ID: 1091549641

View in Genome Browser
Species Human (GRCh38)
Location 12:1528236-1528258
Sequence ACTGTAAACTTCCTGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 1, 1: 0, 2: 21, 3: 100, 4: 646}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091549637_1091549641 -5 Left 1091549637 12:1528218-1528240 CCACACCTCATTCTTCAGACTGT 0: 1
1: 0
2: 0
3: 20
4: 300
Right 1091549641 12:1528236-1528258 ACTGTAAACTTCCTGAAGGTGGG 0: 1
1: 0
2: 21
3: 100
4: 646
1091549638_1091549641 -10 Left 1091549638 12:1528223-1528245 CCTCATTCTTCAGACTGTAAACT 0: 1
1: 1
2: 3
3: 31
4: 292
Right 1091549641 12:1528236-1528258 ACTGTAAACTTCCTGAAGGTGGG 0: 1
1: 0
2: 21
3: 100
4: 646
1091549636_1091549641 0 Left 1091549636 12:1528213-1528235 CCTCTCCACACCTCATTCTTCAG 0: 1
1: 0
2: 3
3: 43
4: 437
Right 1091549641 12:1528236-1528258 ACTGTAAACTTCCTGAAGGTGGG 0: 1
1: 0
2: 21
3: 100
4: 646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091549641 Original CRISPR ACTGTAAACTTCCTGAAGGT GGG Intergenic
900921850 1:5677642-5677664 AATATAAGCTTCTTGAAGGTAGG - Intergenic
901215694 1:7554006-7554028 ACTCTAAAATTCCTGGATGTGGG + Intronic
901926840 1:12571409-12571431 ATAGTAAACTTCCTGAGGGCAGG + Intronic
902098650 1:13967025-13967047 ACTTTAAACTTCTTAAAGGCAGG + Intergenic
902243979 1:15107223-15107245 TCTGTAAGCTTCGTGAAGGCAGG - Intronic
902909590 1:19585705-19585727 ACTGTAAGCTCCATGAAGGCAGG - Intergenic
903391431 1:22966296-22966318 ACTGTAAACCTCCAAAAGGCAGG - Intergenic
903793754 1:25912754-25912776 ACTGGAAGCTTTCTGAAGGCAGG + Intergenic
903803258 1:25985635-25985657 ACTATAATCTTCCTGAAGGTAGG + Intronic
903815571 1:26061865-26061887 ACTGTAACCTCCATCAAGGTAGG + Intronic
904010514 1:27387293-27387315 GCTGTAAGCTTCATGAAGGCAGG + Intergenic
904099937 1:28016863-28016885 AATGTAAGCTGCATGAAGGTAGG - Intronic
904643711 1:31949944-31949966 ACTGTCAACTTCTTGAGGGCAGG - Intergenic
904651628 1:32010232-32010254 AGTGTAAACCTCCTGATAGTAGG - Intergenic
904743082 1:32693658-32693680 ACTGTGAACTTTCAGAAGGTAGG - Intronic
904853402 1:33476553-33476575 ACTGTAATTTTATTGAAGGTAGG + Intronic
904883892 1:33721292-33721314 AGCATAAACTTCCTGAAGGCAGG + Intronic
905006614 1:34714969-34714991 ACTGTGAGCTCCTTGAAGGTAGG + Intronic
905513779 1:38545620-38545642 AATGCATCCTTCCTGAAGGTGGG + Intergenic
906823183 1:48950491-48950513 ACTATAAACTTCCTTTGGGTGGG + Intronic
907702020 1:56797896-56797918 AATGTAAACTCTTTGAAGGTGGG + Intronic
907721190 1:56973894-56973916 ACTGGAAACTCCATGAAGGTAGG - Intergenic
907813254 1:57893517-57893539 ACTGTATGCTTCCTGAGGGCAGG - Intronic
907813504 1:57895549-57895571 ACTGTATGCTTCCTGAGGGCAGG - Intronic
908041421 1:60117993-60118015 AATGCAAACTTCATGAAGATAGG - Intergenic
908065691 1:60401699-60401721 AATGTAAACTCCCTGAGGGCAGG + Intergenic
908153621 1:61329696-61329718 TCTGTAAACTCCCTGAAGGTGGG + Intronic
908834672 1:68217094-68217116 ACTGTAAATATCCTCAAGGGAGG - Intronic
909063084 1:70901613-70901635 ACTGTAAATTCTTTGAAGGTAGG - Intronic
909388676 1:75091907-75091929 ACTGTAAACTCCATGAAGACAGG - Intergenic
909561401 1:77012944-77012966 ACTTTAAACTTCTTAAGGGTTGG + Intronic
910120196 1:83779535-83779557 AAAGTAAACATCTTGAAGGTAGG + Intergenic
910306282 1:85767938-85767960 AATGTAAACTTCATGAGAGTAGG - Intronic
910322152 1:85958444-85958466 ACTGTAAATTCCATGAAGGTAGG + Intronic
910792031 1:91061430-91061452 ACTGTAAGCTTCCTGAGGACAGG - Intergenic
910863194 1:91763632-91763654 ACTGAAAACATCCTGAATCTGGG + Intronic
910897629 1:92085124-92085146 ACTATAAACTCCCTGAGGATAGG + Intronic
911177201 1:94828694-94828716 ACTGTAAGCTCCCTGCAGGCAGG - Intronic
911736009 1:101337441-101337463 TCTGTAAACTTGCTCAAGTTTGG - Intergenic
912446637 1:109741334-109741356 AATGTAAACTTCCTGAGGGCAGG - Intronic
912649567 1:111425837-111425859 ATTATAAACTCCCTGAAAGTGGG - Intronic
912730289 1:112096286-112096308 ACTGTAAGCTCCTTGAGGGTAGG - Intergenic
912921244 1:113869268-113869290 ACTGAAAATTGACTGAAGGTGGG + Intronic
913059036 1:115187883-115187905 ACTGTAAGCTCCATGAAGGTGGG + Intergenic
914763401 1:150617290-150617312 ACTGTAAACTCCTTGAGGGCAGG + Intronic
914776434 1:150740146-150740168 AATGTAAACTTCTTCAAGGTAGG - Intronic
914936501 1:151985842-151985864 ACTGTAAGCTCCTTGAAGGTTGG + Intronic
915736032 1:158085845-158085867 ACTGTAAACTCCTTGAGGGCAGG - Intronic
916670342 1:167012533-167012555 ACTGTTAGCTTCTTGAAGGCAGG - Intronic
916887493 1:169084243-169084265 ACTGTGAGCTTCCTGAGGGCAGG - Intergenic
917539037 1:175895761-175895783 ACTGTAAGCTCCCTGAGGGCAGG - Intergenic
917708071 1:177654820-177654842 ACTGTAAACATCTAGAAGCTAGG - Intergenic
918206536 1:182314677-182314699 AATGTAAATTTCCAGAAGTTGGG + Intergenic
918242018 1:182629038-182629060 ACTGTAAATTCCTTGAAGATAGG + Intergenic
918291951 1:183117263-183117285 ACTGTAAACATCCTGAATTCAGG - Intronic
918500077 1:185184623-185184645 ATTGTGAATTTCCTAAAGGTAGG + Intronic
918645434 1:186899009-186899031 AATGTAAGTTTCCTGAGGGTAGG - Intronic
919118168 1:193307116-193307138 AATGTAAACTCCATGAAGGCAGG + Intergenic
919639333 1:200034043-200034065 ACTGGAAACTTCTTGATGGAAGG - Intronic
919775160 1:201189642-201189664 ACTGTGAACTTCATGATGGGAGG + Intergenic
919798683 1:201337440-201337462 ACTGTGAACTCCCTGAGGGCAGG + Intergenic
920056565 1:203197152-203197174 ACTGGAAGCTCCCTGAAGGCAGG + Intergenic
920442767 1:205992353-205992375 ACTGTGAAATTCCTGAAGTAAGG + Intronic
920739298 1:208565011-208565033 ACTGCAAGCTTCCTGGAGGCAGG - Intergenic
920831885 1:209472875-209472897 ATTTTAAACTTCCTGATGGCTGG + Intergenic
920847724 1:209607711-209607733 ACTGAAAACTCCCTAAGGGTAGG - Intronic
920869961 1:209785789-209785811 ACTGCAAACTTGCTGAAGGTAGG - Exonic
920988452 1:210912870-210912892 GCTCTAAGCTTCCTGAGGGTGGG - Intronic
921066019 1:211622393-211622415 ACTGTAAACTCCTGGAAGGTGGG + Intergenic
921617261 1:217284039-217284061 ATGTTAAACTTCCTGAAGGTGGG - Intergenic
921803600 1:219429858-219429880 ACTGTAAGCTTCTTGAGGGCAGG - Intergenic
923465503 1:234244713-234244735 AATTGAAACTTCCTGAAGATGGG - Intronic
923640664 1:235756432-235756454 ACTGTGAAATTCTTGAATGTAGG + Intronic
923653999 1:235899858-235899880 ACTGTGAGCTCCCTGAAGTTAGG - Intergenic
924732220 1:246722769-246722791 AATGTAAACTTCTTGAGGGCAGG + Intergenic
1062972604 10:1660395-1660417 TCTGTAAACTTCCCAAAGGTGGG - Intronic
1063563606 10:7151670-7151692 ACTGTGCATTTCTTGAAGGTAGG - Intergenic
1063778082 10:9287503-9287525 ACTGTAAGCTTCTTGAAGGCAGG - Intergenic
1064002464 10:11674907-11674929 ACTCTAAACTTCTTGAGGGCAGG - Intergenic
1064504644 10:16015415-16015437 ACTGTAAGCTCCTTGAGGGTGGG + Intergenic
1064847410 10:19670752-19670774 AATGTAAACTTCGTGAAGTCAGG + Intronic
1065129165 10:22602928-22602950 ACTTTAAACTGCCTGAGGGCAGG - Intronic
1065507806 10:26446908-26446930 ACTGGAAGCTTCTTGAGGGTAGG - Intronic
1065775144 10:29112848-29112870 ACTGTAAGCTTCCTAAGGGAGGG - Intergenic
1065799586 10:29339620-29339642 ACCGTAAGCTCCTTGAAGGTAGG + Intergenic
1065843653 10:29726950-29726972 ACTGTAAGCTCCGTGAAGGCAGG + Intronic
1065920287 10:30387060-30387082 AGTGTAAAGATCCTGAAAGTAGG + Intergenic
1066377292 10:34868909-34868931 ACTGTAATCTCCCTAAAGCTAGG + Intergenic
1068555754 10:58456836-58456858 ACTATAAACTCCTTTAAGGTAGG + Intergenic
1068850027 10:61727129-61727151 ATTATAAACTTCTTGAAGGCAGG + Intronic
1069513093 10:69056665-69056687 ACTGTGAGCTCCCTGAGGGTGGG - Intergenic
1070163346 10:73879542-73879564 ACTGTGAGCTTCTTGAAGGCAGG + Intergenic
1070401579 10:76057464-76057486 ACTGTAAGCTTCTTGAAGGCAGG - Intronic
1070425239 10:76280872-76280894 TTGGTAAACTTCCTGAAGGCAGG - Intronic
1070457105 10:76628097-76628119 ATTGAAAACACCCTGAAGGTAGG + Intergenic
1071435866 10:85647691-85647713 ACTATAAACTCCTTGAAGGCAGG - Intronic
1071590823 10:86871342-86871364 ACTCTGAACTTCATGAAGGCTGG + Intronic
1071720022 10:88134151-88134173 ACTATAAACTCCTTGAGGGTAGG - Intergenic
1071780544 10:88839643-88839665 ACTGTAACCCTCCTGAAGTTAGG + Intronic
1072638337 10:97192208-97192230 TGTGTAAACTATCTGAAGGTGGG - Intronic
1072762427 10:98067792-98067814 ACTGTAAGCTTCCTAAAAGCAGG + Intergenic
1073058987 10:100722183-100722205 ACTGTAATCTTCATAGAGGTAGG + Intergenic
1073547477 10:104363229-104363251 GCTGTGAACTCCCTGAAGGAAGG + Intronic
1073790104 10:106931319-106931341 ACTGTAAACCCCTTGATGGTAGG - Intronic
1074009042 10:109457583-109457605 ACTGCAAACTTATTGAAGGCAGG + Intergenic
1074325693 10:112448404-112448426 ACTGTCAACTATGTGAAGGTGGG + Intronic
1074679113 10:115885288-115885310 ACTGTTAGCTCCTTGAAGGTGGG + Intronic
1074693445 10:116027279-116027301 ACTATGACCTTCCTGAGGGTAGG + Intergenic
1074956774 10:118398248-118398270 TTTCTAAACTTCTTGAAGGTTGG + Intergenic
1075311032 10:121413511-121413533 AATGTAAACTTCATAAATGTAGG + Intergenic
1075396973 10:122134553-122134575 TCTGTACACTTCTTGAGGGTTGG - Intronic
1075889599 10:125935272-125935294 ACTATAAGCTTCCTGAAGGCAGG + Intronic
1078470461 11:11581959-11581981 ACTGTAAACATCCTGGGGGCAGG - Intronic
1078925324 11:15869654-15869676 ACTGTAAGCTCCATGAGGGTGGG + Intergenic
1079089374 11:17469950-17469972 ACTGTAAGCTCCATGAAGGCAGG + Intronic
1079546117 11:21633765-21633787 AATGTAAACTCCATGAAGGCAGG + Intergenic
1080462129 11:32463935-32463957 ATTGTAAACTTCATGAGGGCAGG - Intergenic
1080467562 11:32512089-32512111 GCTGTAAGCTTCCTGAAGAGGGG + Intergenic
1080650156 11:34216092-34216114 ACTGCCAACTTCATGAGGGTAGG - Intronic
1082931362 11:58609866-58609888 AATGGAAACTTCCTGAGGGAGGG - Exonic
1083168942 11:60910685-60910707 ACTGTAAACTTCATGATGGCAGG + Intergenic
1084127109 11:67106738-67106760 ACTGTAAGCTTCTTGAGGATAGG + Intergenic
1085195992 11:74672099-74672121 ACTGTAAGCTCCATGAAGGCAGG - Intergenic
1085710127 11:78821942-78821964 ATTGTAAACTTCTTGAAGGCAGG + Intronic
1086039913 11:82463649-82463671 AATGTAAAATTCATGAAGGCAGG - Intergenic
1086148749 11:83584929-83584951 ACTATAAACTACTTGAAGGCAGG - Intronic
1086222008 11:84457297-84457319 ACTGTCAACTCCCTGAAGTCAGG - Intronic
1086225793 11:84507214-84507236 ACTGTGAACTCCTTGAAGGTAGG - Intronic
1086241801 11:84702801-84702823 ACTATAAACTCCATGAAGGAGGG + Intronic
1086264012 11:84976158-84976180 ACTTTAAACTTGCTGAAGACTGG + Intronic
1086325058 11:85690306-85690328 ACTGTAATCATCCTGAGAGTTGG - Intergenic
1086577603 11:88358132-88358154 ACTATGAATTTCTTGAAGGTTGG - Intergenic
1086589709 11:88498557-88498579 AAAGAAAACTTTCTGAAGGTAGG - Intergenic
1087279800 11:96197693-96197715 ACTGTAAGCTCCCAGTAGGTAGG - Intronic
1088220270 11:107563271-107563293 ACTGTGAGCTTTCTGAAGGCGGG + Intronic
1088510335 11:110566944-110566966 AGTGCAAACTCCATGAAGGTGGG + Intergenic
1088728796 11:112662552-112662574 ACTGTGAGCTGCCTGAAGGCAGG + Intergenic
1088852941 11:113720273-113720295 ACTATAAGCTCCCTGAGGGTAGG - Intergenic
1089256143 11:117195224-117195246 ACTGTGAGCTCCCTGAGGGTGGG + Intronic
1089303132 11:117510648-117510670 AATGTAAACTCCCTGATGGCAGG + Intronic
1090594726 11:128309189-128309211 ACTGAAAACTTTCTGAATGCAGG - Intergenic
1091491332 12:935305-935327 TCTGTAGCCTTCCTGAATGTTGG - Intronic
1091549641 12:1528236-1528258 ACTGTAAACTTCCTGAAGGTGGG + Intergenic
1091731872 12:2887021-2887043 TCTTTAAACTTCATGAGGGTAGG - Intronic
1092479766 12:8849374-8849396 GCTGTAAACATGCTGAGGGTAGG - Intronic
1092810856 12:12270120-12270142 GCTGTAAGCTTCTTGAGGGTAGG - Intergenic
1093156749 12:15695637-15695659 ATTGTAAGCTCCATGAAGGTAGG - Intronic
1093268627 12:17029322-17029344 ACTGTGAAATCCCTGAAGGCAGG + Intergenic
1093657471 12:21712136-21712158 ACTATAAGCTTCTTGAAGATGGG + Intronic
1093769248 12:23000159-23000181 ACTGTCATCTTCTTGAGGGTAGG + Intergenic
1093953181 12:25187487-25187509 AATGTAAGCTTCATGAAGGCAGG + Intronic
1093961222 12:25274775-25274797 ATTGTAAACTGTGTGAAGGTAGG - Intergenic
1094066315 12:26364300-26364322 AATGTAAACATCATGAAGGTAGG + Intronic
1094360447 12:29624757-29624779 ACTGTAAGCTCCATGCAGGTGGG + Intronic
1096163109 12:49397298-49397320 AATGTAAACTGTCTGAGGGTAGG + Intronic
1096407896 12:51357223-51357245 ACTGGAAGCTTCCTGAGGGCAGG + Intronic
1096668411 12:53182156-53182178 ACTGGAAGCTCCCTGAAGGCAGG - Intronic
1096865853 12:54562332-54562354 ACTGTGGACTTCCAGAAGTTGGG + Intronic
1097346272 12:58496803-58496825 GCTATAGACTTCCTGAAGGTGGG + Intergenic
1097683641 12:62672006-62672028 ACTGTAAACACCATGAGGGTTGG + Intronic
1097687843 12:62707743-62707765 ACTGTAAACACCATGAGGGTTGG + Intronic
1097742229 12:63256571-63256593 ACTGAAAAATTTCTGAAGGTTGG + Intergenic
1097913534 12:64995825-64995847 ACTGAAAACTCACTGAAGGCAGG - Intergenic
1097960104 12:65524008-65524030 ACTGTAATCTTCATGAGGGCAGG - Intergenic
1098224606 12:68308655-68308677 AATGTAAGCTTCATGAAGGCAGG + Intronic
1098321608 12:69250182-69250204 ACTGGTAGCTTCCTCAAGGTTGG + Intronic
1098356677 12:69618739-69618761 ACTGTAAACTCCCTGAGGCCAGG + Intergenic
1098414746 12:70220216-70220238 ATTCTAGACTTCTTGAAGGTAGG + Intergenic
1098423266 12:70327698-70327720 AATGTAAGCTCCCTGAGGGTAGG + Intronic
1098598069 12:72296069-72296091 ACTGTGAACTCTTTGAAGGTAGG + Intronic
1099300576 12:80889816-80889838 CCTATAAACTTCTTGAGGGTGGG + Intronic
1099885610 12:88526567-88526589 CCTGTAAACTTCACAAAGGTAGG - Intronic
1100297540 12:93276546-93276568 ACTGTGAGCTTCTGGAAGGTGGG + Intergenic
1100787038 12:98089646-98089668 AATGTAAACTCCATGAGGGTAGG + Intergenic
1101148092 12:101860593-101860615 AATGTAAGCTTCATGCAGGTAGG - Intergenic
1101272183 12:103159448-103159470 ACTGGAAGCTTTCTGAAGGCAGG - Exonic
1101470399 12:104991464-104991486 ACTGTAAACTCCTAGAAGGCTGG - Intronic
1102739354 12:115193146-115193168 ACTACAAACTCCCTGAGGGTGGG - Intergenic
1104222201 12:126795911-126795933 ACTGTAAACTACCTGAGGGCAGG + Intergenic
1105572988 13:21621735-21621757 ACTGCAAACTTCTTGAAAGCAGG - Intergenic
1105881645 13:24611363-24611385 ACTGTAAACTCCATGGAAGTTGG + Intergenic
1106465356 13:30009191-30009213 ACTGTAAGCTCCATGAGGGTAGG + Intergenic
1106512627 13:30424427-30424449 ACTGTACATTTCCTGAAGGCAGG + Intergenic
1106719827 13:32426793-32426815 TCTGTAAGTTTCTTGAAGGTAGG - Intronic
1106998578 13:35517801-35517823 ACAGTAAACATCTTGAAGGCAGG + Intronic
1109182531 13:59230952-59230974 ATTGTAAACTTCTTGAAGGCAGG + Intergenic
1109225018 13:59683136-59683158 ATTGTAGGCTTCCTGAAGGCAGG - Intronic
1109288266 13:60438069-60438091 ACTGTAAACTTCTTGAGGGCAGG + Intronic
1109958578 13:69602098-69602120 ACTGTAAACTCCCTGAGATTGGG + Intergenic
1110063963 13:71078018-71078040 ACTGTAAACTCCTTGAAGGCTGG - Intergenic
1110120495 13:71874513-71874535 TCTGTACATTTCCTGATGGTGGG + Intergenic
1110287922 13:73771676-73771698 ACTGTAAGCTGCCTGAGGGCAGG - Intronic
1110638952 13:77799362-77799384 ATTGTAATCTTCCAGAAAGTAGG - Intergenic
1113012019 13:105779073-105779095 AATGTAACCTTCATGAGGGTGGG - Intergenic
1113057919 13:106289498-106289520 AGTGTATACTTCATGCAGGTAGG - Intergenic
1113179452 13:107608967-107608989 ACTGTGAACTCCTTGAAGGCAGG - Intronic
1114238260 14:20841667-20841689 ACTGCAAAATCACTGAAGGTAGG - Intergenic
1114498023 14:23147333-23147355 ACTGCCAACTTCCTAAAGGCAGG - Intronic
1115041501 14:28935497-28935519 ACTGAAAACTTGCTAAAAGTAGG - Intergenic
1115160068 14:30383908-30383930 ACTGTGAGCTTCTTGAATGTAGG - Intergenic
1115614426 14:35080249-35080271 GTTGTAAACTTCTTGAGGGTAGG + Intronic
1115857031 14:37641266-37641288 GCTGTAAACAGCCTGAAGCTAGG + Intronic
1117241782 14:53841045-53841067 ATTGTAAACTTCTTGAAGGCAGG + Intergenic
1117479461 14:56128771-56128793 ACTGTAAGCTCCATGAAGGCAGG - Intronic
1117561814 14:56948035-56948057 ACTACAAACTTCTTGAAGTTTGG - Intergenic
1117665213 14:58049558-58049580 TCTGCAAACTTGCTGAAGGATGG + Intronic
1117707949 14:58492591-58492613 ACTGTAAGCTGCTTAAAGGTAGG - Intronic
1117761612 14:59034943-59034965 AATGTAAGCTTCATGAGGGTAGG + Intergenic
1118689503 14:68324410-68324432 ACTGTATGCTTCTTGAGGGTAGG + Intronic
1118984344 14:70740812-70740834 ACTGTGATCTCCCTGCAGGTGGG + Intronic
1119138941 14:72247242-72247264 AATGTAAGCTCCCTGAAAGTTGG + Intronic
1119141339 14:72269964-72269986 AACGTAAACTTCCTGAGGGCAGG - Intronic
1119198403 14:72734140-72734162 ACTGTAAGCCTCCTAAAGGCAGG - Intronic
1119558368 14:75570536-75570558 ACTGTAAGCTCCATGAAGGTAGG + Intergenic
1119634705 14:76264556-76264578 ACTGTAAGCTTCTTGAGGGCAGG - Intergenic
1119880350 14:78094828-78094850 ACTGAAAGCTTCTTGAAGGTGGG + Intergenic
1120285760 14:82498967-82498989 AATGTAAACTTCTTGAAGAAAGG - Intergenic
1120307380 14:82787873-82787895 ACTTAAAAATTCTTGAAGGTGGG - Intergenic
1121028959 14:90641388-90641410 ACTGTAGACTCCCTGAAGCCTGG - Intronic
1121056481 14:90859195-90859217 ACTGTAATCCTATTGAAGGTTGG - Exonic
1121187105 14:91983220-91983242 ACTGTAAACCTCCTGAAGGCAGG + Intronic
1121743817 14:96272295-96272317 CCTGTGAACTCACTGAAGGTGGG - Intergenic
1121832220 14:97062421-97062443 ACTGTCAGCTTCCAGAGGGTAGG + Intergenic
1121873233 14:97428326-97428348 ACTGGAAGCTTGCTGAAGGCAGG - Intergenic
1122000934 14:98652208-98652230 ACTGTGAACTTCTTGAAGGTAGG - Intergenic
1122094193 14:99359431-99359453 AATGTGAACTCCATGAAGGTGGG - Intergenic
1122193769 14:100069059-100069081 AATGTAAACTCCCAGAAGGCAGG + Intronic
1122463520 14:101915744-101915766 ACTGTAAGCTCCCTGAGGCTGGG - Intronic
1122644484 14:103184444-103184466 ACTGTAGTCTGCCTGAAGCTGGG + Intergenic
1124897118 15:33787833-33787855 ATTGTAAACTTCCTGAAGGAAGG - Intronic
1125107147 15:35985497-35985519 AATTTATACTTCTTGAAGGTGGG + Intergenic
1125212649 15:37235072-37235094 ACTGTAAACTTCTTCAAGTTGGG - Intergenic
1125266644 15:37889028-37889050 ATTGTAATTTTCCTTAAGGTAGG + Intergenic
1125452589 15:39824568-39824590 ACTGTAAGTTTTATGAAGGTAGG + Intronic
1126111996 15:45180793-45180815 ACTGTGAGCTTCCTGAGGGCAGG + Intronic
1126335686 15:47584056-47584078 TCTGTAAACTTCTTGAGGGCAGG + Intronic
1126802913 15:52316525-52316547 ACTGTAAGCTCCTTGAAGGCAGG + Intronic
1127076876 15:55335475-55335497 AATGTAAACTTCATGAAGGCAGG - Intronic
1127201382 15:56656149-56656171 ACTGTACATTCCCTGAAGGCTGG + Intronic
1128280965 15:66394014-66394036 AGTGTAAGCTTCATGATGGTTGG + Intronic
1129942497 15:79510468-79510490 ACTGTAAGCTCCCTGGAGGTAGG + Intergenic
1130346119 15:83047112-83047134 ATTGTAAACTCCTTGAAGGCAGG - Intronic
1130510066 15:84581942-84581964 AGTGTAAAGATCCTGAAAGTAGG + Intergenic
1130825056 15:87535339-87535361 ACTGTAAACTTCTTGAAGGAAGG + Intergenic
1131028312 15:89164173-89164195 ACTGGGATCTTCCTGAAGGCAGG - Intronic
1131288891 15:91087421-91087443 ACTGTAAGCTCCTTGATGGTGGG + Intergenic
1131812845 15:96190620-96190642 ACTTTAAACGTCCAGAAGATCGG + Intergenic
1132129839 15:99265636-99265658 ACTCTAAAGTTCCTCAAGGGAGG + Intronic
1133431269 16:5739130-5739152 GCTGTAAACTTCTTGAGTGTAGG + Intergenic
1133618168 16:7499215-7499237 TCAGTAAACTTCCAGAAGATAGG - Intronic
1133758461 16:8779861-8779883 ACTGCATGCTTCCTGAAGGAAGG - Intronic
1133846866 16:9462942-9462964 AATGCAAGCTTCATGAAGGTGGG - Intergenic
1133892237 16:9891568-9891590 ACTCTAAACTTCTTGAGGGTGGG - Intronic
1133982848 16:10646451-10646473 ACTGTAAAATCCTTGAAGGCAGG - Intronic
1134141045 16:11719724-11719746 ACTGTAAGATTTCTGAGGGTAGG - Intronic
1135161215 16:20098203-20098225 ACTGTAATCTCCTTGAAGGCAGG - Intergenic
1135355735 16:21767572-21767594 ACTGTAAGCTTCATGAAAGCAGG - Intergenic
1135454225 16:22583718-22583740 ACTGTAAGCTTCATGAAAGCAGG - Intergenic
1135668933 16:24358627-24358649 ACTGTAAACTCCCTGAGGGCAGG - Intronic
1136124467 16:28167652-28167674 AGTGTAAATTACCTGAGGGTGGG + Intronic
1137381165 16:48001038-48001060 ACTGTAAGCCTCCTGAGGTTGGG + Intergenic
1137925428 16:52536146-52536168 AATGTAAACTTCATGAGGATAGG - Intronic
1138369903 16:56518768-56518790 ACTATAAGCTTTCTGAAAGTAGG + Intronic
1139034914 16:62932739-62932761 AGTGTATACTTCTTGAAGGCAGG + Intergenic
1139761850 16:69190471-69190493 ACTCTAAACTTCCTGAGGACAGG - Intronic
1140975325 16:80054511-80054533 ACTGTAAGCTCAATGAAGGTAGG + Intergenic
1141110964 16:81270375-81270397 ACGGCAAACCTCCTGAGGGTGGG - Exonic
1141401462 16:83750712-83750734 CCTGTAAACTTCCAGCAGCTGGG + Intronic
1141524216 16:84601267-84601289 ACTGTATATTTTTTGAAGGTAGG - Intronic
1143619950 17:8075076-8075098 ACTGTGAACTCCTTGAAGGCAGG + Intronic
1143874367 17:9980714-9980736 ACTGTAAGCTCCCTGAGGGTGGG - Intronic
1144215100 17:13048434-13048456 ACTGTAAGCTACCTGAGGGCAGG + Intergenic
1144701618 17:17344336-17344358 GCTGTAAGCTCCCTGAGGGTAGG + Intronic
1144769168 17:17749764-17749786 ACTGTAAGCTCCATGAAAGTGGG + Intronic
1145003715 17:19323131-19323153 ACTGTAAACTCCCTGGAGTGAGG - Intronic
1145092520 17:19997787-19997809 AATGGATACTTCCTGCAGGTAGG - Intergenic
1145824914 17:27869661-27869683 ACTGTTTCCTTCTTGAAGGTTGG - Intronic
1146565633 17:33910608-33910630 ACTATAAACTTCATGAGGGCAGG + Intronic
1147114108 17:38286052-38286074 ATTGTCAAATTCCTGAGGGTTGG - Intergenic
1148252263 17:46093824-46093846 AATGTAAGCTTCATGAAGGTAGG + Intronic
1148368954 17:47080105-47080127 AATGTAAGCTTCATGAAGGTAGG + Intergenic
1148415496 17:47503138-47503160 ATTGTCAAATTCCTGAGGGTTGG + Intergenic
1149107617 17:52988268-52988290 AATGTAAACTCAGTGAAGGTGGG - Intergenic
1149288821 17:55195764-55195786 GCTGTAAACTTCTTGAGGGCAGG + Intergenic
1149518541 17:57300265-57300287 ATTGGAAGCTTCCTGAGGGTGGG + Intronic
1150123025 17:62619030-62619052 GCTGTAAGCTTCCTTAAGGCAGG - Intergenic
1150237162 17:63602384-63602406 ACCATAAACTACCTCAAGGTGGG - Intronic
1150280685 17:63928280-63928302 ACTGGAAGCTCCCTGAGGGTAGG - Intergenic
1150494687 17:65598119-65598141 ACTGTAAGCTTTCTGAGAGTAGG + Intronic
1150535103 17:66030326-66030348 ACTGAAACCTTCCTGAGGATAGG - Intronic
1150638233 17:66931629-66931651 ACTGTAAGTTTCCTGAAGGTAGG - Intergenic
1152920924 17:83066255-83066277 CCAGGAAACTTCCCGAAGGTCGG - Intergenic
1153334817 18:3912508-3912530 ACTGTAAGCTCCCTGAGGGAAGG - Intronic
1153423883 18:4941486-4941508 AATGTAAGCTCCATGAAGGTAGG + Intergenic
1153674730 18:7446799-7446821 ACTGTGTAATTACTGAAGGTGGG + Intergenic
1153986486 18:10355554-10355576 ACTGTAAGCTTTCTGAGGGCAGG - Intergenic
1154971444 18:21413578-21413600 ACGGTAAACTCCTTGAAGGTAGG + Intronic
1155528802 18:26744873-26744895 ACTGTGAGCTGCTTGAAGGTAGG + Intergenic
1156019339 18:32581658-32581680 ACTGTAAGCCTCCTGAGGATGGG + Intergenic
1156110294 18:33718181-33718203 ACTATAATCTCCCTGAAGGCAGG - Intronic
1156801467 18:41119892-41119914 ACTCTAAATTTCCTGAGGGCTGG + Intergenic
1156879810 18:42063269-42063291 AATGTAAACTTCATGAATGTGGG + Intronic
1156882565 18:42098482-42098504 ACTGTAAGTTCCCTGAAGGCAGG + Intergenic
1157187164 18:45550478-45550500 ACTGTGAGCTCTCTGAAGGTAGG + Intronic
1157233335 18:45939918-45939940 AATGTAAGCTCCATGAAGGTAGG - Intronic
1157419932 18:47538634-47538656 AATGTAAACTTCCCGTGGGTGGG - Intergenic
1157527579 18:48396358-48396380 ATTGAAAGCTTCCTGAAGGCAGG - Intronic
1157761907 18:50271715-50271737 ATTATAAGCTCCCTGAAGGTAGG + Intronic
1158357722 18:56639175-56639197 ACCGTGAACTTCCTAAAGGAGGG - Intronic
1159967637 18:74611074-74611096 ACAGGAAACTTCCTGAGGGTGGG + Intronic
1160135854 18:76271154-76271176 ACTGTAAGCTCCTTGAGGGTGGG + Intergenic
1162188379 19:8924983-8925005 ACTGTAAACTTGGTGAGGGGAGG + Intronic
1163043985 19:14625418-14625440 ACTGCAAACTTCCTCTAGTTTGG - Intronic
1164741000 19:30575606-30575628 ACTGTGAGCTGCCTGAAGGCAGG - Intronic
1165206210 19:34189056-34189078 ACTGTAACTTCCCTGAGGGTGGG + Intronic
1165696586 19:37905892-37905914 ACTGAAAACTCCCTGAAGGTAGG + Intronic
1166137334 19:40785787-40785809 ACTGTGAGCTCCATGAAGGTTGG - Intronic
1166392704 19:42418866-42418888 ATTGTAAACTCCCTGAGGGCAGG + Intronic
1166850330 19:45757026-45757048 ACTGTAAGCTCCCTGAGGATGGG + Intronic
925702709 2:6655007-6655029 ACTGGAAACTTCTTGGATGTTGG - Intergenic
925818332 2:7775160-7775182 ATTGTAAATTTCATAAAGGTAGG - Intergenic
926388691 2:12364645-12364667 ACTGTAAACTCCTAGAAAGTAGG - Intergenic
926788203 2:16540573-16540595 ACTTTAAACTTCATGAAGTCAGG - Intergenic
926844087 2:17114689-17114711 ATGGTAAACTTCCTGAAGAGAGG + Intergenic
926935070 2:18078839-18078861 ACTATAAGCTCCATGAAGGTAGG + Intronic
926994485 2:18719541-18719563 ACTGTGAATTTACTGAAGATGGG - Intergenic
927369229 2:22335477-22335499 AATGTAAGCTCCCTGAAGGCAGG - Intergenic
927415461 2:22874686-22874708 ACTGGGAGCTTCTTGAAGGTAGG + Intergenic
928152191 2:28841662-28841684 ACTCTAAGATTCTTGAAGGTAGG + Intronic
928373507 2:30757756-30757778 ACTGTAACCTTCTGGAGGGTGGG + Intronic
928602171 2:32914263-32914285 ACTGTAAATCTCATGAAAGTAGG + Intergenic
929403814 2:41616876-41616898 AATGTAATCTCCCTGAAGGCAGG - Intergenic
929723975 2:44404084-44404106 ACTGTAAGCTTCCAGAAGGCAGG + Intronic
930092064 2:47538184-47538206 AATGTAAGCTTCTTGAGGGTAGG - Intronic
930353734 2:50291202-50291224 ACTGTTCAGTTCCTGAAAGTGGG - Intronic
931177780 2:59870823-59870845 GCTGTAAACTTCTTGATGGCAGG + Intergenic
931206864 2:60156041-60156063 ATTGTAAACTTCTTGAAGGCAGG - Intergenic
932050301 2:68391551-68391573 ACTTTCTACTTCCTGAAGGATGG - Intronic
932417866 2:71584510-71584532 ACTCTGAGCTTCCTGAAGGTAGG + Intronic
932845194 2:75128031-75128053 ACGGTAAGCTTCCTGAGGGCAGG + Intronic
933179078 2:79209896-79209918 ACTTTAAACTTACTGCAGCTAGG - Intronic
933262254 2:80143731-80143753 ACTTGAAACTGCCTGAAGGAGGG + Intronic
933368630 2:81387748-81387770 ACTGTAGCCATCCTGAGGGTTGG - Intergenic
933527928 2:83467373-83467395 ACTCTAAACTTCCTGAAGGCAGG - Intergenic
935348113 2:102127512-102127534 AATGTAAGCTTCATGAGGGTAGG - Intronic
935602170 2:104933872-104933894 ATTGTAAGCTTCCTGAAGGTGGG - Intergenic
935716188 2:105940885-105940907 ACTGTAAGCTCCTTGAAGGCAGG - Intergenic
935816670 2:106852490-106852512 CCTGTAAGGTTCCCGAAGGTGGG + Intronic
936919931 2:117677420-117677442 ACTGTAAGCTTTCTGAAGTAAGG - Intergenic
937397973 2:121555434-121555456 ACTGCAACCTTCCAGAAGATAGG + Intronic
938012679 2:127841433-127841455 AATGTAAACTTCCCGAGGGAGGG + Intergenic
939759696 2:146159039-146159061 ACTATAAGCTTCCAGAAGTTAGG + Intergenic
939997722 2:148935872-148935894 ACTGCATACTTCCTAAAGATAGG - Intronic
941224994 2:162838089-162838111 ACTGTAGACTTTCTGAAAGTCGG - Intronic
941291826 2:163685086-163685108 ACTGTAACTTTCTTTAAGGTTGG + Intronic
941794400 2:169584082-169584104 ACTGGAAGCTCCATGAAGGTAGG + Intergenic
941822679 2:169858187-169858209 ACTGTAATCTTCCAGAGGCTTGG + Intronic
942143127 2:172998087-172998109 ATTATAAGCTTCCTGAAGGCAGG - Intronic
942169220 2:173273529-173273551 ATTATAAGCTTCTTGAAGGTAGG + Intergenic
942228842 2:173840834-173840856 ACAGAAATCTTCTTGAAGGTTGG - Intergenic
942432100 2:175922885-175922907 ACTATGAACTTCTTGAAGGCAGG - Intergenic
942472113 2:176270767-176270789 ATTGCAAGCTTCCTGAAAGTAGG + Intronic
942886218 2:180927187-180927209 ACTGGATACTTCCTGTATGTGGG + Intergenic
944312647 2:198251300-198251322 ACTGTCAGCTGCCTGGAGGTAGG - Intronic
944441220 2:199745272-199745294 AATGTAAACTCCATGAAGATAGG - Intergenic
944981504 2:205126076-205126098 ACTGTAAACTTCATTAAAGTAGG - Intronic
945084331 2:206116359-206116381 ACTGTAATCTGCCTGAAGTTGGG - Intronic
945657193 2:212639203-212639225 AATGTAAACTTCAGGAAGGCAGG + Intergenic
945902174 2:215551088-215551110 ACTGTGAACTCCCTGAGGGCAGG - Intergenic
946162962 2:217847270-217847292 ACTGTAAATTTCTTGAGGGCAGG + Intronic
946169127 2:217884030-217884052 ACTGTGAACTCCCTGAGGGTAGG + Intronic
946654367 2:221930054-221930076 ACTGTATGCTTCATGAAGGCAGG - Intergenic
947116911 2:226781713-226781735 CCTGTACACTTTCTGAAGGTCGG + Intronic
947963191 2:234257373-234257395 AATGTAAGCTTCCTGAGGGTAGG - Intergenic
1168956747 20:1839568-1839590 ACTGTGAGCTTCCTGAGGGTAGG - Intergenic
1168994273 20:2121050-2121072 ACTGTGAAGGTCCTGAAAGTTGG + Intronic
1169100332 20:2941996-2942018 ACTGTAAGCTTCATGAAGATAGG + Intronic
1169552867 20:6719007-6719029 ACTGAAAACTTCTTGAGGGCAGG + Intergenic
1169892736 20:10471341-10471363 ACTGCAAACTACCTGAGGTTAGG - Intronic
1170097247 20:12659718-12659740 ACTGTAAACTTCCAGAGAGCAGG + Intergenic
1170278013 20:14614540-14614562 ATTATAAACTTCCTGAGGGCAGG + Intronic
1170443129 20:16398673-16398695 CCTATATACTTGCTGAAGGTGGG + Intronic
1171077290 20:22141280-22141302 GCTGTAAACTCCATTAAGGTAGG - Intergenic
1171989332 20:31683809-31683831 AATGTGAACTTCATGAAGGCAGG + Intronic
1172189676 20:33054338-33054360 CCTGTAAACTCCATGAAGGCAGG - Intergenic
1172258974 20:33545045-33545067 ACTGTAAGCTTCATGAGAGTTGG - Intronic
1172310529 20:33914816-33914838 ACTGTAAGTTCCATGAAGGTAGG + Intergenic
1172672569 20:36644463-36644485 ACTGTGGTCTTCCTGAAGGAGGG - Intronic
1172828301 20:37809130-37809152 ACTGTAAATTTGCTGAGGGCTGG - Intronic
1173306478 20:41855464-41855486 ACTGTAAACTCTGTGAAGGCAGG + Intergenic
1173315174 20:41936676-41936698 ACTGTAAGCTTCATGAGGATAGG + Intergenic
1174251907 20:49226206-49226228 ACTGTAAGATTCCTGAGGGCAGG + Intronic
1174461184 20:50684098-50684120 AATGTGAGTTTCCTGAAGGTAGG - Intronic
1174540100 20:51282471-51282493 ACAGAAAACTTCCTGAAAGGAGG - Intergenic
1175573599 20:60042718-60042740 ACTTTAAACATCCTGAGGCTTGG - Intergenic
1175597797 20:60249222-60249244 ACTGTAAACTTCATGGAAGCAGG + Intergenic
1177707498 21:24726384-24726406 AGTGTAATCTTCATGAGGGTGGG - Intergenic
1177772318 21:25530506-25530528 AATGTAAACTTCGTGAAGACTGG + Intergenic
1178643641 21:34366604-34366626 TCACTAAACATCCTGAAGGTAGG + Intronic
1180620106 22:17155662-17155684 TCTGTGTACATCCTGAAGGTTGG - Intronic
1181504359 22:23341734-23341756 ACTGTGAACTCCTTGAAAGTAGG + Intergenic
1181655471 22:24294345-24294367 ACTGTGAACTCCTTGAAAGTAGG + Intronic
1181689689 22:24551781-24551803 ACGGCAAGCTTCCTGAAGGCAGG + Intronic
1181709350 22:24671968-24671990 ACTGTGAACTCCTTGAAAGTAGG + Intergenic
1181900115 22:26146899-26146921 ACTGTGAGCTCCTTGAAGGTGGG + Intergenic
1182120087 22:27780773-27780795 AATGTAAACTCCATGAAGGCAGG + Intronic
1182879958 22:33724802-33724824 ACTGTAAACTCCCTGAGGGCAGG - Intronic
1182896656 22:33864554-33864576 ACTGTAAGCTCCTTGAGGGTAGG + Intronic
1182925035 22:34114302-34114324 ACCATAAACTTCATGAAGGGAGG - Intergenic
1183121142 22:35731201-35731223 AATGAAAACTTCGTGAAGGCAGG - Intergenic
1183838164 22:40474692-40474714 ACTGTAAACTCACTGAAGGTGGG - Intronic
1185263649 22:49885815-49885837 ACTCTCAGCTTCCTTAAGGTGGG - Exonic
949317855 3:2776617-2776639 ACTGTAAACTTCTTGAGGAAAGG + Intronic
949550110 3:5105413-5105435 ACTGTAAACTCTCAGAAGGAGGG + Intergenic
949734932 3:7160866-7160888 ATTGCAAACTTGCTAAAGGTAGG + Intronic
949904979 3:8851809-8851831 ACTGTGAGCTTCCTGAGGTTAGG - Intronic
949922769 3:9015870-9015892 ACTTTAAACTTGCTGAAGTGGGG - Intronic
950912607 3:16610433-16610455 ACTGGAAGCTTACTAAAGGTTGG - Intronic
952571684 3:34725336-34725358 ACTGTCAGCTTCCTGAAAGCAGG + Intergenic
952761192 3:36915622-36915644 ACAGTAAACTTCTGGAAGGTGGG - Intronic
952828248 3:37541780-37541802 CATGTAAACTACCTGAAGGCAGG + Intronic
953414199 3:42706080-42706102 ACTGGAAACTCCCTGAAAGGAGG + Intronic
953417595 3:42731822-42731844 ACTGTAAGCTCCATGAGGGTAGG + Intronic
953790182 3:45941441-45941463 ACTTTGAACTTCCTAAGGGTGGG - Intronic
954176754 3:48850979-48851001 ACTGCATACTTTCTGCAGGTGGG - Intergenic
955147623 3:56335896-56335918 ACCATAAGCTTCCTGAAGGCTGG - Intronic
955499885 3:59573155-59573177 AATGTAAACTCCATGAAGGTGGG + Intergenic
955698822 3:61663252-61663274 ATTGTAATCTCCATGAAGGTAGG + Intronic
955766958 3:62355010-62355032 AGTGTAAGCTTCGTGAAGGCAGG - Intergenic
955863843 3:63360930-63360952 AATGTAAACTCCATGAAGGCAGG + Intronic
956694157 3:71904452-71904474 AGTGTAAACTCCCTAAGGGTTGG - Intergenic
956882559 3:73525924-73525946 ACTGTGAGCTTCCTGAGGGCAGG + Intronic
956979490 3:74618904-74618926 AATGTAAGCTTCATGAAGGTAGG + Intergenic
957195601 3:77063137-77063159 ACTGAAAACATCATGAGGGTGGG + Intronic
957549729 3:81688326-81688348 ACTGCCAGCTTTCTGAAGGTAGG + Intronic
957911198 3:86621720-86621742 ACTGTAGCCATCCTGAAGGCTGG - Intergenic
958904331 3:99925360-99925382 ACTGTGAACTCCCTGAAAGCTGG + Intronic
958958972 3:100491329-100491351 ACTGCACAGTTTCTGAAGGTTGG - Intergenic
959634436 3:108547325-108547347 AATGTAAACTTAGTGAAGGCTGG + Intergenic
959937071 3:112040262-112040284 TCTGTGAGCTTTCTGAAGGTAGG - Intronic
960041934 3:113158822-113158844 ATTGTAAACTTTTTGAGGGTAGG - Intergenic
960066396 3:113378237-113378259 AATGAAGACTTCCTGAAGGCAGG + Intronic
960226076 3:115170225-115170247 ACTATAAGCTTTGTGAAGGTAGG + Intergenic
960416958 3:117396757-117396779 ACTGTAACCTCCATGAAGGCAGG + Intergenic
960906864 3:122610346-122610368 ACTGTAAGCTCCTTGAGGGTGGG + Intronic
961047305 3:123718358-123718380 ACTGTAAGCTCCCTGCAGGGAGG - Intronic
961175742 3:124833828-124833850 ATAGTAAACTCCCTGAAGGCAGG - Intronic
961270655 3:125685274-125685296 ACTGTAAGCTCCCTGCAGGGAGG + Intergenic
961388261 3:126536638-126536660 ACTGTAAACTTCCTGAGGGCAGG - Intronic
961657430 3:128451033-128451055 ACTATAACCCACCTGAAGGTAGG + Intergenic
962086528 3:132197499-132197521 ACTGTAACCTACTTGAGGGTAGG + Intronic
962630557 3:137271371-137271393 ACTATAAACTCTCTGAAAGTAGG + Intergenic
962848993 3:139293925-139293947 ACTATAAGCTCCCTGAAGGCAGG - Intronic
963122990 3:141792065-141792087 ACTGTAAGCTTCATGAAGGCAGG - Intronic
963252416 3:143115480-143115502 AGTGTAAACTTCATGAAGGTAGG + Intergenic
963322869 3:143828419-143828441 ACTGTAAACTTCACAAAGGCAGG - Intronic
963812848 3:149796529-149796551 ACTGTGAGCTTCCTGATGGTGGG + Intronic
964908870 3:161753280-161753302 AATGTAAACTTTGTGAAGGCAGG + Intergenic
965167240 3:165210756-165210778 ACTGTAAACTCCTTAAAGGCAGG + Intergenic
965246907 3:166284244-166284266 AATGTAAAAATCCTTAAGGTGGG - Intergenic
965329718 3:167356755-167356777 AATGTAAACTTCATGAGGGTAGG - Intronic
965409206 3:168308491-168308513 ACTGTGAGCTTCTTGAAGGCAGG + Intergenic
965556984 3:170028647-170028669 AATGTAAGCCTCATGAAGGTAGG - Intergenic
965610594 3:170539607-170539629 ACTGCAAACTCCTTGAAGGTAGG + Intronic
965644275 3:170863541-170863563 ATTGTAATCTTCATGAAGGCAGG + Intergenic
965784529 3:172321933-172321955 ACTGTAAACAGCTAGAAGGTGGG - Intronic
966020264 3:175201135-175201157 AATATAAAATCCCTGAAGGTTGG + Intronic
966537333 3:181049410-181049432 ACAGGAAACTTCCTGAGGCTAGG + Intergenic
966564066 3:181356491-181356513 ACTGTAAGCTCCATGAAGGCAGG - Intergenic
966625125 3:182007515-182007537 ACTGTGAACTTCTTGAGGGTAGG - Intergenic
966929467 3:184666418-184666440 ACTGTCAGCTTCCTAAAGGCAGG - Intronic
967069276 3:185948356-185948378 ACTCTAAGCTTCAGGAAGGTAGG + Intergenic
967282086 3:187832708-187832730 ACTGCAAAGTTCTTGAAGGCAGG + Intergenic
967409212 3:189150558-189150580 ACTGTTAACTCCTTGAAGGAAGG + Intronic
967522902 3:190455454-190455476 AATGTAAACTTCATGAAGAAAGG + Intergenic
967832638 3:193933628-193933650 ACTGTAAACTCCATGAGGGCAGG + Intergenic
967865637 3:194187736-194187758 ACTCTGAACTCCCTGAAGGCAGG + Intergenic
969387979 4:6869078-6869100 ACTGTAAGCTTCCTGAGGGGCGG - Intronic
969407135 4:7001006-7001028 ACTCTAAGCTTCCTGAGGGCAGG + Intronic
970012770 4:11478653-11478675 ACTATAAACTTTATGAAGGTAGG + Intergenic
970012774 4:11478697-11478719 ACTATAAACTTTATGAAGGTAGG + Intergenic
970507485 4:16746161-16746183 TCTGTAAGCTTACTGAGGGTGGG - Intronic
970561793 4:17288804-17288826 ACTGTAAGCTTCATGAGGGCAGG - Intergenic
970722426 4:19003336-19003358 AATGTAAACTCCATGAAGGAAGG - Intergenic
971011761 4:22445650-22445672 ACTGTGAACTTCCCTAGGGTAGG + Intronic
971196653 4:24476640-24476662 ACTGTAAACTTCTTGAAGGCAGG - Intergenic
971747434 4:30601796-30601818 TCTGTAATTTTCCTGAAGGCAGG - Intergenic
971802595 4:31311558-31311580 ACTGTAACCTTATTGAAGGAGGG - Intergenic
972254674 4:37340488-37340510 ACTGTAAACTCCATGAGGGCAGG - Intronic
972559154 4:40211112-40211134 ACTGTAAACATCTTAAAAGTGGG + Intronic
973687534 4:53387857-53387879 AATGTAAACATCGTGAAGGCAGG + Intronic
973770883 4:54205393-54205415 ACTGAGAACTCCCTGAAGGCAGG + Intronic
973939188 4:55887435-55887457 AATGTAAACTTCATAAAGGTAGG - Intronic
974800348 4:66809570-66809592 ACTATAAACTTCTTTAAAGTTGG + Intergenic
974943713 4:68500748-68500770 ACTGTAAACTCCATGAGGGTGGG + Intergenic
975082105 4:70294233-70294255 ACTGAAAACTTCCTTAATCTGGG - Intergenic
975087376 4:70358385-70358407 TCTGTAAACTTTCTGAAAGTTGG - Intergenic
975147097 4:70980504-70980526 ACTGTGAGCTTCTTAAAGGTAGG + Intronic
975200738 4:71585346-71585368 ACTGAAAACTCCATGAAGGCAGG - Intergenic
975353392 4:73370781-73370803 AATGTAAATTCCATGAAGGTAGG + Intergenic
975414704 4:74093176-74093198 ACTGTAAACTTCTAGAGGCTAGG - Intergenic
975532519 4:75415466-75415488 ATTATAAATTTCCTGAAGGCTGG - Intergenic
975553472 4:75636698-75636720 AATGCAAATTTCCTAAAGGTAGG + Intergenic
975702235 4:77077089-77077111 ACTGTAAACTCCATGAAGGCAGG - Intergenic
975794279 4:77989857-77989879 ACTGTGAGCTCCATGAAGGTAGG + Intergenic
976135115 4:81927331-81927353 ACTGCAAACTCCCTAAAAGTGGG + Intronic
976222838 4:82771883-82771905 ACTGGAAGCTCCCTGAGGGTAGG - Intronic
976445024 4:85120086-85120108 AATGTCAACTCACTGAAGGTAGG + Intergenic
976659971 4:87530559-87530581 GCTGTAAACTCCTTGAAGGAAGG + Intronic
976973061 4:91132605-91132627 ACTGTGAACTCCTTGAAGGGAGG - Intronic
977158573 4:93605747-93605769 ACTGTAAACTTCTGGTAGGCTGG - Intronic
977165264 4:93686969-93686991 ACTGAAAACCGCCTGAAAGTGGG + Intronic
977224290 4:94375977-94375999 ACTGTAAGCTTTTTGAAGGCTGG + Intergenic
977697192 4:99979821-99979843 AATGTAAGCTCCTTGAAGGTAGG - Intergenic
977767212 4:100813246-100813268 ATTATAAACTTTCTGAAGGCAGG - Intronic
977984550 4:103366703-103366725 ACTGTAAGCTTCATGAAAGTAGG - Intergenic
978228355 4:106366376-106366398 ACTGTAAACTTTCTGAAGGAAGG + Intergenic
978981083 4:114946304-114946326 AATGTAAGCTCCCTGAAGGCAGG - Intronic
979229645 4:118332921-118332943 GCAGTAAACTTCCTGAGGGCCGG - Intronic
980527043 4:134003652-134003674 ACTATAAACTCCCTGAACATGGG - Intergenic
981098438 4:140805583-140805605 ACTGCAAACTCCCTGAGGGTAGG - Intergenic
981289469 4:143057215-143057237 ATTGTTAGCTTCCTGAAAGTAGG - Intergenic
982044438 4:151429046-151429068 GCTGTACACTTCATGAAGGCAGG + Intronic
982044451 4:151429203-151429225 GCTGTACACTTCATGAAGGCAGG + Intronic
982100703 4:151964976-151964998 ACTGCAAACTTCCTGAGGGCAGG - Intergenic
982273353 4:153614568-153614590 ACTGTGATCTTCCTGAATGAAGG + Intronic
982981703 4:162145797-162145819 ACATTAAACTTCCTAAAGTTTGG - Intronic
983024581 4:162717772-162717794 AGTATAAACTTTCTGAGGGTAGG + Intergenic
983202050 4:164871926-164871948 AATGTAAACTTCATGAGGGTAGG - Intergenic
983246753 4:165296442-165296464 ACTGTGCAATTTCTGAAGGTAGG - Intronic
983747678 4:171221815-171221837 TCTGAGAACTTCCTGAAGTTAGG - Intergenic
984222998 4:177001051-177001073 ACTGTAAACTCCGTGCAGTTGGG + Intergenic
985044223 4:185924178-185924200 ACTGCAAGCTCCCTGAAGGCAGG - Intronic
985977394 5:3430869-3430891 AGGGTAAAATTCCTGAATGTAGG - Intergenic
986440882 5:7780704-7780726 AATGTAAAGTTTTTGAAGGTGGG + Intronic
986831589 5:11585612-11585634 AATGTAAACTTCATGAAGGCAGG - Intronic
988425691 5:31060971-31060993 ACTGTAAGCTTCATGAAAGCAGG + Intergenic
988577120 5:32437285-32437307 AGTGTAAACTCCCTGAAAGCAGG + Intronic
988768758 5:34409734-34409756 AGTGTAAACTTCTTGAGTGTAGG - Intergenic
989358408 5:40571404-40571426 ACTGTTAGCATCCTGAAGGCAGG - Intergenic
989427542 5:41314219-41314241 ACTGTGTACTTTCTGAAGGCAGG - Intronic
989712209 5:44412936-44412958 ACTATAAACTGCCTCATGGTAGG - Intergenic
990399429 5:55423252-55423274 AATGTAAACTCCATGAAGGCAGG - Intronic
990644520 5:57829182-57829204 ACTGTATACTCCATGAAGGGAGG - Intergenic
991014981 5:61922062-61922084 ACTGTAAGCTCCATGCAGGTAGG + Intergenic
991478103 5:67045090-67045112 ATTATAAACTTCTTGAAGGCAGG + Intronic
991660867 5:68949587-68949609 GCTGCAAGCTTCCTGAAGGACGG + Intergenic
991710017 5:69399634-69399656 ACTGTTAGCTTCTTGAAGGCAGG + Intronic
992162817 5:74018950-74018972 ACTGTGAACTTCCCGAGGGCAGG - Intergenic
992195640 5:74336384-74336406 ATTATAAACTTCTTGAAGTTGGG + Intergenic
992625465 5:78632704-78632726 ACTGTAAGCTCCCTGAGGGCAGG - Intronic
992656553 5:78916054-78916076 ATTGTAAAATTACTGAAGTTCGG + Intronic
992664582 5:78994627-78994649 TCTATAAACTTCATGAAGGCAGG + Intergenic
992735648 5:79717341-79717363 ACTGTAAACTTTCTGTAAGCAGG - Intronic
993017099 5:82546426-82546448 AATGTAAATTTCATGAAGCTAGG + Intergenic
993167106 5:84371030-84371052 ACTGTAAGCTTGATGAAGGCAGG - Intronic
993189211 5:84659612-84659634 ACTGTGAACTTTTTGAGGGTGGG - Intergenic
993468233 5:88273647-88273669 AATGTAAATTTCCTGATAGTAGG - Intergenic
993471793 5:88315404-88315426 ATTGAAATCTTCATGAAGGTAGG + Intergenic
993604738 5:89975060-89975082 AATGTAAACTTGATGAGGGTAGG + Intergenic
993632662 5:90305297-90305319 AATGTAAACATTCTGAATGTAGG + Intergenic
994059203 5:95455534-95455556 ACTATAAATTCCCTGAAGGCAGG - Intergenic
994194823 5:96910920-96910942 ATTGTAAGCTTCTTGAAGGTAGG - Intronic
995056068 5:107760234-107760256 ATTGTAAACTTATTGAAGGCAGG - Intergenic
995574277 5:113513405-113513427 AATATAAACTCCATGAAGGTAGG + Intergenic
995739975 5:115346193-115346215 AATGTAAACTCCATGAAGGTAGG - Intergenic
997311856 5:132892551-132892573 ACTGTAAATTCCATGAAGGTAGG + Intronic
997387031 5:133481726-133481748 ACTGTAAGCTCCATGTAGGTAGG - Intronic
997643274 5:135463767-135463789 AATGCAAGCTTCCTGAAGGAAGG - Intergenic
997905993 5:137817831-137817853 ACTGTAAACTCCATGAGGGCAGG - Intergenic
998350593 5:141497983-141498005 ACTGTAAACTCCTTGAGGGCAGG - Intronic
998410741 5:141909384-141909406 ACTGTAAACTCCATGAGGGCAGG + Intergenic
998629391 5:143881580-143881602 ACTGCAAACTTCCTGAAGGCAGG + Intergenic
998783711 5:145686228-145686250 ATTATAAACTCCCTGTAGGTAGG + Intronic
998833870 5:146185776-146185798 ACTGTAAGCTCCATGAAGGAAGG - Intergenic
998910908 5:146959349-146959371 ACTGTAAGCTTTCTGAAGGCAGG - Intronic
999180613 5:149667572-149667594 ACTGTGAGGTTCCTGAAGGAAGG + Intergenic
999690138 5:154139361-154139383 ACTGTAAGCTTCGTGAGGGCAGG + Intronic
999707749 5:154289488-154289510 ACTGTAAGCTTCTTGAAGGCAGG - Intronic
999769050 5:154761331-154761353 ACTCTGAACCTCCTGAGGGTCGG + Intronic
999977555 5:156927013-156927035 ACTGTAAATTTCTTGAGGGTAGG - Intronic
1000154480 5:158537016-158537038 ATTGTAAACTCTTTGAAGGTAGG + Intergenic
1000770271 5:165344299-165344321 AATATAAGTTTCCTGAAGGTAGG + Intergenic
1001238638 5:170050937-170050959 ACTGTAAGCTCCCTGAACGTAGG - Intronic
1001802480 5:174556264-174556286 AATGTAAACTCCCTGAGGGCAGG + Intergenic
1003383030 6:5641969-5641991 ACTGTTAACTCCTTGAGGGTAGG + Intronic
1003386959 6:5677808-5677830 ATTGTGAAATTCCTGAGGGTAGG + Intronic
1003491815 6:6628707-6628729 ACTTTAAACTCCTTGAAGGAAGG + Intronic
1003814647 6:9825032-9825054 ACGCTAAGCTTCCTGAATGTAGG + Intronic
1003925688 6:10875568-10875590 ACTGTTAACTTCCTGTTGGTAGG + Intronic
1003963943 6:11235468-11235490 ACTGTAAGCTCCATGAAGATGGG - Intronic
1005078986 6:21937986-21938008 ACTCTAAGCTGCTTGAAGGTAGG + Intergenic
1005394417 6:25366554-25366576 AATGTAAACCTCCTGAAGGCAGG + Intronic
1005704181 6:28435298-28435320 ACTGTAAACTTCGTGAGAGTGGG + Intronic
1006000148 6:30958285-30958307 ACTGTGAGCTCCCTGAAGGCAGG - Intergenic
1006145584 6:31957413-31957435 ACTGTAAGCTTCTTGAGGGTAGG - Intronic
1006540584 6:34736750-34736772 ACTTTAAACTGCCTTCAGGTTGG - Intergenic
1006955201 6:37863423-37863445 AGTTTAAACTACCTGTAGGTTGG - Intronic
1007267849 6:40610688-40610710 CTTGGAAACTTCTTGAAGGTAGG - Intergenic
1007286182 6:40749079-40749101 ACTGTAAGCTTCCAGAGGGCAGG + Intergenic
1007501676 6:42303220-42303242 ATTGTAAGCTCCATGAAGGTAGG - Intronic
1008020905 6:46576038-46576060 ATTGGAAGCTTCCTGAAGTTCGG - Intronic
1008469547 6:51868334-51868356 ACTATAGACTGCATGAAGGTAGG - Intronic
1008493693 6:52111633-52111655 ACTGTAAGCTTCCTGAGGGCAGG - Intergenic
1008518118 6:52337409-52337431 ACTATAAGCTTCTTGAAGATAGG - Intergenic
1010022603 6:71178188-71178210 ACTGTAAACTTCTTGAGAGCTGG + Intergenic
1010167872 6:72938767-72938789 ACTATAAGCTTCTTGATGGTAGG - Intronic
1011207703 6:84918165-84918187 ACTGTAAACTTTTTTAAGGAGGG - Intergenic
1011263322 6:85490633-85490655 ACTGGAGAGTTCCTGCAGGTGGG + Exonic
1011419105 6:87153236-87153258 ACTGTAAGCTTCTTCAAGGCAGG + Intronic
1012421908 6:99075106-99075128 ACTGTAAACTTCATGAGGCCAGG - Intergenic
1012881713 6:104798920-104798942 ATTGTAAACTTCCTGACAGTAGG + Intronic
1012884244 6:104826313-104826335 ACTATAAACTTCTTGAAGGCAGG - Intronic
1013817821 6:114119839-114119861 ACTGTAAATTTCCTGAGGGCAGG - Intronic
1013823105 6:114179140-114179162 AATGTAAGCTCCATGAAGGTAGG + Intronic
1013987343 6:116211024-116211046 ACTGTAAAATTCCTAAAACTAGG + Intronic
1014159094 6:118146682-118146704 CCTCTAAACTTCCTGGAGGCAGG + Intronic
1014440599 6:121469390-121469412 AATGTAAACTTCTTGAGGGCAGG + Intergenic
1014832065 6:126114508-126114530 ACTGTGAGCTCCTTGAAGGTGGG + Intergenic
1014962693 6:127706568-127706590 ACTGTAAACCCCCTGAAGGCAGG - Intergenic
1015001600 6:128223116-128223138 ACTGAAATCATTCTGAAGGTAGG + Intronic
1015349078 6:132195541-132195563 ACAGCAAAATTCCTGAAGGCAGG - Intergenic
1015473515 6:133633740-133633762 ACTGTAAGCACCCTAAAGGTAGG - Intergenic
1016097819 6:140059824-140059846 ACTGTAAACTCCCTGAGGACAGG - Intergenic
1016389698 6:143562308-143562330 ATTGTAAACTTCCTGAGGCCTGG - Intronic
1016714537 6:147209624-147209646 ACTGGAAACTTTTTGAAGGAAGG - Intronic
1016801758 6:148175928-148175950 GCTGTAAGCTTCCAGAAGGCAGG - Intergenic
1017157739 6:151337544-151337566 ACTGTAAACATACAGAAAGTTGG + Intronic
1017164762 6:151397395-151397417 ACTGTAAGCTCCCTGAGGGCAGG + Intergenic
1017342311 6:153338471-153338493 ACTGCAAATTCCATGAAGGTAGG + Intergenic
1018514644 6:164565586-164565608 ACTGTAAACTTCTTGAAAGCAGG + Intergenic
1020040499 7:4997444-4997466 ACTGTGAACTCCTTGAAGGCAGG - Intronic
1020234723 7:6346900-6346922 ACTGTAAACTCCCCAAAGGAGGG + Intronic
1020451553 7:8325447-8325469 AATGAAAGCTTCATGAAGGTAGG - Intergenic
1021460410 7:20880453-20880475 ACTGTAAGCTTCATGAAGAGTGG + Intergenic
1021821877 7:24506548-24506570 ACTATAAGCTTCTTGAAGGCAGG - Intergenic
1021908576 7:25361337-25361359 AATGTAAGCTTCTTGAAGGCAGG + Intergenic
1021970527 7:25961197-25961219 ACTGTAAGCTCCCTGAGGGCAGG + Intergenic
1022657319 7:32331356-32331378 CCTGTAAACTCCATGAAGGCAGG - Intergenic
1022836038 7:34116170-34116192 AATGTAAACTACATGATGGTAGG + Intronic
1024244795 7:47461094-47461116 ACTGTAAGCTTCCCAAAGGCGGG - Intronic
1024378188 7:48663249-48663271 ATTATAAACTCCATGAAGGTAGG - Intergenic
1025779033 7:64582942-64582964 ACTGTAGTCTGCCTGAAGTTGGG + Intergenic
1026275098 7:68869757-68869779 ACTGTAAACTGTATGAAGGCAGG + Intergenic
1027196151 7:76031898-76031920 ACTATAACCTTCATGAAGGCAGG - Intronic
1027321137 7:77010979-77011001 AGTGTGAAGTTCCTGAATGTTGG - Intergenic
1027923657 7:84431809-84431831 ACTGTAAACTCTTTGAAGGCAGG - Intronic
1028417378 7:90595540-90595562 ACTGTAACCCTCCAGAAGGCAGG - Intronic
1028728931 7:94122423-94122445 ACTGTAAACTCCTTGAAGAAAGG + Intergenic
1029046386 7:97633741-97633763 ACTGTAAACTCTCTGAAGGCAGG - Intergenic
1030701938 7:112649550-112649572 ACTGTAAACTTCCCAAATTTGGG + Intergenic
1030740711 7:113106193-113106215 ACTTTAAACTTCTTTTAGGTAGG + Intergenic
1031441554 7:121800763-121800785 ACTGTAAGCTTCCTGGACATGGG - Intergenic
1031601884 7:123720010-123720032 ACTGTCAACTCCTTGAAGATAGG + Intronic
1031731249 7:125303351-125303373 AATGTAAACTTCATGAAGGTAGG + Intergenic
1031799600 7:126225352-126225374 AGTGTGAACTTCCTGAAGTCTGG + Intergenic
1032237951 7:130141000-130141022 AATGGAAACTTCCCGAAGGCAGG - Intergenic
1033461403 7:141550584-141550606 AATGTAAACTGTCTGGAGGTTGG + Intergenic
1033889239 7:145988399-145988421 ACTGTAAACTACATGAACTTTGG - Intergenic
1034343210 7:150370987-150371009 CCTGGAAACTTCCAGAAGGGAGG - Intronic
1034587394 7:152106995-152107017 TCTGTAAACAGCCTGAAGGGTGG - Intronic
1035288801 7:157824156-157824178 CCTGTGACCCTCCTGAAGGTAGG + Intronic
1037028257 8:14067403-14067425 ACTGTAAACTTCAGGAAGACAGG + Intergenic
1037590228 8:20305617-20305639 AGTGTAAATTCCCTGAAGGCAGG + Intergenic
1037827338 8:22167276-22167298 ACTGTAAGCTCCTTGAAGGCAGG - Intronic
1038054531 8:23845946-23845968 ACTGTAAGCTTACTGAAGGCAGG + Intronic
1038077977 8:24099352-24099374 ACAGTAAATATCCTGATGGTAGG + Intergenic
1038588204 8:28810741-28810763 ACTGTTCATTTCCTGAATGTTGG - Intronic
1038760712 8:30382979-30383001 ACTTTAAACTCCCTAAAGGGAGG + Intergenic
1039784366 8:40819595-40819617 ACTGCAAGCTTCCTGAGGGCAGG - Intronic
1039868339 8:41525403-41525425 ACTGTAAAGTTCAGGAAGGTGGG - Intergenic
1040751933 8:50720481-50720503 ACTGTAGACTTCTTGAGGGGAGG - Intronic
1040963488 8:53060827-53060849 ACTGTGAGCTTCCTGAGGGAGGG - Intergenic
1041012006 8:53553347-53553369 ACTGTGACCTCCTTGAAGGTAGG - Intergenic
1041237699 8:55821283-55821305 AATGTAAAATTCATGGAGGTGGG + Intronic
1041345443 8:56892091-56892113 ACTGTACTCTTTCTGAAGCTGGG + Intergenic
1041444047 8:57930927-57930949 ACTGTGAACTTCTCCAAGGTAGG + Intergenic
1041713895 8:60916329-60916351 ACTGTAAACTCCCTGTAGGCAGG - Intergenic
1041786656 8:61641731-61641753 ACTGTAAACTCCTTGAAAGGAGG + Intronic
1042592638 8:70412046-70412068 ACTGTAAACTCCCTGAAGACAGG + Intergenic
1042665291 8:71197417-71197439 ACTGTAAGCTCCCTGACTGTCGG - Exonic
1042950127 8:74192598-74192620 ATTGTAAACTCTGTGAAGGTAGG - Intergenic
1042964245 8:74334102-74334124 ACTGTAAATTCCCTGAGGGCAGG - Intronic
1042982925 8:74550622-74550644 TCTGTAAACTTCATGAAGTCAGG + Intergenic
1043026278 8:75073297-75073319 ATGGTAAACTTCTTGAAGGCAGG + Intergenic
1043226202 8:77734241-77734263 TCTCTAAACTTCTTGAAAGTAGG + Intergenic
1043247497 8:78023573-78023595 AGTGTAAACCACATGAAGGTAGG - Intergenic
1043544273 8:81297510-81297532 ATTGTAAACTTACTGAGGGCAGG - Intergenic
1044090140 8:87989996-87990018 ACTGTAAACATCTAGAAGCTAGG + Intergenic
1045021511 8:98048265-98048287 ACTATTAGCCTCCTGAAGGTAGG - Intergenic
1045295833 8:100871136-100871158 CGTGTAAGCTTCCTGAAGGCAGG - Intergenic
1045765537 8:105663203-105663225 ACTGTAAACTCCATGAAGCCAGG - Intronic
1045982207 8:108203714-108203736 ACTGTAAAATCCTTGAGGGTAGG + Intronic
1046357547 8:113107819-113107841 ACTGTAAACTTCATAAAGGCAGG + Intronic
1046631168 8:116624285-116624307 ACTGTAAACTCCTTGAGTGTAGG - Intergenic
1046651019 8:116836789-116836811 AATGTAAACTTCATGAGGGCTGG - Intronic
1047204214 8:122790450-122790472 ACTATGACCTTCCTGAAGGCAGG - Intronic
1047407871 8:124600484-124600506 TCTGTGAGCTTCCTGAAGGCAGG + Intronic
1047571730 8:126106155-126106177 ACTGTGAACCTCATGAAGGCAGG + Intergenic
1047839646 8:128737022-128737044 ACTGTAAATTTCCTGACAGCAGG - Intergenic
1048436392 8:134422581-134422603 ACTGTGAACTCCCAGAAGATGGG - Intergenic
1048488492 8:134870230-134870252 ACTTTCAACTGCTTGAAGGTGGG - Intergenic
1048613288 8:136047648-136047670 ACTGTAAACACCTTGAAGGCAGG + Intergenic
1048628208 8:136210453-136210475 ACTGTAAGCTTCCTGAGAGTGGG - Intergenic
1048933768 8:139338676-139338698 ACTGTCAGCTCCCTGAAGGCTGG - Intergenic
1050434424 9:5593819-5593841 ACTGTAAGCTTCCAGGAGTTGGG + Intergenic
1050713312 9:8490830-8490852 ATAGTAAACTTCCTGATTGTGGG - Intronic
1052139915 9:24968063-24968085 ACTAGGAACTTCTTGAAGGTTGG - Intergenic
1053116684 9:35510557-35510579 ACTATAAACTCCATGAAGGCAGG + Intronic
1053385219 9:37681824-37681846 ATTGTAAACTCCTTGAGGGTAGG - Intronic
1053410868 9:37915263-37915285 ACTGGAAACTTCTTGAGGGCAGG + Intronic
1053604748 9:39645792-39645814 CCTCTAAACTTCTTGAAGGAAGG + Intergenic
1053862562 9:42401804-42401826 CCTCTAAACTTCTTGAAGGAAGG + Intergenic
1054248794 9:62696623-62696645 CCTCTAAACTTCTTGAAGGAAGG - Intergenic
1054562906 9:66731149-66731171 CCTCTAAACTTCTTGAAGGAAGG - Intergenic
1054841771 9:69749800-69749822 ACTGTAAGCTTCCTGAATAAAGG + Intronic
1055099106 9:72445002-72445024 ACTGTAAGCTCCCTGAAGCCAGG + Intergenic
1055621997 9:78135536-78135558 ACTGTAAACTTCTTGAGGGTAGG + Intergenic
1055752596 9:79523407-79523429 ACTACAAACTTCATGAGGGTGGG - Intergenic
1055776009 9:79767844-79767866 ACTGAAAGCTCCCTGATGGTAGG + Intergenic
1055996712 9:82168123-82168145 ACTGAAAACTTTCTGTAGCTTGG + Intergenic
1056210070 9:84357079-84357101 ACTGTCAGCTTCATGAAGGCCGG + Intergenic
1056461853 9:86816532-86816554 AGTTCCAACTTCCTGAAGGTTGG - Intergenic
1056573691 9:87838220-87838242 ACTGTAAGCAACCTGAAGGGAGG + Intergenic
1056771922 9:89483897-89483919 ACTGAAACCTTCCTGAGGCTTGG + Intronic
1057544867 9:96010800-96010822 ACTGTAAACTCCTTGAAGATAGG + Intronic
1057834236 9:98431351-98431373 ACTGTAAACTCTCTGAAGAAAGG + Intronic
1058028370 9:100167678-100167700 AATATAAACTCCCTGAAGTTGGG + Intronic
1058058027 9:100468855-100468877 ACTGTAAACTTCCTAAGGACAGG + Intronic
1058063438 9:100523389-100523411 ACTGTGAGCTTCCTGAGGGCAGG + Intronic
1058117577 9:101102065-101102087 CTTGTAAACTCCTTGAAGGTAGG + Intronic
1058321844 9:103641838-103641860 AATGTAAACTTCTTGAAGGCAGG - Intergenic
1058838673 9:108883461-108883483 ACTGTAAAACTCTTGAAGGCTGG - Intronic
1059484870 9:114618855-114618877 AGTGTAAGCTCCCTGAAGGAAGG + Intronic
1059699870 9:116764720-116764742 ACTCTAAACTCCTTGAAGGCAGG - Intronic
1060629715 9:125144435-125144457 ATTATAAAATTCTTGAAGGTGGG + Intergenic
1060807073 9:126584564-126584586 ACTGGAAGTTTCTTGAAGGTAGG - Intergenic
1186582597 X:10836757-10836779 ACTGTAAGCTCCATGAGGGTGGG - Intergenic
1186613480 X:11162000-11162022 AAGGTAAATTTCCTGAAGGCAGG + Intronic
1186814942 X:13227149-13227171 ACTGTAAGCTTTATGAAGGCAGG - Intergenic
1186863040 X:13691874-13691896 ACTGTAAGCTTCAGGAAGGTTGG - Intronic
1186920220 X:14270392-14270414 ACTGTAAACACCCAGAAGGCAGG + Intergenic
1187427578 X:19192315-19192337 GGTGTAAACTTCAGGAAGGTAGG - Intergenic
1187884342 X:23875306-23875328 ACTGTAGACTTCTTGAAGGTGGG - Intronic
1187888959 X:23915373-23915395 ACTGTAAGCTTCATGAAGGTAGG - Intronic
1188153156 X:26704354-26704376 ACTGTAGCCTTCTTGAAGGCAGG - Intergenic
1188544813 X:31293348-31293370 TCTGTATACTTTCTGAATGTGGG + Intronic
1189113064 X:38313818-38313840 ACTGTAAACTTCAGAAGGGTAGG + Intronic
1189266682 X:39722102-39722124 ACTGTGAATTTCCTGAGGGCAGG - Intergenic
1189612076 X:42747788-42747810 AATGTAAGCTTCATGAAGATGGG + Intergenic
1190398766 X:50010890-50010912 ACTGTACACTCCATGAAGGTAGG - Intronic
1190438705 X:50454293-50454315 ACTGTAATTTGCCTGAAGGAAGG - Intronic
1191082982 X:56533414-56533436 ACTGTAAATGTCCTGAATTTTGG - Intergenic
1192222483 X:69206886-69206908 ACTGGAAGCTTCCTGGAGGCAGG - Intergenic
1193322273 X:80136834-80136856 ATTGTAAACTTCACGAAGGTAGG - Intergenic
1193810911 X:86049846-86049868 AATGTAAACTTCATGAAGACAGG - Intergenic
1195957474 X:110347231-110347253 ATTATAAACTTCCACAAGGTTGG - Intronic
1195986829 X:110639485-110639507 ACTGTAAGCTTGATAAAGGTGGG - Intergenic
1196731947 X:118949871-118949893 ACTGTGAACTTACTGAGGGAAGG - Intergenic
1197358901 X:125473231-125473253 ACTGTAAACTCCTTGAGGGCAGG + Intergenic
1197586914 X:128359667-128359689 ACTGTGAGCTACCTGAAGGCAGG - Intergenic
1198495629 X:137189751-137189773 ACTGATAACTTCATGAAGCTGGG - Intergenic
1198764865 X:140070220-140070242 ACAGTAGAGTCCCTGAAGGTAGG - Intergenic
1198801021 X:140447790-140447812 ACTGTAAACTACATAAAGGCAGG + Intergenic
1199019475 X:142860276-142860298 ATTGTAAACTCCTTGAAGGCAGG - Intergenic
1199192522 X:144987330-144987352 ACTGTAAACTCCCTGAGGCCAGG - Intergenic
1199398465 X:147368144-147368166 ACTATAAACTCCATGAAGGCAGG - Intergenic
1200228116 X:154430579-154430601 AATGTCAGCTTCCTGAGGGTGGG - Intronic