ID: 1091544567

View in Genome Browser
Species Human (GRCh38)
Location 12:1492872-1492894
Sequence ATTCCATGCCCCTCTCCTAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091544563_1091544567 4 Left 1091544563 12:1492845-1492867 CCCACTCCCATCACACTAGGACT 0: 1
1: 0
2: 0
3: 21
4: 257
Right 1091544567 12:1492872-1492894 ATTCCATGCCCCTCTCCTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 141
1091544566_1091544567 -3 Left 1091544566 12:1492852-1492874 CCATCACACTAGGACTTGTCATT 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1091544567 12:1492872-1492894 ATTCCATGCCCCTCTCCTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 141
1091544561_1091544567 12 Left 1091544561 12:1492837-1492859 CCAAATGTCCCACTCCCATCACA 0: 1
1: 0
2: 1
3: 23
4: 292
Right 1091544567 12:1492872-1492894 ATTCCATGCCCCTCTCCTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 141
1091544560_1091544567 23 Left 1091544560 12:1492826-1492848 CCAACACTTAACCAAATGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1091544567 12:1492872-1492894 ATTCCATGCCCCTCTCCTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 141
1091544564_1091544567 3 Left 1091544564 12:1492846-1492868 CCACTCCCATCACACTAGGACTT 0: 1
1: 0
2: 0
3: 17
4: 179
Right 1091544567 12:1492872-1492894 ATTCCATGCCCCTCTCCTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 141
1091544565_1091544567 -2 Left 1091544565 12:1492851-1492873 CCCATCACACTAGGACTTGTCAT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1091544567 12:1492872-1492894 ATTCCATGCCCCTCTCCTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091544567 Original CRISPR ATTCCATGCCCCTCTCCTAG TGG Exonic