ID: 1091550771

View in Genome Browser
Species Human (GRCh38)
Location 12:1533444-1533466
Sequence CAGCCAAGGCTGCCCGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091550771 Original CRISPR CAGCCAAGGCTGCCCGTAAG TGG (reversed) Intronic
902053883 1:13584417-13584439 CAGCCACTGCTGCCAGCAAGCGG - Intronic
902704596 1:18195914-18195936 CAGAGAAGGCTTCCCGGAAGAGG + Intronic
903051399 1:20603865-20603887 AAGCCAAGGCTGCTCCTAGGAGG - Intronic
905258997 1:36704440-36704462 CAGCCCTGGCTGCCAGTCAGAGG - Intergenic
909700851 1:78521035-78521057 CAGCCTAGGCAGCCCGCATGTGG - Intronic
917731953 1:177883278-177883300 CAGGAAAGGCTGCCAGGAAGAGG + Intergenic
1064029945 10:11877380-11877402 CTGCCAAGGCTGCCCTCAAATGG - Intergenic
1067787232 10:49259570-49259592 CAGCCAAGGCTGCCTGTGGTTGG + Intergenic
1069076373 10:64042067-64042089 CCACCAAGGCTGACCTTAAGGGG + Intergenic
1072741457 10:97912460-97912482 CAACCAAGGCTGCCCTTTGGGGG - Intronic
1076317371 10:129551956-129551978 CAGCCCAGGCTTGCCGGAAGTGG + Intronic
1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG + Intronic
1081762406 11:45585426-45585448 CAGGGAAGGCTGCCTGCAAGAGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084516862 11:69642181-69642203 CGGCCCAGGCTGCCCGTTCGGGG - Intronic
1087225224 11:95591728-95591750 CAGGCAAGGTTGCCAGTTAGTGG + Intergenic
1088102103 11:106167000-106167022 CAGCCAAGGCTGAGTCTAAGAGG - Intergenic
1089352244 11:117828343-117828365 CAGCCCAGGGTGCCCGAAAAGGG + Intronic
1091046678 11:132331750-132331772 CAGGGAAGGCTGCCTGCAAGAGG + Intronic
1091550771 12:1533444-1533466 CAGCCAAGGCTGCCCGTAAGTGG - Intronic
1093059177 12:14584771-14584793 CAGCTAATGCTGCCAATAAGAGG - Intergenic
1103948305 12:124539063-124539085 CAGCCCAGGCTGCCCGCGAGCGG + Intronic
1105727849 13:23183467-23183489 CAGCCATGGCTGCTCAGAAGGGG + Intronic
1105862424 13:24427683-24427705 TAGCCAAAACTGCTCGTAAGTGG + Intronic
1107726177 13:43301831-43301853 CAGACAAGGCTGCCTGGAAGAGG + Intronic
1108527586 13:51299273-51299295 CACCCAAGGCAGCCCTTATGAGG + Intergenic
1118769724 14:68934286-68934308 CTGGCAAGACTTCCCGTAAGGGG + Intronic
1122787256 14:104169408-104169430 CGGCCAAGGCTGCCCCCAGGAGG - Intronic
1122835285 14:104427717-104427739 CAGGGAAGGCTTCCCGTAGGAGG - Intergenic
1122930347 14:104930606-104930628 CAGGCAATGCTTCCCGCAAGTGG + Intronic
1128494293 15:68184166-68184188 CAGCTAATGTTGCCAGTAAGAGG + Intronic
1133201279 16:4206176-4206198 CAGCCAAAGCTGCCCTCAAAGGG - Intronic
1137403081 16:48169277-48169299 CAGCCTAGGCTGCCTGATAGCGG - Intronic
1138206831 16:55131462-55131484 CAATCAAGGCTGCCCTTTAGTGG + Intergenic
1138644954 16:58417955-58417977 CAGCCAAGCCTGCCCTGCAGGGG - Intergenic
1142617014 17:1142658-1142680 CAGGGAAGGCTGCCCGGAAGAGG + Intronic
1143587410 17:7857231-7857253 CAGCCCAGGCTGCCCGCCCGCGG + Exonic
1145031933 17:19510914-19510936 GAGCCAAGGATGCCAGTATGTGG - Intronic
1146482279 17:33214264-33214286 CAGCCAAGGGTACAAGTAAGAGG - Intronic
1146693067 17:34889888-34889910 CAGGGAAGGCTTCCTGTAAGAGG - Intergenic
1148737780 17:49874480-49874502 CAGCCAGGGCTGCCCCTCTGTGG + Intergenic
1151354322 17:73549581-73549603 CAGGGAAGGCTTCCCGGAAGAGG + Intronic
1151696694 17:75721590-75721612 CAGCCGAGGCTGGCCGGGAGAGG + Exonic
1152521117 17:80857573-80857595 CAGTCAAGGCTGGCAGTATGTGG + Intronic
1153913709 18:9726485-9726507 CAGGCAAGGTTCCCCGTTAGAGG - Intronic
1156471724 18:37381308-37381330 CAGACAAGGCTTCCTGTAGGAGG + Intronic
1160855572 19:1215665-1215687 GAGCCAAGGCTTCCTGCAAGAGG + Intronic
1163400881 19:17091768-17091790 CAGCCAGGGCTGCAGGGAAGGGG - Intronic
926800876 2:16659522-16659544 AAGCCCAGGCTGCTTGTAAGTGG + Intronic
927808467 2:26168907-26168929 CTGGCCAGGCTGCCCGTGAGCGG - Intergenic
929939579 2:46322905-46322927 CAGCCAAACCTACCCGTCAGTGG + Intronic
930818860 2:55625604-55625626 AAGCCAAAGTTGCCCGTTAGAGG - Intergenic
931407453 2:61993607-61993629 CAGCCTAGGCTGCCAGTAGATGG + Intronic
932469734 2:71945925-71945947 CAGAGAAGGCTGCCTGGAAGAGG + Intergenic
933346326 2:81090473-81090495 CAGCCAAGTCTGACATTAAGAGG - Intergenic
934782168 2:96977675-96977697 CAGCAAAGGCTGCACGCAATGGG + Intronic
935502372 2:103857161-103857183 CCACCAAGGCTGCCAGTCAGGGG - Intergenic
935881695 2:107572106-107572128 CAGCCAAAGCTGCCTGCATGAGG - Intergenic
936589392 2:113788731-113788753 CAGTCAAGACTCCCCATAAGGGG + Intergenic
936966114 2:118129119-118129141 TAGCCAAGGCAGCATGTAAGAGG - Intergenic
944147232 2:196518825-196518847 CAGAGAAGGCTGCTTGTAAGAGG - Intronic
945529022 2:210926817-210926839 TAGCCAAAGCTGCCCATTAGAGG + Intergenic
946466407 2:219915852-219915874 AAGGCAACGCTGCCTGTAAGTGG + Intergenic
948853869 2:240721153-240721175 GAGCCAAGGCTGCTGGTAGGAGG - Intronic
1168831414 20:847086-847108 CAGCCAAGGCAGCCTGTGAAAGG - Intronic
1172530447 20:35627289-35627311 CAGCCCAGGCTGCACATCAGGGG - Exonic
1172815033 20:37679518-37679540 CAGGGAAGGCTGCCTGTCAGAGG + Intergenic
1173161011 20:40652768-40652790 CAGCCCAGAATGCCTGTAAGAGG + Intergenic
1173709854 20:45145312-45145334 AAGCCAAGGTTGCCCGAATGGGG + Intergenic
1175301697 20:57947612-57947634 GAGCCAAGGCTGACCCGAAGGGG + Intergenic
1175703040 20:61154447-61154469 CAGTCAAGGCTGACAGTAAGAGG - Intergenic
1178896671 21:36564484-36564506 CAGCCAAGGCTGTCCTCCAGGGG - Intronic
1179460350 21:41530630-41530652 CAGCCAACCCTGCTCGTTAGTGG - Intronic
1180391525 22:12287746-12287768 CTGCCAAGGCTGCCTGGGAGTGG + Intergenic
1180408220 22:12577008-12577030 CTGCCAAGGCTGCCTGGGAGTGG - Intergenic
1181088499 22:20456417-20456439 AAGCCAAGGCTGCCCCTCTGTGG + Intronic
1183004953 22:34893549-34893571 CAGCCCATGCTGCAGGTAAGGGG + Intergenic
1183175881 22:36224497-36224519 CAGTCCAGGCTGCCTGGAAGGGG + Intergenic
1183479410 22:38055183-38055205 CTGCTAAGGCTGCCGGGAAGAGG + Intergenic
950630463 3:14278646-14278668 CGGCCAAGGCTGCCCAGAATGGG + Intergenic
951017660 3:17747444-17747466 GAGCCAAAGCTGCCTGTTAGAGG - Intronic
953885303 3:46711613-46711635 CAGCCAGGCCTGCCCATAAAAGG - Intergenic
963057702 3:141200895-141200917 CACCCAAGGCTCCCTGGAAGAGG + Intergenic
966231088 3:177653024-177653046 GAGACAAGGCAGCCCGCAAGAGG - Intergenic
969460987 4:7328881-7328903 CTGCCAAGGGTGCCGGCAAGTGG - Intronic
970232820 4:13928312-13928334 AAGCCAAAGTTGCCCGTCAGAGG + Intergenic
976620872 4:87126176-87126198 CAGCCAAGCCTGCACTTAAGAGG + Exonic
977679687 4:99785184-99785206 CAGCCAAGGAGGCCAGAAAGTGG - Intergenic
985209061 4:187572545-187572567 TAGCCAGGGCTGCCCTTCAGTGG - Intergenic
985411440 4:189689845-189689867 CAGCCCAGGCTGCCCAGCAGAGG - Intergenic
986080628 5:4388866-4388888 TAGCCAAGGCTGCCCTGAACAGG - Intergenic
989141034 5:38201589-38201611 CATCCAATGCTGCCCATCAGGGG + Intergenic
989991662 5:50774442-50774464 CAGCCAAGGCGGCCGGGCAGAGG + Intronic
991674119 5:69075235-69075257 CCGAGAAGGCTGCCCCTAAGAGG - Intergenic
994499076 5:100551398-100551420 AAGCAAAGGCTGCCCATTAGCGG - Intronic
997258261 5:132445799-132445821 CAGTCTATGCTCCCCGTAAGAGG - Intronic
998091514 5:139373605-139373627 CAGCCTGGGCTGCCAGCAAGTGG - Intronic
998198071 5:140093288-140093310 CAGCCAGAGCTCCCTGTAAGTGG - Intergenic
1002685520 5:181006098-181006120 AAGCCATGGCTGCCCTGAAGTGG + Exonic
1003241610 6:4350207-4350229 GAGCCAAAGCTGCCCATAAAGGG - Intergenic
1008525514 6:52403456-52403478 CGGCCAGGGCTGCCAGTAAATGG - Exonic
1017237461 6:152131747-152131769 CAGCCGAGGCGCCCCGCAAGTGG + Intronic
1017875915 6:158524199-158524221 CACCCAGGGCTGCCGGGAAGGGG - Intergenic
1026858229 7:73768926-73768948 CAGCCAAGGCCGCCCCGAGGGGG + Intergenic
1032681902 7:134193840-134193862 GTGCCAAGGCTGTCCGTCAGTGG - Intronic
1032699336 7:134365043-134365065 CAGCCAAGTCTGGCAGTAAAAGG + Intergenic
1033368390 7:140688452-140688474 GAGGCGAGGCTGCCCTTAAGGGG + Intronic
1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG + Intronic
1037949617 8:23010413-23010435 CAGGGAAGGCTGCCCGTCTGGGG + Intronic
1040801672 8:51349200-51349222 CAACCAAGGCTGCCCTGAATGGG - Intronic
1040985937 8:53294603-53294625 CAGCTGAGGCTGCCCTGAAGGGG - Intergenic
1044803293 8:95978941-95978963 CAGACAAGGCTTCCCATAGGAGG - Intergenic
1048779620 8:137987082-137987104 TAGCCAAAGCTGCCCGTATTGGG - Intergenic
1052898646 9:33771227-33771249 CAGCCAAGGCTGGTCTTAAAGGG - Intronic
1056936730 9:90920197-90920219 CAGCCAAGGCTGTCCAGGAGGGG - Intergenic
1058359839 9:104131586-104131608 CTGCTAAGGCTGACCTTAAGAGG + Intronic
1060196682 9:121628586-121628608 CAGGGAAGGCTTCCCGGAAGAGG + Intronic
1061149803 9:128822251-128822273 CAGGGAAGGCTGCCTGGAAGAGG + Exonic
1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG + Intergenic
1062475085 9:136722721-136722743 CACCCAAGGCTGCCAGGAGGCGG + Intronic
1186637191 X:11419147-11419169 CAGCCAAGGCTGCAAGTCAGTGG + Intronic
1187023266 X:15406688-15406710 CAGCCATGGGTTCCCGTAAAAGG - Intronic
1187581271 X:20610055-20610077 CAGCCAAGGCTGCCCCTCAGGGG - Intergenic
1188537068 X:31209143-31209165 CAGCCATGGCCGCCAGTGAGAGG + Intronic
1189216559 X:39330120-39330142 GAGCCAAGGTTGCCTGTCAGAGG - Intergenic
1190339574 X:49286181-49286203 CAGCCACAGCAGCCCGTAGGCGG - Exonic
1192929049 X:75785345-75785367 CAGCCTAGCCTGCCCTTCAGAGG - Intergenic
1193198006 X:78656989-78657011 CATCCAGGCCTGCCAGTAAGGGG - Exonic
1199340181 X:146668499-146668521 CAGGGAAGGCTTCCTGTAAGAGG - Intergenic