ID: 1091541416

View in Genome Browser
Species Human (GRCh38)
Location 12:1465944-1465966
Sequence CAGTGGCAACAGAATTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091541416_1091541421 24 Left 1091541416 12:1465944-1465966 CCAGGCTAATTCTGTTGCCACTG 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1091541421 12:1465991-1466013 GTCTGGAGTTGGATCTCAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 186
1091541416_1091541418 7 Left 1091541416 12:1465944-1465966 CCAGGCTAATTCTGTTGCCACTG 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1091541418 12:1465974-1465996 TGAAGACATATCCTGATGTCTGG 0: 1
1: 0
2: 0
3: 17
4: 154
1091541416_1091541419 13 Left 1091541416 12:1465944-1465966 CCAGGCTAATTCTGTTGCCACTG 0: 1
1: 0
2: 1
3: 10
4: 197
Right 1091541419 12:1465980-1466002 CATATCCTGATGTCTGGAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091541416 Original CRISPR CAGTGGCAACAGAATTAGCC TGG (reversed) Intronic
901130596 1:6960461-6960483 CAGTGCCAAGAGAGTCAGCCTGG - Intronic
902642781 1:17777393-17777415 AAGTGGGAACAGCATGAGCCTGG - Intronic
904248066 1:29202236-29202258 CACTGGCAACAGAGTGAGACTGG + Intronic
904587456 1:31588144-31588166 CAGTGCCAGCACAATAAGCCAGG + Intergenic
905680524 1:39867795-39867817 GAGTGGCAGCAGAAATAGCTTGG - Intronic
906356313 1:45108533-45108555 CAGTCTCAAGAGAAGTAGCCAGG - Intronic
907403051 1:54237382-54237404 CAGTGGTCGCAGAATTAGCTTGG - Intronic
908390661 1:63680699-63680721 AAGAGGCAGCAGAATTAGCATGG + Intergenic
908589833 1:65618625-65618647 CAAAGGAAACAGAATTAGGCTGG - Intronic
908845422 1:68319854-68319876 CAGGGGAACCAGATTTAGCCTGG + Intergenic
908907227 1:69029562-69029584 CAGTGGCACCTGAATTCTCCTGG + Intergenic
912704558 1:111902327-111902349 CAGTGGCAACTGAATGAGCCTGG + Intronic
913466539 1:119148850-119148872 GAGTGGCAACAGGATTAGAGTGG - Intergenic
915730143 1:158047633-158047655 CAGGGACAACAGAATGATCCTGG - Intronic
916343113 1:163758610-163758632 CACTGGCAACAGAGGTATCCAGG + Intergenic
916423408 1:164658225-164658247 CAGTGGCTGCAGAATTCGCATGG - Intronic
917891796 1:179446548-179446570 CACTGGCAACAGAATCACCTGGG - Intronic
919428770 1:197467608-197467630 CAGTGGCAAAAGAATTAAAAGGG - Intronic
920062107 1:203234015-203234037 CAGAGGCAAGAGAATTAGGAAGG - Intronic
923024556 1:230194469-230194491 CAGAGGCAGAAGAATTAACCTGG + Intronic
1063191178 10:3696355-3696377 CAGTAGCAACACAATGAACCCGG + Intergenic
1064068253 10:12202486-12202508 CAGTGTCAACTGAATTGGACTGG - Intronic
1064506852 10:16040573-16040595 CTGGGGAAACAGAATTAGCTCGG + Intergenic
1066259824 10:33718740-33718762 CAGGGGCAACAGCATTACCTGGG - Intergenic
1066311035 10:34196924-34196946 CAGTATCAAAAGAATTAGCATGG - Intronic
1067753311 10:48985854-48985876 CAGAGGCAGCAGAGGTAGCCAGG + Intergenic
1068301803 10:55153187-55153209 CAGTGAAAACAAAACTAGCCTGG + Intronic
1071767690 10:88687180-88687202 CAGTGGTATCAGCATTAGCTGGG - Intergenic
1076307914 10:129477662-129477684 CACTGGAAACGGAATCAGCCAGG + Intronic
1077673574 11:4179200-4179222 CAGTGGCAGCAGCAGTAGGCAGG + Intergenic
1079291283 11:19190248-19190270 GAGTGGCTACAGAATTGGCCAGG - Intronic
1080153854 11:29084561-29084583 CAGTGGCAACAGAGCAAGTCTGG + Intergenic
1081452848 11:43189237-43189259 CAATGGCAACAGCAGTGGCCAGG + Intergenic
1082222988 11:49664470-49664492 CAATGGTAACAAAATCAGCCAGG + Intergenic
1086066812 11:82754294-82754316 CAGTGGAAGAAGCATTAGCCTGG + Intergenic
1086626059 11:88954759-88954781 CAATGGTAACAAAATCAGCCAGG - Intronic
1088377888 11:109161593-109161615 TAGTGGGAACAGAATTTGTCAGG - Intergenic
1088937834 11:114421459-114421481 CATTGGAAACAAAATTAACCAGG - Intronic
1091541416 12:1465944-1465966 CAGTGGCAACAGAATTAGCCTGG - Intronic
1091808310 12:3373627-3373649 CAGTGACAACAGCTTTAGCCTGG + Intergenic
1091913355 12:4249960-4249982 CAGTGGCTACAGGATGAGCTGGG - Intergenic
1092480263 12:8853156-8853178 CTCTGCCAACTGAATTAGCCAGG - Intronic
1095212822 12:39512815-39512837 CAGTGGAAACATTATAAGCCAGG + Intergenic
1096531077 12:52243234-52243256 CAGTGGCACCAGCTTTGGCCGGG - Intronic
1098633969 12:72757962-72757984 CAGTGGCAACAGCCATAGGCAGG - Intergenic
1101469667 12:104984697-104984719 CAGAGGCTCCAGAATCAGCCTGG - Intergenic
1104184279 12:126414111-126414133 TAGTGGCTACTGAATAAGCCCGG + Intergenic
1110217574 13:73039957-73039979 CAGTGACAAGTGAATTAACCAGG - Intergenic
1112461996 13:99610919-99610941 CAGTGGGAACAGTATTTTCCCGG - Intronic
1115395776 14:32906953-32906975 CTGTGGTAACAGAATCACCCAGG + Intergenic
1117886144 14:60365030-60365052 CAACAGCAACAAAATTAGCCGGG - Intergenic
1118493320 14:66283177-66283199 CAGAGGCAGGAGAATTGGCCAGG - Intergenic
1120423349 14:84316026-84316048 CAGTGGCAGCAGTCTTAGGCAGG - Intergenic
1120506121 14:85355105-85355127 CAGTGGCATCAGTATTACCTAGG - Intergenic
1122696403 14:103555059-103555081 TACTGGCAACAGCATTAACCAGG - Intergenic
1122943752 14:104995508-104995530 CAGTGACAACAGGCTTATCCAGG - Exonic
1125857734 15:42966515-42966537 CAGTCTCTACTGAATTAGCCGGG + Intronic
1126504074 15:49382604-49382626 AAGTGGCAACAAAATGGGCCAGG + Intronic
1129802082 15:78422674-78422696 CCTGGGCAACAAAATTAGCCAGG + Intergenic
1130058920 15:80555586-80555608 CAGTGGTGATAGAATGAGCCTGG + Intronic
1132037164 15:98494045-98494067 CAATGGCAACTGACTTAACCAGG + Intronic
1135758171 16:25115303-25115325 CACTGTCAACAGAATTACCGAGG - Intronic
1136130385 16:28216801-28216823 CAGTAGCAATAGAAATAGGCAGG - Intergenic
1138735779 16:59248623-59248645 CAGAGACATCACAATTAGCCAGG + Intergenic
1140113500 16:72022821-72022843 TAGTGGAAACAGACTGAGCCCGG + Intronic
1141082695 16:81066498-81066520 CAGTTACAAAAAAATTAGCCAGG - Intronic
1141980375 16:87546562-87546584 CAGTGGCAGCAGAAATGGTCCGG - Intergenic
1142061024 16:88029448-88029470 AAGTGTCAAAAAAATTAGCCGGG + Intronic
1143715935 17:8769032-8769054 CAGTGGCAACAGGGTGTGCCGGG - Intergenic
1147872665 17:43598494-43598516 CAATGACATCACAATTAGCCGGG + Intergenic
1151866633 17:76807619-76807641 CACAGGCAACAGAAATTGCCTGG - Intergenic
1155713169 18:28907402-28907424 CTGAGGCAACAGAATGAACCTGG + Intergenic
1156726208 18:40130591-40130613 CACTGGCAAAGGAATTAGACTGG + Intergenic
1158105753 18:53883118-53883140 CAGTGGCAACCGAGGTATCCGGG - Intergenic
1160621545 18:80174565-80174587 CAGGGGTAACAGCATTATCCAGG + Intronic
1160863303 19:1246661-1246683 CACTGGAAGCAGAATGAGCCTGG + Intergenic
1162315200 19:9934586-9934608 CAGTGGAAAAAAAATGAGCCAGG - Intronic
1162557210 19:11394651-11394673 CAGTGACAGCAGAATGAGCTTGG - Intronic
1163245924 19:16094123-16094145 AAGTGGCAATTCAATTAGCCAGG - Intronic
1163776185 19:19219209-19219231 CAGTGGCCCCAGAAGTAGCGTGG - Exonic
1164670098 19:30067555-30067577 CAGTGGCAACAGACTCAGTCAGG + Intergenic
1166888653 19:45976376-45976398 CCATGGCAGCAGAACTAGCCCGG - Intergenic
925151549 2:1618705-1618727 CAGTGGGAACAGACTGAACCAGG - Intergenic
927067380 2:19486937-19486959 CAGTAGCCACAGAATATGCCAGG + Intergenic
928416465 2:31096403-31096425 AAGTGACAAGAGACTTAGCCAGG - Intronic
930158955 2:48133332-48133354 CATTGGCAACAGATATAGCAAGG + Intergenic
930843696 2:55877790-55877812 CACTGGCAATAAAATGAGCCTGG + Exonic
939335634 2:140824496-140824518 CAGTGGCCACAGGGTTAGACAGG + Intronic
941251160 2:163164940-163164962 CAGTGCCAACCGAAATAGCTTGG + Intergenic
942245210 2:174001707-174001729 CACTGTCGACAGAATAAGCCAGG + Intergenic
944694465 2:202188712-202188734 CAGTGGCAATAGAATCTGCTGGG - Intronic
944891414 2:204120904-204120926 CAGTGGCTACAGAGGCAGCCAGG - Intergenic
946262423 2:218505656-218505678 CAAGGGCAACAGAAATAGTCTGG - Intronic
947667299 2:231914348-231914370 CACAGGCATCAAAATTAGCCGGG - Intergenic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1170854553 20:20039195-20039217 CAGTGACAACAGAAGTTGCAAGG + Intronic
1171228236 20:23459144-23459166 CAGTGGCATCCGTGTTAGCCTGG - Intergenic
1172269710 20:33647606-33647628 CAGTGGCCATAAAACTAGCCAGG + Exonic
1172459349 20:35104251-35104273 CAGAGGCAACAGCATTACCAAGG - Intergenic
1174915642 20:54650592-54650614 CAATGACCACACAATTAGCCAGG - Exonic
1175528138 20:59650694-59650716 AAGTGGCAAGAGAATTATCCAGG + Intronic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1179090475 21:38260795-38260817 AATTAGCAACAGAATAAGCCAGG + Intronic
1180719423 22:17896329-17896351 CAATGGGAACAGGAATAGCCCGG - Exonic
1181341409 22:22182684-22182706 GAGTGGCATCAGCAGTAGCCAGG + Intergenic
1181597801 22:23928457-23928479 CAGTGGCAACAAAATTCCACTGG - Intergenic
1182354280 22:29715374-29715396 CAGAGGCAACAGACTGAGGCAGG + Intergenic
1182772644 22:32806289-32806311 AAGTGGCCACAGAAGTAGCTTGG + Intronic
1183950666 22:41351009-41351031 CAGTGGCAACAGTCTGAGGCTGG + Intronic
1184357154 22:43990013-43990035 CAGAGGGAACAGAATATGCCAGG + Intronic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
949831981 3:8224523-8224545 CAGAGACACCAGAATTATCCTGG - Intergenic
951448880 3:22814081-22814103 CAGTGGCAACAGAAACAGGATGG - Intergenic
953446314 3:42971168-42971190 CAGAGGCCACAGAATTAGCTTGG + Intronic
953571861 3:44077575-44077597 CAGTGGCATCATAAATAGCTTGG + Intergenic
954335671 3:49915842-49915864 CAGTGGTAACAGAGCTAGCTGGG + Intronic
954821151 3:53328873-53328895 CTGTGGCAACTGCATTAGTCTGG - Intronic
958423143 3:93950804-93950826 CACTGGCAACAGAATAAAGCTGG + Intronic
958646232 3:96878246-96878268 TAGTGGGAACAGAATTGGCAAGG + Intronic
960131545 3:114061503-114061525 CTGTGCCAACAGAATTACACAGG - Intronic
960965468 3:123101324-123101346 CAGTGGCACCAGCATCATCCAGG - Intronic
961533021 3:127551398-127551420 CAGGGGCAACTGCAGTAGCCAGG - Intergenic
962416480 3:135187201-135187223 CAGTGGGACCAAAATTAGGCTGG + Intronic
963480804 3:145871560-145871582 CACTTGCATCAGAATTAGTCAGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967906855 3:194508515-194508537 AAGAGGCAAAAGAATTAGGCAGG + Intergenic
968096561 3:195935316-195935338 CAGTGGAAACATTATAAGCCAGG + Intergenic
969110118 4:4839275-4839297 CAGTGGCCACAGTCTCAGCCAGG + Intergenic
970403654 4:15741788-15741810 CAGTGGCAACAGAGGTTGCATGG + Intergenic
971347856 4:25827677-25827699 GAGTGGCCACAGAATGATCCAGG - Intronic
971871840 4:32251018-32251040 CAGTGGCAAGGTAATTAGCTGGG - Intergenic
972717618 4:41663504-41663526 CAGTGGCATCAGAATTACCATGG - Intronic
973983586 4:56327722-56327744 CCGTGTCAACAGAACCAGCCTGG + Exonic
976478362 4:85510665-85510687 CAGTGGAAAAAAAATGAGCCTGG - Intronic
980482597 4:133406334-133406356 CAGTGGCTACAAAATTATCATGG + Intergenic
982534744 4:156596254-156596276 CAGTGGGACCAGAAATACCCAGG + Intergenic
982870000 4:160566985-160567007 CAATGCCACCAGAATAAGCCTGG + Intergenic
984565111 4:181319836-181319858 CAGTGGCAGCAGCAGTACCCGGG - Intergenic
984984712 4:185316751-185316773 CAGTATCAACAGAAAGAGCCAGG - Intronic
987297517 5:16567196-16567218 AAGTGGCAAGAGACTTAGCAGGG + Intronic
987341425 5:16942846-16942868 CAACAGCAACAAAATTAGCCAGG + Intergenic
987981858 5:25096131-25096153 GTGTGGAAACAGAATTAACCTGG - Intergenic
989640118 5:43576159-43576181 CAAAAGCAACAAAATTAGCCAGG + Intergenic
990318503 5:54607215-54607237 CAGTGCCAACAGAAGAACCCAGG - Intergenic
992118710 5:73568048-73568070 CAGTGGCAACAAGAATAGTCTGG + Intronic
992133446 5:73718768-73718790 GAGTGGCAACAGGCTCAGCCTGG - Intronic
992920303 5:81509917-81509939 CAGTGGCAGTAGAATTAGAAAGG - Intronic
992989136 5:82265832-82265854 CAGTGACATCAGAATTCCCCTGG - Intronic
993530670 5:89020861-89020883 CAGGGTCAACAGAATTAACCTGG + Intergenic
994042703 5:95276195-95276217 AAGAGGCAACAGAATGAACCAGG + Intronic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994697390 5:103089615-103089637 CCTAGGCAACACAATTAGCCAGG - Intronic
996009196 5:118461958-118461980 CAGTGACAAAAGAATTAAGCTGG + Intergenic
997415382 5:133723979-133724001 CAGTGGCAGCAAAATTGGGCAGG + Intergenic
997476199 5:134143983-134144005 CAGTCTCAGCAGAACTAGCCAGG - Intronic
997981461 5:138470143-138470165 CAATGGGAACAGATTTGGCCCGG - Intergenic
998507097 5:142680858-142680880 CAAAGGCAACAGAATTACCTAGG + Intronic
999820317 5:155221241-155221263 AACAGGCACCAGAATTAGCCTGG + Intergenic
1000870918 5:166576245-166576267 TAGTGGCAACAGAAGGTGCCAGG + Intergenic
1000927335 5:167209888-167209910 CAGTGGCCACTGAATTAACATGG + Intergenic
1001925000 5:175629770-175629792 CAGTGGCAAAAGAGTAAGACTGG + Intergenic
1003347779 6:5286850-5286872 CAGTGGCACCAAAATTAACATGG - Intronic
1004636446 6:17472613-17472635 CAATGGCAAGAGAATTACCTTGG + Intronic
1005722893 6:28620132-28620154 CTGTGTCTACAAAATTAGCCAGG + Intergenic
1007026557 6:38581680-38581702 CAGTGGCTCCACATTTAGCCAGG + Intronic
1007153403 6:39718067-39718089 AAATGGAAACAAAATTAGCCAGG + Intronic
1007415004 6:41686402-41686424 CAGTGGCAACAGAAGTCACCAGG - Intronic
1012233599 6:96787717-96787739 CAGAGGCAACAGGATGAGTCAGG + Intergenic
1015203106 6:130604139-130604161 CAGTGGGACCTGAATTAGACTGG - Intergenic
1017830173 6:158120020-158120042 ATGTGGCAACCAAATTAGCCTGG - Intronic
1018064604 6:160116477-160116499 CAGTGGCACCAGGCTTGGCCTGG + Intergenic
1020605672 7:10333670-10333692 AAGTGCCAACAGAATTCTCCTGG + Intergenic
1022156177 7:27663692-27663714 AAGTGCCAAAAAAATTAGCCGGG - Intergenic
1022845622 7:34206945-34206967 CTGAGGGAACAGAATTAGCCAGG + Intergenic
1027770180 7:82396789-82396811 CATTGGCAACATAATAAGCATGG + Intronic
1028053225 7:86209356-86209378 CAGTGGCAACAGACCCAGACCGG + Intergenic
1028937857 7:96486211-96486233 GAGCGACAACAGAGTTAGCCTGG - Intronic
1030874399 7:114795259-114795281 GAGTTTCAACAGAATTATCCAGG + Intergenic
1031606006 7:123768860-123768882 CAGGGGCAACATCATTTGCCTGG - Intergenic
1031711655 7:125054389-125054411 CAGTGGCAGCAAATGTAGCCAGG - Intergenic
1031850235 7:126854284-126854306 CAGTGGCAAAAGAAAAAGCTAGG - Intronic
1033827730 7:145212458-145212480 TAGTGGCTACAGCATTAGACAGG + Intergenic
1034592409 7:152152828-152152850 CAGTAGCCACAGAATCAACCCGG - Exonic
1035461367 7:159041168-159041190 CAGTGTCCACAGAAACAGCCCGG + Intronic
1035968042 8:4216549-4216571 CAGTGGCAGCAGACTCAGGCCGG - Intronic
1036521366 8:9494519-9494541 CAGTGTCCTCAGAAATAGCCAGG - Intergenic
1037505813 8:19528155-19528177 AATGGGCTACAGAATTAGCCAGG - Intronic
1041085857 8:54255657-54255679 CCGTGGCATCAGCATTAGCTGGG + Intergenic
1041341128 8:56847058-56847080 CACTGGCAACTGAAGTATCCAGG + Intergenic
1041850957 8:62391923-62391945 CAGTTGAGACAGAATGAGCCAGG - Intronic
1041879279 8:62729072-62729094 CATTGGCAAGAGAATAAGACAGG + Intronic
1048966024 8:139615164-139615186 AAATAGCAACAGAAGTAGCCAGG + Intronic
1050184234 9:2955669-2955691 CAGTGCCAAGAGCTTTAGCCAGG - Intergenic
1050691458 9:8231953-8231975 CAGGGGAAACAAAAATAGCCAGG - Intergenic
1056716919 9:89039007-89039029 CAGCAGCAAAAGAAGTAGCCAGG + Intronic
1058369214 9:104245787-104245809 CATTTGCTACAAAATTAGCCAGG + Intergenic
1058471981 9:105289149-105289171 CAGTGGTAAGAGACCTAGCCTGG + Intronic
1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG + Intergenic
1062098289 9:134714014-134714036 CAGAAGCAACAGACTTTGCCTGG - Intronic
1186241567 X:7573269-7573291 CAGTTGCTACAAAATTAGCTGGG + Intergenic
1187628421 X:21142172-21142194 CAGTGGCAGCGGCATTAGTCAGG + Intergenic
1188537788 X:31216564-31216586 CAGTGGCAAAATAATTACACTGG + Intronic
1188720168 X:33513035-33513057 CAGTGCCAACAGAATGATACAGG - Intergenic
1188722822 X:33544055-33544077 CAGTGGCAGCAGCCATAGCCAGG - Intergenic
1190383947 X:49866155-49866177 AACTGGAAACAAAATTAGCCAGG - Intergenic
1190750727 X:53359312-53359334 CATTGGCAATAGAAAAAGCCTGG - Intergenic
1195510348 X:105709171-105709193 CAGAGCCAACAGAAGCAGCCAGG + Intronic
1201161389 Y:11169313-11169335 CAGTGGCCACAGAGTTCACCCGG + Intergenic
1201466669 Y:14289058-14289080 CAGTGGCTACAGAATTTGAGGGG + Intergenic