ID: 1091547992

View in Genome Browser
Species Human (GRCh38)
Location 12:1517284-1517306
Sequence GTCCCCCTGTAGACCCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091547992_1091548003 11 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091548003 12:1517318-1517340 CTAGGGGGAGCTCCCCACCCTGG No data
1091547992_1091547997 -6 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091547997 12:1517301-1517323 GGGGACCCACTGGGCCACTAGGG No data
1091547992_1091547998 -5 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091547998 12:1517302-1517324 GGGACCCACTGGGCCACTAGGGG No data
1091547992_1091548006 21 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091548006 12:1517328-1517350 CTCCCCACCCTGGGATTTGGTGG No data
1091547992_1091548005 18 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091548005 12:1517325-1517347 GAGCTCCCCACCCTGGGATTTGG No data
1091547992_1091547999 -4 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091547999 12:1517303-1517325 GGACCCACTGGGCCACTAGGGGG No data
1091547992_1091548004 12 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091548004 12:1517319-1517341 TAGGGGGAGCTCCCCACCCTGGG No data
1091547992_1091547996 -7 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091547996 12:1517300-1517322 GGGGGACCCACTGGGCCACTAGG No data
1091547992_1091548007 22 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091548007 12:1517329-1517351 TCCCCACCCTGGGATTTGGTGGG No data
1091547992_1091548014 30 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091548014 12:1517337-1517359 CTGGGATTTGGTGGGGTCTCTGG No data
1091547992_1091548009 23 Left 1091547992 12:1517284-1517306 CCCAGGGGGGTCTACAGGGGGAC No data
Right 1091548009 12:1517330-1517352 CCCCACCCTGGGATTTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091547992 Original CRISPR GTCCCCCTGTAGACCCCCCT GGG (reversed) Intergenic
No off target data available for this crispr