812-1441834
Sequence ATGACGAAACCGTCTCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091538996 Original CRISPR ATGACGAAACCGTCTCATCA CGG (reversed) Intronic
919348476 1:196417720-196417742 ATGACAAAATCGTCTAATGATGG - Intronic
919766344 1:201129779-201129801 ATGAGGAAACCGGCTCAAAAGGG + Intergenic
924520067 1:244798322-244798344 ATGTGTAAACCGTCTCAACATGG + Intergenic
1078036190 11:7807662-7807684 ATAACCAATCTGTCTCATCATGG + Intergenic
1085031936 11:73277017-73277039 ATGAGGAAACCAACTCTTCAGGG + Intronic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1091538996 12:1441812-1441834 ATGACGAAACCGTCTCATCACGG - Intronic
1093291008 12:17322197-17322219 AGGAGGAAAACATCTCATCAGGG - Intergenic
1101023622 12:100578725-100578747 ATGCCTAAACCATCTCAGCATGG + Intronic
1113668512 13:112159023-112159045 TTGAAGAGACCGTCTCATCTTGG + Intergenic
1118656468 14:67955384-67955406 ATAAGGAAACAGTTTCATCAGGG + Intronic
1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG + Intronic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1129131203 15:73498227-73498249 ATGAGGAAAAAGTCACATCAAGG - Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1143707125 17:8706292-8706314 CTCACAAAACCGTCTCTTCAAGG + Intergenic
1151017994 17:70579031-70579053 AGGACGAAACAGTCACATTAGGG + Intergenic
1155318101 18:24592178-24592200 ATGACAAAACCATCACATAAAGG - Intergenic
1155877510 18:31104684-31104706 AGGACGAAACCATCTCGGCATGG + Intergenic
940473585 2:154131510-154131532 ATTAAGAAACTGTCTCTTCATGG + Intronic
953835942 3:46344240-46344262 AGGACCAAACTGCCTCATCATGG - Intergenic
956251861 3:67242392-67242414 ATAACCAAACGATCTCATCATGG - Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
999360989 5:150986692-150986714 AAGACCAAACCATCTCATCATGG - Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1010717559 6:79246906-79246928 AAGAGGAAACCCTGTCATCAAGG - Intergenic
1018722153 6:166581293-166581315 ATGACAAAACCTTCCCCTCAGGG + Intronic
1021508245 7:21408570-21408592 AAGAGGAAACCTTCTCATGAAGG + Intergenic
1030320036 7:108156620-108156642 ATGATGAAACCGTTTCTACATGG - Intronic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1047816652 8:128471757-128471779 ATGATGAATCAGACTCATCATGG + Intergenic
1049484071 8:142842432-142842454 ATGACAAAACCATGCCATCAAGG - Intronic
1187016224 X:15331927-15331949 ATGTCTAAACCGTCTCAGCATGG - Exonic
1202199712 Y:22333292-22333314 ATGCCAAAACCGTCCCTTCAAGG + Intronic